Células endoteliales Co-cultura media la maduración de embriones humanos de células madre a las células productoras de insulina del páncreas en un enfoque de diferenciación dirigida

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

El estudio actual describe un enfoque de diferenciación dirigida en la inducción de diferenciación pancreática de células madre embrionarias humanas. De gran importancia es la constatación de que las células endoteliales de co-cultivo de maduración media de las células madre embrionarias derivan en células progenitoras pancreáticas de insulina que expresan.

Cite this Article

Copy Citation | Download Citations

Jaramillo, M., Banerjee, I. Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach. J. Vis. Exp. (61), e3759, doi:10.3791/3759 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Las células madre embrionarias (ESC) tienen dos características principales: pueden ser propagadas in vitro indefinidamente en un estado indiferenciado y que son pluripotentes, lo que tiene el potencial de diferenciarse en múltiples linajes. Estas propiedades hacen que CES sumamente atractiva para la terapia celular regenerativa y aplicaciones basadas en el tratamiento 1. Sin embargo, para todo su potencial para llevarse a cabo las células que se diferencian en fenotipos maduros y funcionales, que es una tarea de enormes proporciones. Un enfoque prometedor en la inducción de diferenciación celular es para imitar el camino de la organogénesis en el en el establecimiento in vitro. El desarrollo del páncreas se sabe que se producen en etapas específicas 2, a partir del endodermo, que pueden desarrollarse en varios órganos, incluyendo el hígado y el páncreas. Endodermo inducción se puede lograr por la modulación de la vía nodal mediante la adición de activina A 3 en combinación con varios factores de crecimiento 4-7 in vitro mediante la adición de ciclopamina 8. Maduración de páncreas está mediada por varios eventos paralelos, que incluyen la inhibición de la muesca de señalización; agregación de células progenitoras pancreáticas en 3-dimensionales racimos; inducción de la vascularización; para nombrar unos pocos. Con mucho, el más exitoso en la maduración in vitro de células derivadas de CES pancreáticas progenitoras se han logrado a través de la inhibición de la señalización Notch por la suplementación DAPT 9. Aunque tuvo éxito, esto da como resultado un bajo rendimiento del fenotipo maduro con funcionalidad reducida. Un área menos estudiada es el efecto de la señalización de las células endoteliales en la maduración de páncreas, que es cada vez más apreciado como un factor importante que contribuye a la maduración in vivo los islotes pancreáticos 10,11.

El presente estudio explora estos efectos de endotelioial de señalización celular en la maduración de los humanos derivados de la CES, las células pancreáticas productoras de insulina en progenitoras de los islotes, como las células. Se presenta un protocolo de múltiples etapas de diferenciación dirigida, donde los humanos CES primero se induce hacia endodermo por activin A junto con la inhibición de la vía PI3K. Especificación de las células de páncreas endodermo se logra mediante la inhibición de la señalización erizo sónico por ciclopamina junto con la inducción de retinoide por adición de ácido retinoico. La etapa final de la maduración es inducida por la señalización de las células endoteliales consigue una configuración de co-cultivo. Mientras que varias células endoteliales han sido probados en el co-cultivo, en este documento se presentan los datos con las células de rata microvasculares endoteliales del corazón (RHMVEC), principalmente por la facilidad de análisis.

Protocol

1. Mantenimiento de la célula

  1. HESC H1 (WiCell) se mantuvieron en hESC calificados matrigel pozos revestidos con mTeSR1 los medios de comunicación, con los medios de comunicación cambian todos los días. Los pocillos se recubre por una solución diluida de Matrigel, preparado mediante la adición de 300 l de Matrigel hCME en 25 ml de DMEM: F12. 1 ml de esta solución Matrigel se añadió a cada pocillo de una placa bien seis, o 400 l añadió a cada pocillo de una placa de 12 pocillos y se dejó capa durante 1 hora a temperatura ambiente. Las células se pasaron mecánicamente en una relación de separación de 1:4 por raspado colonias una vez que se alcanzó entre 1 y 1,5 mm de diámetro.
  2. RHMVEC (tecnologías de la VEC) se mantuvo en MCDB-131 medios de comunicación con los medios de comunicación cambian cada dos días. Las células se dividieron por tripsinización una vez 80% de confluencia se alcanzó en una relación de separación de 1:3. Las células endoteliales entre pasajes 3 y 7 se utilizaron para este estudio.

2. Preparación de las soluciones de archivo

  1. Activina A se reconstituyó a 50 mg / ml de P estérilesBS que contenía 0,1% de suero de albúmina bovina. La solución se dividió en alícuotas y se almacenó a -20 ° C.
  2. EGF se reconstituyó a 500 mg / ml en el estéril de 10 mM de ácido acético. La solución se dividió en alícuotas y se almacenó a -20 ° C.
  3. La insulina se reconstituyó en 10 mg / ml mediante la adición de H 2 O acidificada (pH ≤ 2), preparado por adición de 0,1 ml de ácido acético glacial a 10 ml de agua.
  4. DAPT se reconstituyó en DMSO a 18 mg / ml. Se diluyó adicionalmente a la concentración mM 300 en DMEM: F12, alícuotas y se almacenó a -20 ° C.
  5. KAAD-ciclopamina se reconstituyó en DMSO a 5mg/ml. Se diluyó adicionalmente a la concentración mM 2 en DMEM: F12, alícuotas y se almacenó a -20 ° C.
  6. Ácido trans-retinoico se reconstituyó en 2,7 mg / ml en 95% de etanol. Se diluyó adicionalmente a la concentración de 2 mM en DMEM: F12, alícuotas y se almacenó a -80 ° C.

3. Endodermo definitivo (DE) y la inducción pancreáticas progenitoras (PP)

  1. Una vez que hColonias CES alcanzado entre 1 y 1,5 mm de diámetro, la inducción DE se realizó mediante la adición de DMEM: F12 suplementado con B27, 0,2% de BSA, 100 ng / ml de activina A y 1 Wortmannin mM durante 4 días (día 0-día 4) con los medios cambian todos los días.
  2. Después de la inducción DE fue completa, la inducción de páncreas progenitora fue inducida por el cambio de soporte a DMEM: F12 suplementado con B27, 0,2% de BSA y KAAD ciclopamina-a una concentración de 0,2 mM durante 24 horas (Día 4-Día 5).
  3. Después de 24 horas medio se cambió a DMEM: F12 suplementado con B27, 0,2% de BSA, KAAD-ciclopamina a una concentración de 0,2 mM y ácido trans-retinoico en una concentración mM 2 durante 3 días con los medios de cambiar cada día (Día 5-Día 8) .

4. La maduración de páncreas

  1. Después de la inducción del PP, todos los grupos se cambió a los medios de maduración compuestas de DMEM: F12 suplementado con B27, 0,2% de BSA, 10 mM de nicotinamida, 25 mg / ml de insulina, 30 nM de Na 2 g Seo 3 y 50 / ml para la transferrina 2 days con los medios de comunicación cambian todos los días (día 8-Día 10).
  2. Después de 2 días en los medios de maduración, la etapa de maduración final se lleva a cabo en paralelo usando diversas condiciones para la comparación. La diferenciación fue inducida en las siguientes condiciones: i) con la muesca inhibidor DAPT (ii) el uso de co-cultivo único medio de comunicación, sin que las células endoteliales como el control y (iii) mediante el contacto co-cultivo con células RHMVEC. Las células se mantuvieron en los medios de dApt o compañero de la cultura durante una semana (Día 10 Día 17) con los medios de comunicación cambian todos los días.
    1. Los medios de comunicación dApt fue preparado por complementar los medios de maduración con 30 mM DAPT. Las células de estos grupos fueron expuestos primero en completar MCDB131 durante 24 horas y luego se expusieron a los medios de comunicación dApt durante 6 días (Día 11 Día 17).
    2. Medios de co-cultivo se preparó completándolo MCDB-131 con medios B27, 0,2% de BSA, 10 mM de nicotinamida, 10 ng / ml de EGF, 1 mg / ml de hidrocortisona, 10 mg EndoGro, 90 ug / ml de heparina. Para la condición de control de los medios de comunicación células diferenciadas fueron expuestosa MCDB-131 medio completo durante 24 horas (día 10-Día 11) después de lo cual se cambió el medio a los medios de co-cultivo durante 6 días (día 11-Día 17) (sin células endoteliales).
    3. En caso de contacto condición de co-cultivo, un millón RHMVEC se añadió a las células que se diferencian en completos MCDB-131 medios (tecnologías de la VEC) para 24 horas (día 10-Día 11) para permitir la conexión. Después de los medios de comunicación las 24 horas fue cambiado a los medios de co-cultivo durante 6 días (Día 11 Día 17) con los medios de comunicación cambian todos los días.

5. QRT-PCR Análisis

  1. Al final de cada etapa de la diferenciación (endodermo; progenitora pancreático; islote madura) se lisaron y el ARN se extrajo utilizando NucleoSpin kit de extracción de ARN II de acuerdo con las instrucciones del fabricante.
  2. ARN de calidad se analizó mediante la comprobación absorbancia ARN a 260 nm y 280 nm, seguido por la cuantificación de ARN utilizando un espectrofotómetro SmartSpec Plus.
  3. La transcripción inversa se realizó a través ImProm k II transcripción inversade acuerdo con las instrucciones del fabricante. Todas las reacciones se llevaron a cabo con 100 ng de RNA.
  4. QRT-PCR se realizó utilizando el sistema de Mx3005P QPCR (Agilent) y Brilliant II SYBR Green mezcla maestra QPCR de acuerdo a las instrucciones del fabricante. Los cebadores utilizados se muestran en la tabla 1. El paso de inicialización se realizó a 50 ° C durante 2 minutos, seguido por 95 ° C durante 10 minutos. 50 ciclos de amplificación se realizaron como sigue: 95 ° C durante 30 segundos, 54 ° C durante 30 segundos y 72 ° C durante 1 minuto.
  5. Veces el cambio de expresión mRNA blanco sobre las células indiferenciadas se calcula a partir de valores de CT con las siguientes fórmulas:
    Ct (marcador i) = CT (marcador i) - CT (GAPDH)
    Δ Ct (marcador i) = Ct (marcador i) (Muestra) - Ct (marcador i) (células indiferenciadas)
    La expresión relativa (marcador i) = 2-ΔΔCT(Marcador i)

6. La inmunocitoquímica

  1. Al final de cada etapa de la diferenciación (endodermo; progenitora pancreático; islote madura) las células fueron fijadas en formaldehído al 4% durante 15 minutos a temperatura ambiente.
  2. Las células fijadas se permeabilizaron con 0,25% de Triton X-100 (TX) durante 15 minutos.
  3. Tinción no específica se bloquearon por incubación en suero burro 10% en 0,05% TX durante 30 minutos.
  4. Incubación del anticuerpo primario se realizó la noche a 4 ° C en tampón de bloqueo a la dilución de anticuerpos recomendado (ver tabla 1).
  5. Las células fueron lavadas con TX 0,05% tres veces durante 5 minutos.
  6. Incubación del anticuerpo secundario se realizó durante una hora a temperatura ambiente en la oscuridad con anticuerpos apropiados diluidos en tampón de bloqueo.
  7. Las células fueron lavadas con TX 0,05% tres veces durante 5 minutos.
  8. La tinción nuclear se realizó por incubación con Hoescht mancha en la dilución 1:1000 en PBSdurante 5 minutos, seguido de 3 lavados con PBS.
  9. Las células fijadas y teñidas fueron imágenes utilizando Olympus IX81 microscopio invertido y el software Metamorph imágenes.

7. Los resultados representativos

La adición de activina A y Wortmannin de hESC indiferenciada durante 4 días induce endodermo definitivo según lo confirmado por QRT-PCR en el análisis de marcadores DE Sox17, CXCR4, y FOXA2 y la inmunotinción para Sox17 como se ilustra en la Figura 2. La diferenciación de células progenitoras pancreáticas después de la adición de ácido retinoico y ciclopamina fue confirmada por QRT-PCR de marcadores progenitoras pancreáticas y inmunotinción para Pdx1 como se ilustra en la Figura 3.

En la etapa final de la diferenciación, póngase en contacto con el co-cultivo con células RHMVEC fuertemente inducida por la regulación positiva de la expresión de insulina en las células pancreáticas hESC derivados progenitoras. La eficiencia de la diferenciación mediada por co-cultivo se analizó por comparing con la condición de control utilizando DAPT. DAPT se utilizó como control positivo, ya que es actualmente uno de los métodos más comúnmente utilizados para lograr la maduración de páncreas. Dado que el co-cultivo se realizó en un medio suplementado modificados por factores de apoyo de las células endoteliales, el control adicional se realizó con los medios de comunicación en ausencia de células endoteliales para verificar el efecto de los medios en la diferenciación. Los detalles de este análisis se presentan en la Figura 4.

Figura 1.
Figura 1. Multi-etapa de protocolo para la diferenciación de hESC en células productoras de insulina que expresan.

Figura 2.
Figura 2. Inducción de endodermo definitivo de células madre embrionarias humanas. A) QRT-PCR análisis de marcadores DE representativas en las células expuestas a hESC activina A y Wortmannin durante 4 días. Resultados ar e normalizada con respecto a hESC indiferenciado. B) Sox17 coloración (verde) y DAPI (azul) muestran la expresión nuclear de Sox17. Barra de escala: 50 m.

Figura 3.
Figura 3. Páncreas inducción de células progenitoras de las células madre embrionarias derivan las células del endodermo. A) QRT-PCR análisis de los marcadores en las células pancreáticas primeros hESC endodermo derivados expuestos al ácido retinoico ciclopamina y durante 4 días después de la inducción DE. Los resultados normalizados con respecto a hESC indiferenciado. B) Pdx1 tinción (violeta) y DAPI (azul) muestran la expresión nuclear de Pdx1. Barra de escala: 50 m.

">

Figura 4.
Figura 4. De páncreas en estadio de maduración A) QRT-PCR análisis de las hormonas pancreáticas en hESC después de la maduración de páncreas con DAPT, póngase en contacto con los medios de co-cultivo o co-la cultura (de control). Los resultados normalizados con respecto a hESC indiferenciado. valores de p obtenido por t de Student. B) Co-cultivo con Dil-Ac-LDL marcados RHMVEC (rojo) muestran las regiones donde EC se adhieren a la placa si hay espacios vacíos (arriba), RHMVEC otros se encuentran en contacto directo con la diferenciación de ESC (abajo). C) del péptido C (verde) para la tinción de las células diferenciadas con el co-cultivo método. Barra de escala: 12,5 m (Arriba) y 50 micras (abajo) D) La inmunotinción de RHMVEC no demuestra la expresión de insulina en el RHMVEC.

Marcador Primer1 (5 'a 3') </ Td> Primer2 (5 'a 3') Árbitro
SOX17 CTCTGCCTCCTCCACGAA CAGAATCCAGACCTGCACAA 12
CXCR4 CACCGCATCTGGAGAACCA GCCCATTTCCTCGGTGTAGTT 4
FOXA2 GGAGCGGTGAAGATGGAA TACGTGTTCATGCCGTTCAT 12
PDX1 AAGTCTACCAAAGCTCACGCG GTAGGCGCCGCCTGC 4
PTF1 CATAGAGAACGAAACCACCCTTTGAG GCACGGAGTTTCCTGGACAGAGTTC 12
HLXB9 CACCGCGGGCATGATC ACTTCCCCAGGAGGTTCGA 4
HNF6 TGTGGAAGTGGCTGCAGGA TGTGAAGACCAACCTGGGCT 5
PAX6 CGAATTCTGCAGGTGTCCAA ACAGACCCCCTCGGACAGTAAT 5
NKX6.1 AGACCCACTTTTTCCGGACA CCAACGAATAGGCCAAACGA 5
ISL1 GATCTATGTCACCTCGCAAGG TACAACCACCATTTCACTG 12
GLUCAGÓN AGGCAGACCCACTCAGTGA AACAATGGCGACCTCTTCTG 4
INSULINA AAGAGGCCATCAAGCAGATCA CAGGAGGCGCATCCACA 12

Primers Tabla 1. Usado para reacciones de qPCR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Durante el desarrollo del páncreas, que diferencian las células pancreáticas están en estrecha proximidad con las células endoteliales de la aorta y, además, los islotes pancreáticos son densamente vascularizado para promover el intercambio rápido de glucosa en la sangre y las hormonas de los islotes. Teniendo en cuenta estos hechos, no es sorprendente que las células endoteliales juegan un papel importante en el proceso de organogénesis pancreática. Si bien la importancia de las células endoteliales durante el desarrollo del páncreas es cada vez más apreciado, su papel en la diferenciación in vitro de las células embrionarias está menos investigada. En nuestro informe anterior se estableció el papel positivo de las células endoteliales en la maduración de las células del páncreas madre embrionarias de ratón 13. En el presente estudio analiza el efecto de la señalización de las células endoteliales en la diferenciación de células madre embrionarias humanas.

Varias células endoteliales se utilizaron en este protocolo, todo lo cual dio lugar a althou similares efecto globalgh con variaciones en la eficiencia de la diferenciación. En el presente informe se presenta el efecto de la co-cultivo de hESC células pancreáticas progenitoras derivadas de células de rata con microvasculares endoteliales del corazón (RHMVEC). Las células endoteliales pueden ser convenientemente visualizado por AC-LDL tinción, que es específico para sólo las células endoteliales. Co-cultivo de los CES de diferenciación con pre-teñidas las células endoteliales mostraron que mientras que la mayoría de las células endoteliales eran viables en cultivo durante un periodo largo de tiempo, el RHMEV desaparecen gradualmente después de 4 días y ya no podían ser detectados después de 6 días de maduración. La ausencia de la RHMVEC simplifica el análisis mediante la eliminación de la necesidad de clasificar, por lo tanto, fue elegido para la optimización del protocolo de co-cultivo.

Aunque el presente estudio indica claramente el efecto positivo de las células endoteliales en la maduración induce páncreas, el mecanismo exacto de la inducción como todavía se desconoce y se está investigando actualmente en nuestro laboratorio. Una few mecanismos plausibles podría ser (i) el efecto de las células secretan moléculas (ii) la inhibición mediada por células endoteliales de la muesca de señalización (iii) la función de la matriz extracelular secretada por las células endoteliales. Mientras que la primera categoría no requiere contacto célula-célula, tal contacto es obligatorio para la segunda y tercera categoría. Por lo tanto se realizó un análisis preliminar con diferentes configuraciones de co-cultivo: (i) el contacto co-cultivo (ii) transwell co-cultivo y (iii) la cultura acondicionado, los medios de comunicación. Se observó que el contacto de co-cultivo resultó en la diferenciación máxima, a juzgar por la expresión de insulina; seguido por transwell co-cultivo, mientras que los medios de cultivo condicionado resultó en un efecto mínimo sobre la expresión de insulina (datos no presentados). Estos análisis indican que, si bien contacto célula-célula es importante, puede haber algunos cortos moléculas secretadas vida que son importantes también.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

No tenemos nada que revelar.

Acknowledgements

Reconocemos el apoyo de los NIH Premio Innovador Nueva DP2 116520 y ORAU Ralph Powe Premio Junior Faculty mejora.

Materials

Name Company Catalog Number Comments
mTeSR1 (with supplement) Stem Cell Technologies 5850
hESC qualified matrigel BD Biosciences 354277
DMEM:F12 Invitrogen 11330-032
MCDB-131 Invitrogen 10372019
MCDB-131 (Complete) VEC Technologies MCDB-131
B27 Supplement Invitrogen 17504044
Activin A R&D Systems 338-AC 100ng/ml
Wortmannin Invitrogen W3144 1μM
KAAD-Cyclopamie Sigma-Aldrich C4116 0.2μM
All-Trans Retinoic Acid Sigma-Aldrich R2625 2μM
DAPT Sigma-Aldrich D5942 30μM
Nicotinamide Sigma-Aldrich N0636 10 mM
Sodium Selenite Sigma-Aldrich S5261 30 nM
Insulin Sigma-Aldrich I1882 25 μg/ml
Transferrin Sigma-Aldrich T8158 50 μg/ml
EGF R&D Systems 236-EG 10ng/ml
EndoGro VEC Technologies ENDOGRO 10mg
Heparin Sigma-Aldrich H3149 90μg/ml
Hydrocortisone Sigma-Aldrich H0888 1μg/ml
NucleoSpin RNA II Macherey-Nagel 740955
ImProm II reverse transcription System Promega Corp. A3800
Brilliant II SYBR Green QPCR master mix Stratagene, Agilent Technologies 600548
Sox17 goat polyclonal IgG Santa Cruz Biotechnology, Inc. sc-17355 1/500
PDX1 goat polyclonal IgG Santa Cruz Biotechnology, Inc. sc-14662 1/500
C-Peptide Rabbit polyclonal Cell Signaling Technology 4593 1/500
Alexa Fluor 488 donkey anti-rabbit IgG Invitrogen A-21206 1/1000
Alexa Fluor 647 donkey anti-goat IgG Invitrogen A-21447 1/1000
Table 2. Reagents and Kits

DOWNLOAD MATERIALS LIST

References

  1. De Vos, J., Assou, S., Tondeur, S., Dijon, M., Hamamah, S. Les cellules souches embryonnaires humaines : de la transgression de l'embryon humain á la médecine régénératrice de demain. Gynécologie Obstétrique & Fertilité. 37, 620-626 (2009).
  2. Murtaugh, L. C., Melton, D. A. Genes, Signals, and Lineages in Pancreas Development. Annual Review of Cell and Developmental Biology. 19, 71-89 (2003).
  3. Kubo, A., Shinozaki, K., Shannon, J. M., Kouskoff, V., Kennedy, M., Woo, S., Fehling, H. J., Keller, G. Development of definitive endoderm from embryonic stem cells in culture. Development. 131, 1651-1662 (2004).
  4. D'Amour, K. A., Bang, A. G., Eliazer, S., Kelly, O. G., Agulnick, A. D., Smart, N. G., Moorman, M. A., Kroon, E., Carpenter, M. K., Baetge, E. E. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat. Biotech. 24, 1392-1401 (2006).
  5. Zhang, D., Jiang, W., Liu, M., Sui, X., Yin, X., Chen, S., Shi, Y., Deng, H. Highly efficient differentiation of human ES cells and iPS cells into mature pancreatic insulin-producing cells. Cell Res. 19, 429-438 (2009).
  6. Basma, H., Soto-Gutiérrez, A., Yannam, G. R., Liu, L., Ito, R., Yamamoto, T., Ellis, E., Carson, S. D., Sato, S., Chen, Y., Muirhead, D. Differentiation and Transplantation of Human Embryonic Stem Cell-Derived Hepatocytes. Gastroenterology. 136, 990-999 (2009).
  7. Phillips, B. W., Hentze, H., Rust, W. L., Chen, Q. -P., Chipperfield, H., Tan, E. -K., Abraham, S., Sadasivam, A., Soong, P. L., Wang, S. T., Lim, R., Sun, W., Colman, A., Dunn, N. R. Directed Differentiation of Human Embryonic Stem Cells into the Pancreatic Endocrine Lineage. Stem Cells and Development. 16, 561-578 (2007).
  8. Kim, S. K., Melton, D. A. Pancreas development is promoted by cyclopamine, a Hedgehog signaling inhibitor. Proceedings of the National Academy of Sciences. 95, 13036-13041 (1998).
  9. Docherty, K. Growth and development of the islets of Langerhans: implications for the treatment of diabetes mellitus. Current Opinion in Pharmacology. 1, 641-649 (2001).
  10. Nikolova, G., Jabs, N., Konstantinova, I., Domogatskaya, A., Tryggvason, K., Sorokin, L., Fässler, R., Gu, G., Gerber, H. -P., Ferrara, N., Melton, D. A. The Vascular Basement Membrane: A Niche for Insulin Gene Expression and [beta]> Cell Proliferation. Developmental Cell. 10, 397-405 (2006).
  11. Yoshitomi, H., Zaret, K. S. Endothelial cell interactions initiate dorsal pancreas development by selectively inducing the transcription factor Ptf1a. Development. 131, 807-817 (2004).
  12. Osafune, K., Caron, L., Borowiak, M., Martinez, R. J., Fitz-Gerald, C. S., Sato, Y., Cowan, C. A., Chien, K. R., Melton, D. A. Marked differences in differentiation propensity among human embryonic stem cell lines. Nat. Biotech. 26, 313-315 (2008).
  13. Banerjee, I., Sharma, N., Yarmush, M. Impact of co-culture on pancreatic differentiation of embryonic stem cells. J. Tissue Eng. Regen. Med. 5, 313-323 (2010).

Comments

2 Comments

  1. good

    Reply
    Posted by: Zhongchun S.
    July 20, 2012 - 2:15 AM
  2. Dear Maria Jaramillo

    I am a student of the licencientura in biotechnology in the Universidad Argentina de la Empresa.
    I am currently studying the cell cultures, researching on the internet I find interesting the abstract, I would like to know if it is possible for me to send the paper by email please.
    thanks and greetings


    Ana Clara López Novo
    Matter cell cultures
    Department of biotechnology and food technology
    Faculty of engineering and Sciences
    Universidad Argentina de la Empresa
    Lima 717 (C1073AAO)
    Ciudad Autónoma de Buenos Aires
    Email: anaclaralopeznovo@gmail.com

    Reply
    Posted by: Ana L.
    May 6, 2013 - 10:24 PM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics