İnsan Embriyonik endotel hücre Co-kültür aracılık Olgunlaşma Bir Yönetmen Farklılaşma Yaklaşım Pankreas insülin üreten hücreler için Kök Hücre

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Çalışmada insan embriyonik kök hücreleri pankreas farklılaşma uyarması yönlendirilmiş bir farklılaşma yaklaşım anlatılmaktadır. Büyük önem insülin salgılayan hücrelerin içine pankreas ataları edilen insan embriyonik kök hücre bulma olduğu endotel hücre ko-kültür aracılık olgunlasmasi.

Cite this Article

Copy Citation | Download Citations

Jaramillo, M., Banerjee, I. Endothelial Cell Co-culture Mediates Maturation of Human Embryonic Stem Cell to Pancreatic Insulin Producing Cells in a Directed Differentiation Approach. J. Vis. Exp. (61), e3759, doi:10.3791/3759 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Embriyonik kök hücreler (ESC) iki ana özellikleri: onlar sonsuza kadar böylece birden fazla soy içine ayırt etmek için potansiyeli olan, farklılaşmadan in vitro koşullarda yayılır ve pluripotenttir olabilir. Bu özellikleri hücre temelli tedavi ve rejeneratif tedavi uygulamaları 1 için EKH son derece cazip kılmaktadır. Ancak gerçekleştireceği tam potansiyelini için hücreleri zor bir görev olduğunu olgun ve işlevsel fenotipleri, ayrılabilir gerekir. Hücresel farklılaşmadan indükleyecek şekilde umut verici bir yaklaşım yakından in vitro ortamda organogenezisin yolu taklit etmektir. Pankreas gelişimi karaciğer ve pankreas gibi çeşitli organlar, dönüşebilir endoderm ile başlayan, belli aşamalarına 2 oluştuğu bilinmektedir. Endoderm indüksiyon çeşitli büyüme faktörleri 4-7 ile kombinasyon halinde bir 3 aktivin ilavesi yoluyla nodal yolunun modülasyonu ile elde edilebilir 8 ilavesi ile in vitro olarak elde edilebilir sonik kirpi inhibisyonu, inhibe ederek pankreas kararlılığını geçirilir. Pankreas olgunlaşma çentik sinyal inhibisyonu gibi çeşitli paralel etkinlikler aracılığıyla olur; pankreas progenitörlerin agregasyon 3 boyutlu kümeler halinde; vaskülarizasyonu indüksiyon; birkaç isim. En başarılı ESC türetilmiş pankreas progenitör hücrelerin in vitro maturasyonu By DAPT takviyesi 9 ile sinyalizasyon çentik inhibisyonu yoluyla elde edilmiştir. Başarılı olsa da, sınırlı işlevsellik ile olgun fenotip düşük verim elde edilmektedir. Daha az çalışma alanı giderek in-vivo pankreas adacık olgunlaşma 10,11 önemli bir faktör olarak takdir ediliyor pankreas olgunlaşmasında sinyal endotel hücre, etkisidir.

Çalışmada endotel tür etkilerini araştıranial adacık hücresi benzeri hücreler üreten insülin içine insan ESC türetilmiş pankreas progenitör hücrelerinin olgunlaşmasında sinyalizasyon. Biz insan EKH ilk PI3K yolun inhibisyonu ile birlikte bir aktivin tarafından endoderm doğru indüklenirler çok aşamalı yönettiği farklılaşma protokolü sunduk. Endoderm hücrelerinin pankreas spesifikasyonu retinoik asidin eklenmesiyle retinoid indüksiyon ile birlikte Cyclopamine tarafından sonik kirpi sinyalleşme inhibisyonu ile elde edilir. Olgunlaşmanın son aşamasında bir ko-kültür yapılandırma elde endotel hücre sinyal sayesinde meydana gelir. Birkaç endotel hücreleri ko-kültür olarak test edilirken, burada öncelikle analiz kolaylığı için, sıçan kalp mikrovasküler endotel hücreleri (RHMVEC) ile verileri sunmak.

Protocol

1. Hücre Bakım

  1. Medya her gün değiştirmek ile H1 hESC (WiCell), mTeSR1 medya ile hESC nitelikli matrigel kuyucuklar da saklandı. F12: Wells DMEM ile 25 ml hESC matrigel 300 ul ilave edilerek hazırlanır seyreltik matrigel çözeltisi ile kaplandı. Bu matrigel çözeltinin 1 ml altı kuyulu plakanın her oyuğa ilave ya da 400 ul bir 12 kuyulu plakanın her oyuğa ilave edildi ve oda sıcaklığında 1 saat boyunca kat etmesine izin verildi. Hücreler mekanik onlar 1 arasında ve çapı 1.5mm ulaştı kez koloniler kazınarak 1:4 bölünmüş bir oranında pasajlandı.
  2. RHMVEC (VEC teknolojileri) medya her gün değiştirmek ile MCDB-131 ortamda sürdürüldü. % 80 izdiham 1:3 bölünmüş bir oranına ulaşılmıştır kez Hücreler tripsinizasyon ile ayrıldı. Pasajlar 3 ile 7 arasında endotel hücreleri, bu çalışma için kullanıldı.

2. Stok Çözümler hazırlanması

  1. Aktivin A steril P 50 mcg / mL 'de yeniden yapıldıBS sığır serum albümini içeren% 0.1. Çözelti -20 ° C'de muhafaza edildi bölünüp
  2. EGF steril 10 mM asetik asit içerisinde 500 ug / mL 'de yeniden çözüldü. Çözelti -20 ° C'de muhafaza edildi bölünüp
  3. İnsülin suyun 10 ml 'ye 0.1 ml glasiye asetik asit ilave edilerek asitleştirildi hazırlanan H2O (pH ≤ 2), ilave edilerek 10 mg / ml' de yeniden çözüldü.
  4. DAPT 18 mg / ml DMSO içinde yeniden çözüldü. F12, bölünüp -20 ° C'de muhafaza: Bu daha DMEM 300 uM konsantrasyona seyreltildi
  5. KAAD-Cyclopamine 5mg/ml DMSO içinde yeniden çözüldü. F12, bölünüp -20 ° C'de muhafaza: Bu daha DMEM 2 uM konsantrasyona seyreltildi
  6. All-trans retinoik asit% 95 etanol içinde 2.7 mg / ml olarak yeniden yapıldı. , F12 bölünüp -80 ° C'de saklanır: Daha da DMEM içinde 2mm konsantrasyona seyreltildi

3. Definitive Endoderm (DE) ve Pankreas Progenitör (PP) İndüksiyon

  1. Saat sonraESC koloniler 1 ve çapı 1.5 mm arasında ulaşılır, DE indüksiyon DMEM eklenmesi ile yapıldı: B27 F12,% 0.2 BSA, A ve 4 gün boyunca 1 uM Wortmannin (gün 0-Gün 4) ortam ile 100 ng / ml aktivin ile desteklenmiş her gün değiştirin.
  2. DE indüksiyonu tamamlandıktan sonra, pankreas progenitör indüksiyon DMEM için ortam değiştirerek oluşturuldu: F12 24 saat için 0.2 mM konsantrasyonda (Gün 4 Gün 5) B27,% 0.2 BSA ve KAAD-Cyclopamine ile desteklenmiş.
  3. 24 saat sonra medya DMEM şekilde değiştirildi: F12 ile desteklenmiş B27,% 0,2 BSA, medya her gün değiştirmek ile 3 gün için 0.2 mM konsantrasyon ve 2 mM konsantrasyonda all-trans retinoik asit (Gün 5 Gün 8) KAAD-Cyclopamine .

4. Pankreas Olgunlaşma

  1. PP indüksiyonundan sonra, tüm gruplar DMEM oluşan olgunlaşma medyaya değiştirildi: F12 2 gün süresince B27,% 0,2 BSA, 10 mM Nikotinamid, 25 mcg / ml insülin, 30 nM Na 2 SeO 3 ve 50 mg / ml transferrin ile desteklendimedya ile ays (Gün 8 Gün 10) her gün değiştirin.
  2. Olgunlaşması ortam içinde 2 gün sonra, son olgunlaşması adım paralel bir karşılaştırma için, birkaç farklı koşullar kullanılarak gerçekleştirilir. (I) kontrol olarak endotelial hücreleri olmaksızın, sadece eş-kültür ortamı kullanılarak ve (iii) RHMVEC hücrelerle temas co-kültürü ile çentik inhibitörü DAPT (ii) kullanılarak: farklılaşma aşağıdaki koşullar altında endüklenmiştir. Hücreler medya her gün değiştirin ile (Gün 10 Gün 17) bir hafta boyunca DAPT ya da ko-kültür ortamı da sağlandı.
    1. DAPT ortam 30 uM DAPT ile olgunlaşması ortam ilave kullanılarak hazırlandı. Bu grup hücreler 6 gün (Gün 11 Gün 17) için ilk 24 saat MCDB131 tamamlamak maruz kalan ve daha sonra DAPT medya maruz bırakıldı.
    2. Co-kültür ortamı ile MCDB-131 ortam ilave hazırlandı B27,% 0.2 BSA, 10 mM Nikotinamid, 10 ng / ml EGF, 1 ug / ml hidrokortizon, 10 mg EndoGro, 90 ug / ml heparin. Medya kontrol koşulu için ayırt hücreleri maruz bırakıldımedya 6 gün (Gün 11 Gün 17) (hayır endotel hücreleri) için ko-kültür ortamı olarak değiştirildi sonra 24 saat boyunca MCDB-131 tam orta (Gün 10 Gün 11).
    3. Kontakt co-kültürü durum için, bir milyon RHMVEC bağlanma izin vermek için 24 saat için tam MCDB-131 ortam içinde ayırt hücreleri (VEC teknolojiler) (Günlük 10 Günlük 11) ilave edildi. 24 saat medya medya ile 6 gün (Gün 11 Gün 17) için ko-kültür medya çevrildikten sonra her gün değiştirin.

5.. QRT-PCR analizi

  1. Farklılaşma her aşamasında (; pankreas progenitör; endoderm olgun adacık) sonunda eridi edildi ve RNA üreticinin talimatlarına göre NucleoSpin II RNA ekstraksiyon kiti kullanılarak ekstrakte edildi.
  2. RNA kalitesi SmartSpec Plus, spektrofotometre kullanılarak RNA ölçümü takiben, 260 nm ve 280 nm RNA absorbans kontrol ederek analiz edildi.
  3. Ters transkripsiyon ImProm II ters transkripsiyon k kullanılarak gerçekleştirildiBu üreticinin talimatlarına göre. Bütün reaksiyonlar RNA 100 ng ile yapıldı.
  4. QRT-PCR üreticinin talimatlarına göre Mx3005P qPCR sistemi (Agilent) ve Brilliant II SYBR Green qPCR ana karışımı kullanılarak gerçekleştirildi. Kullanılan primerler Tablo 1'de verilmiştir. Başlatma adım 50 gerçekleştirildi 10 dakika boyunca 95 ° C'de, ardından 2 dakika süreyle ° C. 50 amplifikasyon döngüsü şu şekilde yapıldı: 95 ° C de 30 saniye, 54 ° ve 30 saniye 1 dakika boyunca 72 ° C'de.
  5. Andiferansiye hücreleri üzerinde hedef mRNA ekspresyonu kat değişimi aşağıdaki formül kullanılarak CT değerleri hesaplandı:
    ΔCT (Marker i) = CT (Marker i) - CT (GAPDH)
    Δ ΔCT (Marker i) = ΔCT (Marker i) (Örnek) - ΔCT (Marker i) (Farklılaşmamış hücreleri)
    Bağıl ifade (Marker i) = 2-ΔΔCT(Işaretleyici i)

6. İmmünositokimya

  1. Farklılaşma her aşamasında (; pankreas progenitör; endoderm olgun adacık) sonunda hücreler oda sıcaklığında 15 dakika boyunca% 4 formaldehit tespit edildi.
  2. Sabit hücreleri Triton X-100 (TX) 15 dakika boyunca% 0.25 ile permeabilize edildi.
  3. Spesifik olmayan boyama 30 dakika boyunca TX% 0.05 'in% 10 eşek serum inkübasyonu ile bloke edildi.
  4. Primer antikor inkübasyon 4 'de bir gece gerçekleştirildi tavsiye edilen seyreltme antikoru (bakınız Tablo 1) de tampon engelleme ° C.
  5. Hücreler 5 dakika boyunca% 0.05 TX üç kez yıkandı.
  6. Sekonder antikor inkübasyon tampon bloke edici ile sulandırılmış uygun bir antikor ile birlikte karanlık oda sıcaklığında bir saat süreyle gerçekleştirildi.
  7. Hücreler 5 dakika boyunca% 0.05 TX üç kez yıkandı.
  8. Nükleer boyanma PBS içinde 1:1000 dilusyonda leke Hoescht ile inkübasyon yapıldıPBS ile 3 yıkama izledi 5 dakika için.
  9. Sabit ve boyanan hücrelerin Olympus IX81 inverted mikroskop ve Metamorph görüntüleme yazılımı kullanılarak görüntülendi.

7. Temsilcisi Sonuçlar

DE belirteçler Sox17, CXCR4 ve Foxa2 için QRT-PCR analizi ile teyit ve Şekil 2 'de gösterildiği gibi Sox17 için İmmünoboyama olarak aktivin ilavesiyle A ve 4 gün boyunca andiferansiye hESC üzere Wortmannin kesin endoderm indüklemektedir. Cyclopamine ve retinoik asit ilave edildikten sonra pankreas progenitör hücrelerine farklılaşmasını pankreas progenitör belirteçler, Şekil 3 'de gösterildiği gibi Pdx1 için İmmünoboyama QRT-PCR ile teyit edilmiştir.

Farklılaşma son aşamada, güçlü hESC edilen pankreas progenitör hücrelerin insülin ifade upregülasyonu indüklenen RHMVEC hücreleri ile ko-kültür başvurun. Co-kültürü aracılı farklılaşma verim co ile analiz edildiDAPT kullanarak kontrol koşulu ile mparing. O anda pankreas olgunlaşması elde etmek için en yaygın olarak kullanılan yöntemlerin biri olduğu DAPT, bir pozitif kontrol olarak kullanılmıştır. Co-endotel hücreleri kültürünün destekleyici faktörleri ile desteklenmiş değiştirilmiş bir ortam içinde gerçekleştirildi beri, ek kontrol farklılaşması üzerinde ortam etkisinin doğrulanması için endotel hücrelerinin yokluğunda ortam ile gerçekleştirildi. Bu analizin ayrıntıları Şekil 4 'de verilmiştir.

Şekil 1..
Şekil 1. Insülin salgılayan hücre içine hESC ayrımında Çok aşamalı protokolü.

Şekil 2.
Şekil 2. Insan embriyonik kök hücrelerin Definitive endoderm indüksiyon. A ve Wortmannin 4 gün boyunca aktivin maruz hESC hücrelerinde temsil DE belirteçlerinin A) QRT-PCR analizi. Sonuçlar ar e farklılaşmamış hESC göre normalize. B) Sox17 boyama (Yeşil) ve DAPI (mavi) Sox17 nükleer ifade göstermektedir. Ölçek çubuğu: 50 mikron.

Şekil 3.
Endoderm hücreleri elde edilen embriyonik kök hücre Şekil 3. Pankreas progenitör indüksiyon. DE indüksiyon sonrası 4 gün cyclopamine ve retinoik asit maruz hESC türetilmiş endoderm hücreleri erken pankreas belirteçlerin A) QRT-PCR analizi. Sonuçlar farklılaşmamış hESC göre normalize. B) Pdx1 boyama (mor) ve DAPI (mavi) Pdx1 nükleer ifade göstermektedir. Ölçek çubuğu: 50 mikron.

">

Şekil 4.
Şekil 4. Pankreas olgunlaşma evresi A) QRT-PCR hESC pankreatik hormon analizi DAPT kullanarak pankreas olgunlaşma sonrasında, ortak kültür ve ortak kültür ortamı (kontrol) başvurun. Sonuçlar farklılaşmamış hESC göre normalize. p öğrenci t-testi ile elde edilen değerler. Dil-Ac-LDL etiketli RHMVEC (Kırmızı) ile B) Co-kültür boş alanlar (üst) varsa EC plaka takmak bölgeleri göstermek, diğer RHMVEC ayırt ESC (alt) ile doğrudan temas halinde bulunabilir. Ko-kültür yöntemi ile farklılaşmış hücreler için C) C-peptid (Yeşil) boyama. Ölçek çubuğu: 12.5 mikron (Üst) ve 50 mikron (Alt) D) RHMVEC ve İmmun Boyamanın RHMVEC hiç insülin ifade gösterir.

Işaretleyici Primer1 (5 'den 3') </ Td> Primer2 (5 'den 3') Ref
SOX17 CTCTGCCTCCTCCACGAA CAGAATCCAGACCTGCACAA 12
CXCR4 CACCGCATCTGGAGAACCA GCCCATTTCCTCGGTGTAGTT 4
FOXA2 GGAGCGGTGAAGATGGAA TACGTGTTCATGCCGTTCAT 12
PDX1 AAGTCTACCAAAGCTCACGCG GTAGGCGCCGCCTGC 4
PTF1 CATAGAGAACGAAACCACCCTTTGAG GCACGGAGTTTCCTGGACAGAGTTC 12
HLXB9 CACCGCGGGCATGATC ACTTCCCCAGGAGGTTCGA 4
HNF6 TGTGGAAGTGGCTGCAGGA TGTGAAGACCAACCTGGGCT 5
PAX6 CGAATTCTGCAGGTGTCCAA ACAGACCCCCTCGGACAGTAAT 5
NKX6.1 AGACCCACTTTTTCCGGACA CCAACGAATAGGCCAAACGA 5
ISL1 GATCTATGTCACCTCGCAAGG TACAACCACCATTTCACTG 12
Glukagon AGGCAGACCCACTCAGTGA AACAATGGCGACCTCTTCTG 4
İNSÜLİN AAGAGGCCATCAAGCAGATCA CAGGAGGCGCATCCACA 12

Tablo 1. Primerler qPCR reaksiyonlar için kullanılır.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Pankreas gelişimi sırasında, ayırt pankreas hücreleri aortadan endotel hücreleri ile birbirine yakın olduğu, ayrıca, pankreas adacık kan şekeri ve adacık hormonların hızlı değişimi teşvik etmek yoğun vaskülarize vardır. Bu gerçekler göz önüne alındığında, endotel hücreleri pankreas organogenez sürecinde önemli bir rol oynaması şaşırtıcı değil. Pankreas geliştirme sırasında endotel hücreleri önemi giderek takdir edilirken, embriyonik hücreler in vitro ayrımında rolünü daha az araştırılmıştır. Daha önceki yazımızda fare embriyonik kök hücreleri 13 pankreas olgunlaşması üzerinde endotel hücrelerin pozitif rolünü kurdu. Mevcut çalışmada insan embriyonik kök hücreleri farklılaştırarak üzerinde endotel hücre sinyal etkisini araştırmak.

Çoklu endotel hücreleri bu protokolü kullanılmıştır, bunlardan birinin de benzer genel etkisi althou sonuçlandıfarklılaşma verimliliği varyasyonlarını gh. Mevcut raporda, sıçan kalp mikrovasküler endotel hücrelerinde (RHMVEC) ile ortak kültür hESC kaynaklı pankreatik progenitör hücrelerin etkisi sunuyoruz. Endotel hücreleri sadece endotel hücreleri için özel olan AC-LDL boyama, tarafından rahatlıkla görüntülenebilmekte. Önceden lekeli endotel hücreleri farklılaştırarak EKH Eş-kültür endotel hücreleri çoğu zaman uzun süre kültüründe canlı iken, RHMEV giderek 4 gün sonra kaybolur ve artık olgunlaşma 6 gün sonra tespit edilebileceğini gösterdi. RHMVEC yokluğu dolayısıyla ko-kültür protokolünün optimizasyonu için seçildi, sıralama ihtiyacını ortadan kaldırarak analizi kolaylaştırır.

Bu çalışmada açıkça uyaran pankreas olgunlaşması endotel hücrelerin pozitif etki gösterir iken, bu tür indüksiyon tam mekanizması hala bilinmemektedir ve şu anda bizim laboratuvarda araştırılmaktadır. Bir few makul bir mekanizma (i) olabilir hücre-salgılanan molekülleri çentik sinyalleşme (iii) endotel hücreleri tarafından salgılanan hücredışı matrisin rolü, (ii) endotelyal hücre dolaylıdır inhibisyon etkisi. İlk kategoride hücre-hücre teması gerektirmez iken, böyle bir temasın ikinci ve üçüncü kategori için zorunludur. Dolayısıyla biz farklı ko-kültür yapılandırmaları kullanılarak bazı ön analiz yapıldı: (i) temas ko-kültür (ii) transwell ko-kültür ve (iii) klimalı medya kültürü. Transwell ko-kültür izledi;; Bu şekilde insülin ifade tarafından değerlendirilecek iletişim ko-kültür, maksimum farklılaşma neden olduğu gözlendi klimalı medya kültürü insülin ifade (veriler gösterilmemiştir) üzerinde minimal etkisi sonucunu getirmiştir. Bu analizler, hücre-hücre teması önemli, hem de önemli olan bazı kısa ömürlü salgılanan molekülleri olabileceğini göstermektedir.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Biz ifşa hiçbir şey yok.

Acknowledgements

Biz 116520 DP2 ve ORAU Ralph Powe Acemi Fakültesi Geliştirme Ödülü NIH Yeni Yenilikçisi Ödülü destek kabul ediyorsunuz.

Materials

Name Company Catalog Number Comments
mTeSR1 (with supplement) Stem Cell Technologies 5850
hESC qualified matrigel BD Biosciences 354277
DMEM:F12 Invitrogen 11330-032
MCDB-131 Invitrogen 10372019
MCDB-131 (Complete) VEC Technologies MCDB-131
B27 Supplement Invitrogen 17504044
Activin A R&D Systems 338-AC 100ng/ml
Wortmannin Invitrogen W3144 1μM
KAAD-Cyclopamie Sigma-Aldrich C4116 0.2μM
All-Trans Retinoic Acid Sigma-Aldrich R2625 2μM
DAPT Sigma-Aldrich D5942 30μM
Nicotinamide Sigma-Aldrich N0636 10 mM
Sodium Selenite Sigma-Aldrich S5261 30 nM
Insulin Sigma-Aldrich I1882 25 μg/ml
Transferrin Sigma-Aldrich T8158 50 μg/ml
EGF R&D Systems 236-EG 10ng/ml
EndoGro VEC Technologies ENDOGRO 10mg
Heparin Sigma-Aldrich H3149 90μg/ml
Hydrocortisone Sigma-Aldrich H0888 1μg/ml
NucleoSpin RNA II Macherey-Nagel 740955
ImProm II reverse transcription System Promega Corp. A3800
Brilliant II SYBR Green QPCR master mix Stratagene, Agilent Technologies 600548
Sox17 goat polyclonal IgG Santa Cruz Biotechnology, Inc. sc-17355 1/500
PDX1 goat polyclonal IgG Santa Cruz Biotechnology, Inc. sc-14662 1/500
C-Peptide Rabbit polyclonal Cell Signaling Technology 4593 1/500
Alexa Fluor 488 donkey anti-rabbit IgG Invitrogen A-21206 1/1000
Alexa Fluor 647 donkey anti-goat IgG Invitrogen A-21447 1/1000
Table 2. Reagents and Kits

DOWNLOAD MATERIALS LIST

References

  1. De Vos, J., Assou, S., Tondeur, S., Dijon, M., Hamamah, S. Les cellules souches embryonnaires humaines : de la transgression de l'embryon humain á la médecine régénératrice de demain. Gynécologie Obstétrique & Fertilité. 37, 620-626 (2009).
  2. Murtaugh, L. C., Melton, D. A. Genes, Signals, and Lineages in Pancreas Development. Annual Review of Cell and Developmental Biology. 19, 71-89 (2003).
  3. Kubo, A., Shinozaki, K., Shannon, J. M., Kouskoff, V., Kennedy, M., Woo, S., Fehling, H. J., Keller, G. Development of definitive endoderm from embryonic stem cells in culture. Development. 131, 1651-1662 (2004).
  4. D'Amour, K. A., Bang, A. G., Eliazer, S., Kelly, O. G., Agulnick, A. D., Smart, N. G., Moorman, M. A., Kroon, E., Carpenter, M. K., Baetge, E. E. Production of pancreatic hormone-expressing endocrine cells from human embryonic stem cells. Nat. Biotech. 24, 1392-1401 (2006).
  5. Zhang, D., Jiang, W., Liu, M., Sui, X., Yin, X., Chen, S., Shi, Y., Deng, H. Highly efficient differentiation of human ES cells and iPS cells into mature pancreatic insulin-producing cells. Cell Res. 19, 429-438 (2009).
  6. Basma, H., Soto-Gutiérrez, A., Yannam, G. R., Liu, L., Ito, R., Yamamoto, T., Ellis, E., Carson, S. D., Sato, S., Chen, Y., Muirhead, D. Differentiation and Transplantation of Human Embryonic Stem Cell-Derived Hepatocytes. Gastroenterology. 136, 990-999 (2009).
  7. Phillips, B. W., Hentze, H., Rust, W. L., Chen, Q. -P., Chipperfield, H., Tan, E. -K., Abraham, S., Sadasivam, A., Soong, P. L., Wang, S. T., Lim, R., Sun, W., Colman, A., Dunn, N. R. Directed Differentiation of Human Embryonic Stem Cells into the Pancreatic Endocrine Lineage. Stem Cells and Development. 16, 561-578 (2007).
  8. Kim, S. K., Melton, D. A. Pancreas development is promoted by cyclopamine, a Hedgehog signaling inhibitor. Proceedings of the National Academy of Sciences. 95, 13036-13041 (1998).
  9. Docherty, K. Growth and development of the islets of Langerhans: implications for the treatment of diabetes mellitus. Current Opinion in Pharmacology. 1, 641-649 (2001).
  10. Nikolova, G., Jabs, N., Konstantinova, I., Domogatskaya, A., Tryggvason, K., Sorokin, L., Fässler, R., Gu, G., Gerber, H. -P., Ferrara, N., Melton, D. A. The Vascular Basement Membrane: A Niche for Insulin Gene Expression and [beta]> Cell Proliferation. Developmental Cell. 10, 397-405 (2006).
  11. Yoshitomi, H., Zaret, K. S. Endothelial cell interactions initiate dorsal pancreas development by selectively inducing the transcription factor Ptf1a. Development. 131, 807-817 (2004).
  12. Osafune, K., Caron, L., Borowiak, M., Martinez, R. J., Fitz-Gerald, C. S., Sato, Y., Cowan, C. A., Chien, K. R., Melton, D. A. Marked differences in differentiation propensity among human embryonic stem cell lines. Nat. Biotech. 26, 313-315 (2008).
  13. Banerjee, I., Sharma, N., Yarmush, M. Impact of co-culture on pancreatic differentiation of embryonic stem cells. J. Tissue Eng. Regen. Med. 5, 313-323 (2010).

Comments

2 Comments

  1. good

    Reply
    Posted by: Zhongchun S.
    July 20, 2012 - 2:15 AM
  2. Dear Maria Jaramillo

    I am a student of the licencientura in biotechnology in the Universidad Argentina de la Empresa.
    I am currently studying the cell cultures, researching on the internet I find interesting the abstract, I would like to know if it is possible for me to send the paper by email please.
    thanks and greetings


    Ana Clara López Novo
    Matter cell cultures
    Department of biotechnology and food technology
    Faculty of engineering and Sciences
    Universidad Argentina de la Empresa
    Lima 717 (C1073AAO)
    Ciudad Autónoma de Buenos Aires
    Email: anaclaralopeznovo@gmail.com

    Reply
    Posted by: Ana L.
    May 6, 2013 - 10:24 PM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics