تفاعل البلمرة سلسلة: البروتوكول الأساسي زائد استراتيجيات حل المشكلات والتحسين

Biology

Summary

وقد برزت PCR وتقنية شائعة في العديد من المختبرات البيولوجيا الجزيئية. المقدمة هنا هو دليل سريع لعدة بروتوكولات PCR التقليدية. لأن كل رد فعل هو تجربة فريدة من نوعها، والظروف المثلى المطلوبة لتوليد منتج تختلف. وفهم المتغيرات في رد فعل يعزز إلى حد كبير كفاءة استكشاف الأخطاء وإصلاحها، وبالتالي زيادة فرصة للحصول على النتيجة المرجوة.

Cite this Article

Copy Citation | Download Citations

Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J. Vis. Exp. (63), e3998, doi:10.3791/3998 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

في مجال العلوم البيولوجية كانت هناك التقدم التكنولوجي الذي تحظى من خلالها الانضباط في العصور الذهبية للاكتشاف. على سبيل المثال، تحولت مجال علم الأحياء المجهرية مع ظهور المجهر انطون فان يوينهويك، والتي سمحت للعلماء تصور بدائيات النوى للمرة الأولى. تطوير تفاعل البلمرة سلسلة (PCR) هي واحدة من تلك الابتكارات التي غيرت مجرى العلوم الجزيئية مع تأثيره يمتد subdisciplines لا تعد ولا تحصى في علم الأحياء. وقد ورد في النظرية من عملية Keppe وزملاء العمل في عام 1971، إلا أنها كانت آخر 14 عاما حتى إجراء PCR كاملة وصفت وتطبيقها تجريبيا من قبل كاري موليس مؤسسة قيطس بينما في عام 1985. تقدم الأتمتة وصقل هذه التقنية مع الأخذ البلمرة DNA مستقرة من البكتيريا الحرارية aquaticus المستحرات، بالتالي DNA بوليميراز طق الاسم.

PCR هو باورrful تقنية التضخيم التي يمكن أن تولد مخزون وفير من شريحة محددة من الحمض النووي (اي ان يكون AMPLICON) من كمية صغيرة فقط من المواد ابتداء (أي قالب أو تسلسل DNA الهدف). في حين واضحة وعموما خالية من المتاعب، وهناك مطبات التي تعقد رد الفعل تحقيق نتائج زائفة. عندما فشل PCR يمكن أن يؤدي إلى العديد من المنتجات DNA غير محددة ذات أحجام مختلفة التي تظهر سلم أو تشويه من العصابات على المواد الهلامية الاغاروز. في بعض الأحيان لا توجد منتجات تشكل على الإطلاق. وهناك مشكلة أخرى محتملة يحدث عندما يتم تقديمها عن غير قصد الطفرات في amplicons، مما أدى إلى السكان غير متجانسة من المنتجات PCR. يمكن فشل PCR تصبح محبطة ما لم يتم توظيف الصبر واستكشاف الأخطاء وإصلاحها لفرز دقيق وحل المشكلة (ق). هذا البروتوكول يحدد المبادئ الأساسية للPCR، ويقدم منهجية من شأنها أن تؤدي إلى التضخيم من متواليات الأكثر المستهدفة، ويقدم استراتيجيات لتحسين رد فعل. باتباع هذا دليل PCR، وسانتيجب أن تكون قادرة على udents:

  • إعداد ردود الفعل وظروف ركوب الدراجات الحرارية لتجربة PCR التقليدية
  • فهم وظيفة المكونات المختلفة رد الفعل وتأثيرها الكلي على تجربة PCR
  • تصميم وتحسين تجربة PCR لأي قالب DNA
  • فشل التجارب استكشاف PCR

Protocol

1. تصميم الاشعال

تصميم الاشعال المناسب أمر أساسي لنجاح تجربة PCR. عند تصميم مجموعة من الاشعال إلى منطقة محددة من الحمض النووي المطلوب لتضخيم، ينبغي للمرء أن يصلب التمهيدي إلى حبلا زائد، والتي من اتفاقية موجه في الاتجاه 5 '→ 3' (المعروف أيضا باسم بمعنى أو حبلا nontemplate) ولل يجب التمهيدي أخرى تكمل حبلا ناقص، وهو الموجه للفي 3 '→ 5' الاتجاه (مضاد أو حبلا قالب). هناك بعض المشاكل الشائعة التي تنشأ عند تصميم الاشعال: 1) الذاتي من الصلب الاشعال مما يؤدي إلى تشكيل هياكل الثانوية مثل الحلقات القاسي (الشكل 1A)، 2) التمهيدي الصلب مع بعضها البعض، ثم بدلا القالب الحمض النووي، وخلق التمهيدي dimers (1B الشكل)، 3) درجات الحرارة ذوبان مختلفة اختلافا جذريا (T م) لكل التمهيدي، مما يجعل من الصعب تحديد درجة الحرارة التي من شأنها أن جميع الصلبآه كلا الاشعال لربط بكفاءة لتسلسل هدفهم خلال ركوب الدراجات themal (الشكل 1C) (انظر الأقسام حساب درجة حرارة انصهار (T م) وتعديلات على شروط CYCLING لمزيد من المعلومات حول T م ق).

  1. وفيما يلي قائمة من الخصائص التي يجب أخذها في الاعتبار عند تصميم الاشعال.
    1. يجب أن يكون طول التمهيدي 15-30 مخلفات النوكليوتيدات (قواعد).
    2. ينبغي الأمثل GC المحتوى تتراوح بين 40-60٪.
    3. يجب أن ينتهي 3 'من الاشعال تحتوي على C أو G من أجل كبح ومنع التمهيدي "التنفس" من الغايات، وزيادة كفاءة فتيلة. DNA "التنفس" يحدث عندما تنتهي لا يبقى صلب المعركة الانتخابية أو تقسيم ولكن وبصرف النظر. السندات الهيدروجين الثلاث في أزواج GC تساعد على منع التنفس ولكن أيضا زيادة درجة حرارة ذوبان الاشعال.
    4. يجب أن ينتهي 3 'من مجموعة التمهيدي، والذي يتضمن بالإضافة إلى التمهيدي حبلا حبلا التمهيدي وناقص، لا تكون ج omplementary لبعضها البعض، ولا يمكن أن نهاية 3 'من التمهيدي واحدة تكون مكملة للأخرى في تسلسل التمهيدي. هذين السيناريوهين يؤدي إلى تشكيل dimers التمهيدي والهياكل حلقة دبوس الشعر، على التوالي.
    5. درجات الحرارة المثلى ذوبان (T م) لمجموعة الاشعال بين 52-58 ° C، على الرغم من ويمكن توسيع النطاق إلى 45-65 درجة مئوية. ينبغي للم T النهائي لكلا الاشعال تختلف باختلاف لا يزيد عن 5 ° C.
    6. وينبغي تجنب تكرار دى النوكليوتيدات (على سبيل المثال، أو GCGCGCGCGC ATATATATAT) أو تشغيل قاعدة واحدة (على سبيل المثال، أو CCCCC AAAAA) لأنها يمكن أن تسبب الانزلاق على طول الجزء معبي الهياكل حلقة DNA وأو منعطف حاد لتشكيل. إذا لا مفر منه نظرا لطبيعة قالب DNA، ثم يكرر تشمل فقط أو قاعدة واحدة تدير باستعراضات من 4 القواعد.

ملاحظات:

  1. هناك العديد من برامج الكمبيوتر المصممة للمساعدة في تصميم أزواج التمهيدي. NCBI أداة تصميم التمهيديw.ncbi.nlm.nih.gov / أدوات / التمهيدي-الانفجار / "الهدف =" _blank "> http://www.ncbi.nlm.nih.gov/tools/primer-blast/ وPrimer3 http://frodo .wi.mit.edu/primer3 / من المواقع الموصى بها لهذا الغرض.
  2. من أجل تجنب التضخيم من homologs الكاذبة ذات الصلة أو قد يكون من المفيد لتشغيل الانفجار على NCBI للتحقق من خصوصية الهدف من الاشعال.

2. المواد والكواشف

  1. عند إعداد تجربة PCR، من المهم أن نكون مستعدين. ارتداء القفازات لتجنب تلويث خليط التفاعل أو الكواشف. وتشمل المراقبة السلبية، وإذا كان ذلك ممكنا عنصر تحكم إيجابية.
  2. ترتيب كل الكواشف اللازمة لتجربة PCR في دلو الجليد شغلها حديثا، والسماح لهم ذوبان الجليد تماما قبل إعداد رد فعل (الشكل 2). الحفاظ على الكواشف على الجليد في كافة مراحل التجربة.
    • الكواشف القياسية تشمل PCRمجموعة من الاشعال المناسب لهذا الجين الهدف المنشود أو شريحة DNA ليتم تضخيمها، البلمرة DNA، وهي عازلة للبوليميراز DNA محددة، deoxynucleotides (dNTPs)، قالب DNA، والمياه المعقمة.
    • قد تشمل الكواشف إضافية المغنيسيوم المغنيسيوم 2 + الملح (عند تركيز النهائي من 0.5 إلى 5.0 ملم)، البوتاسيوم K + ملح (عند تركيز النهائي من 35 الى 100 ​​ملم)، dimethylsulfoxide (DMSO، وفي تركيز النهائي من 1-10٪ )، الفورماميد (في تركيز النهائي من 1،25-10٪)، الأبقار مصل الزلال (في تركيز النهائي من 10-100 ميكروغرام / مل)، والبيتين (عند تركيز النهائي من 0.5 إلى 2.5 M M). وتناقش المضافة مزيد من المتاعب في القسم اطلاق النار.
  3. تنظيم المعدات المختبرية على طاولة العمل.
    • وتشمل المواد أنابيب PCR وكبسولات رف أنبوب PCR، وهي علامة الإيثانول المقاوم، ومجموعة من micropipettors أن تستغني بين 1 - 10 ميكرولتر (P10)، 2 - 20 ميكرولتر (P20)، 20 - 200 ميكرولتر (P200)و200 - 1000 ميكرولتر (P1000)، فضلا عن cycler الحرارية.
    • عند إعداد التجارب PCR عدة أن جميع استخدام الكواشف نفسه، يمكن تحجيمها بشكل مناسب ومجتمعة معا في مزيج ماجستير (ماجستير ميكس). ويمكن أن يتم في هذه الخطوة العقيمة 1،8 مل أنبوب microcentrifuge (انظر الحواشي).
    • لتحليل amplicons الناتجة عن تجربة PCR والكواشف والمعدات اللازمة لالكهربائي للهلام الاغاروز هو مطلوب. إلى حجم تقريبي للمنتج PCR، وهناك حاجة مناسبة، متوفرة تجاريا حجم الوزن الجزيئي القياسية.

3. إنشاء خليط التفاعل

  1. بدء بجعل جدول الكواشف التي من شأنها أن تضاف إلى خليط التفاعل (انظر الجدول 1).
  2. المقبل، والتسمية PCR أنبوب (s) مع علامة الإيثانول مقاومة.
  3. سوف حجم رد الفعل تختلف تبعا لتركيزات من الكواشف الأسهم. تركيزات النهائي(CF) لرد فعل نموذجي 50 ميكرولتر هي كما يلي.
    • X العازلة (مرفق عادة من قبل الشركة المصنعة للبوليميراز DNA، وقد تحتوي على 15 ملم MgCl 2). إضافة 5 ميكرولتر من العازلة 10X في رد الفعل.
    • 200 ميكرومتر dNTPs (50 ميكرومتر كل من النيوكليوتيدات الأربعة). إضافة 1 ميكرولتر من 10 ملي dNTPs في رد فعل (dATP، dCTP، وdTTP dGTP هي 2.5 ملم في كل منهما).
    • 1.5 مم 2 + المغنيسيوم. إضافة إلا إذا لم يكن موجودا في المخزن المؤقت 10X أو حسب الحاجة لتحسين PCR. على سبيل المثال، للحصول على المغنيسيوم ملم 4.0 2 + اللازمة لإنتاج AMPLICON الأمثل لحفظها 566 قطعة DNA بي بي جدت في Mycobacteriophage uncharacterized إضافة 8 ميكرولتر من 25 ملم MgCl 2 إلى رد الفعل (الشكل 3).
    • 20 حتي 50 بمول كل التمهيدي. إضافة 1 ميكرولتر من كل التمهيدي 20 ميكرون.
    • إضافة 10 أبريل - 10 يوليو الجزيئات (أو حوالي 1 حتي 1000 نانوغرام) قالب DNA. إضافة 0.5 ميكرولتر من / 2ng ومو؛ Mycobacteriophage الجيني ل DNA.
    • إضافة 0،5 حتي 2،5 وحدة من بوليميريز الحمض النووي لكل 50 ميكرولتر رد فعل (انظر التوصيات المصنعين) على سبيل المثال، إضافة 0.5 ميكرولتر من وحدات سيغما 0،5 / ميكرولتر بوليميراز DNA طق.
    • إضافة الماء المقطر المعقم QS للحصول على الحجم النهائي بنسبة 50 ميكرولتر رد فعل في ما قبل تحديد في جدول الكواشف (QS هو اختصار لساتيس اللاتينية الكم يعني المبلغ المطلوب). وبالتالي، مطلوب 33 ميكرولتر في رد فعل لتبرزي حجم ما يصل الى 50 ميكرولتر. ومع ذلك، ينبغي الإشارة إلى أن إضافة الماء الأول ولكن في البداية يتطلب اتخاذ جدول الكواشف وتحديد حجم كل الكواشف الأخرى إضافة إلى رد فعل.

4. بروتوكول الأساسية PCR

  1. وضع وحة 96 أيضا في دلو الجليد بأنها حامل للأنابيب 0.2 مل رقيقة الجدران PCR. وسوف يسمح لتضاف إلى الكواشف PCR الباردة أنابيب رقيقة 0.2 مل PCR الجدران تساعد على منع nucleasنشاط البريد وفتيلة غير محددة.
  2. ماصة ما يلي الكواشف PCR بالترتيب التالي إلى 0.2 مل أنبوب PCR رقيقة الجدران (الشكل 4): الماء المعقم، 10X العازلة PCR، dNTPs، MgCl الاشعال، وDNA القالب (انظر الجدول 1). منذ التجارب يجب أن يكون ما لا يقل عن المراقبة السلبية، وربما مراقبة إيجابية، من المفيد لإعداد مزيج ماجستير في أنبوب مل ميكروسنتريفوج 1.8 (انظر الشرح في الحواشي).
  3. في منفصلة 0.2 مل أنابيب رقيقة الجدران PCR (الشكل 4) إضافة كافة الكواشف باستثناء DNA قالب لعنصر تحكم السلبية (زيادة المياه للتعويض عن حجم مفقود). وبالإضافة إلى ذلك، ينبغي أن رد فعل آخر (إذا الكواشف المتاحة) تحتوي على عنصر تحكم إيجابية باستخدام الحمض النووي القالب وأو الاشعال لتضخيم يعرف سابقا تحت نفس الشروط أنابيب PCR التجريبية.
  4. عادة يتم تخزين DNA بوليميراز طق في الجلسرين 50٪والحل لتفريق كاملة في مزيج لطيف يتطلب رد فعل من خلط الكواشف PCR بواسطة pipetting صعودا وهبوطا على الأقل 20 مرة. يجب تعيين micropipettor إلى حوالي نصف حجم رد فعل من مزيج الرئيسي عند خلط، وينبغي الحرص على تجنب إدخال فقاعات.
  5. وضع القبعات على 0.2 مل أنابيب رقيقة الجدران PCR ووضعها في cycler الحرارية (الشكل 5). مرة واحدة يتم إغلاق الغطاء بقوة إلى cycler الحرارية بدء تشغيل البرنامج (انظر الجدول 2).
  6. عند البرنامج قد انتهت، قد يتم إزالة الجدران رقيقة 0.2 مل أنابيب PCR وتخزينها في C. ° 4 ويمكن الكشف عن منتجات PCR عن طريق تحميل مأخوذة من كل رد فعل في آبار من هلام الاغاروز تلطيخ ثم DNA الذي هاجر إلى الكهربائي للهلام إيثيديوم بروميد التالية مع. إذا كان منتج PCR هو الحاضر، فإن بروميد إيثيديوم يقحم بين الأسس التي قامت عليها حمض النووي، والسماح لفرق يمكن تصور مع إضاءة UV. </ لى>

ملاحظات:

  1. عند إعداد عدة تجارب PCR، فإنه من المفيد أن يجمع خليط من الكواشف مشتركة بين جميع ردود الفعل (أي، ماجستير ميكس). وعادة ما يحتوي على كوكتيل من حل البلمرة DNA، dNTPs، رد فعل العازلة، والمياه تجميعها في أنبوب microcentrifuge 1.8 مل. قيمة كل كاشف تضاف إلى مزيج ماجستير يعادل العدد الإجمالي للردود فعل بالإضافة إلى 10٪ تقريب تصل إلى رد فعل أقرب كله. على سبيل المثال، إذا كان هناك 10 × 0.1 = 1 رد فعل، ثم (10 + 1) × 5 ميكرولتر العازلة 10X يساوي 55 ميكرولتر من العازلة 10X لمزيج ماجستير. يتم خلط المواد الكاشفة في مزيج دقيق من قبل ماجستير ضخ الغواص بلطف من micropipettor صعودا وهبوطا بنحو 20 مرة كما هو موضح أعلاه. كل أنبوب PCR يتلقى قسامة من مزيج ماجستير التي تمت إضافتها ثم القالب الحمض النووي، أي الاشعال المطلوبة، وتجربة محددة الكواشف (انظر الجدولين 1 و 7).
  2. وfollowiالموقع يقدم نانوغرام آلة حاسبة لتحديد عدد النسخ من الحمض النووي القالب ( http://www.uri.edu/research/gsc/resources/cndna.html ). يمكن حساب العدد الإجمالي للنسخ من الحمض النووي الذين تقطعت بهم السبل المزدوج باستخدام المعادلة التالية:
    عدد نسخ DNA = (مبلغ DNA (NG) × 6.022x10 23) / (طول × 9 1x10 DNA نانوغرام / مل 650 × دالتون)
    حساب عدد نسخ الحمض النووي يستخدم لتحديد مدى الحاجة في قالب رد الفعل.
  3. قد تحدث ايجابيات كاذبة نتيجة الإفراط في تحمل رد فعل آخر من شأنه أن PCR يمكن تصور عن المنتجات غير المرغوب متعددة على هلام الاغاروز الكهربائي بعد. ولذلك، فإنه من الحكمة استخدام الأسلوب السليم، وتشمل المراقبة السلبية (مراقبة إيجابية وعندما يكون ذلك ممكنا).
  4. بينما إيثيديوم بروميد هو الأكثر شيوعا و وصمة عارأو الأحماض النووية هناك عدة بدائل أكثر أمانا وأقل سمية. الموقع التالي يصف العديد من البدائل بما في ذلك زرقة الميثيلين، بنفسجي كريستال، SYBR الآمن، وجل الأحمر جنبا إلى جنب مع أوصاف كيفية استخدام وكشف المنتج النهائي ( http://bitesizebio.com/articles/ethidium-bromide-the- البدائل / ).
  5. في حين أن معظم الأجهزة الحديثة PCR استخدام أنابيب 0.2 مل، قد تتطلب بعض النماذج ردود الفعل في أنابيب مل 0.5. راجع كتيب cyclers الحرارية لتحديد الحجم المناسب أنبوب.

5. حساب درجة حرارة انصهار (T م)

  1. معرفة درجة حرارة انصهار (T م) من الاشعال لا بد للتجربة الناجحة PCR. على الرغم من أن هناك العديد من الآلات الحاسبة T م المتاحة، من المهم أن نلاحظ أن هذه الحسابات هي تقدير للم T الفعلية بسبب لعدم وجود معلومات محددة حول رد فعل معين، والافتراضات الواردة في خوارزميات للحاسبات م T أنفسهم. ومع ذلك، ويفضل نماذج الحرارية أقرب الجار على حساب أكثر تقليدية: T م ≈ 4 (GC) + 2 (AT). سوف تعطي السابق تقدير أكثر دقة لأنه م T يأخذ في الاعتبار الطاقة التراص من أزواج قاعدة المجاورة. ويستخدم هذا الأخير على نحو أكثر تواترا لأن حسابات بسيطة ويمكن القيام به بسرعة باليد. انظر القسم استكشاف الأخطاء وإصلاحها للحصول على معلومات حول كيفية PCR مختلف الظروف والمواد المضافة تؤثر درجة حرارة انصهار.
    لحساب القيم م T النماذج الحرارية أقرب الجار، واحدة من الآلات الحاسبة ويوصى بعد:
    http://www6.appliedbiosystems.com/support/techtools/calc/
    ايدو / ~ زيمر / oligoTMcalc.html "الهدف =" _blank "> http://www.cnr.berkeley.edu/ ~ زيمر / oligoTMcalc.html
    http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/
    http://www.finnzymes.com/tm_determination.html
    http://mobyle.pasteur.fr/cgi-bin/portal.py؟ # أشكال :: ذوبان

6. إعداد الشروط ركوب الدراجات الحرارية

  1. cyclers PCR الحرارية الحرارة بسرعة وتبريد خليط التفاعل، مما يسمح للحرارة الناجمة عن تمسخ من الحمض النووي المزدوجة (الفصل حبلا)، من الصلب إلى فروع الاشعال زائد وناقص من القالب الحمض النووي، واستطالة للمنتج PCR. وتحسب على أساس مرات الدراجات حجم القالب والمضمون GC من الحمض النووي. فورميولا العامويبدأ خطوة تمسخ الأولي في 94 ° C إلى 98 ° C تبعا لدرجة الحرارة المثلى للنشاط بوليميريز الحمض النووي ومحتوى GC للDNA القالب. رد فعل نموذجي سوف تبدأ مع تمسخ دقيقة واحدة في 94 ° C. يجوز لأي من 3 دقائق تعد تعطيل بوليميريز الحمض النووي، وتدمير نشاطها الأنزيمي. أسلوب واحد، والمعروفة باسم الساخن بداية PCR، ويمتد بشكل كبير من الوقت تمسخ الأولي في الفترة من 3 دقائق حتى 9 دقائق. مع بداية PCR الساخنة، يتم إضافة البلمرة DNA بعد الانتهاء من الخطوة الأولي تمسخ مبالغ فيها. هذا التعديل بروتوكول يتجنب تعطيل المحتمل للانزيم بوليميريز الحمض النووي. الرجوع إلى قسم استكشاف الأخطاء وإصلاحها من هذا البروتوكول لمزيد من المعلومات حول بدء PCR الساخنة والطرق البديلة الأخرى.
  2. والخطوة التالية هي لضبط cycler الحرارية لبدء أول من 25 إلى 35 جولات من دورة الحرارة من ثلاث خطوات (الجدول 2). في حين أن زيادة عدد دورات فوق 35 يؤدي إلىكمية أكبر من المنتجات PCR، جولات كثيرة جدا غالبا ما يؤدي إلى إثراء المنتجات الثانوية غير المرغوب فيها. الخطوات الثلاث في درجة الحرارة دورة واحدة إنجاز ثلاث مهام: الخطوة الأولى يبدل طبيعة القالب (ودورات في وقت لاحق، وamplicons أيضا)، والخطوة الثانية يسمح الأمثل الصلب من الاشعال، والخطوة الثالثة البلمرة DNA يسمح لربط القالب الحمض النووي وتجميع المنتجات PCR. يجوز تغيير مدة ودرجة حرارة كل خطوة في إطار دورة لتحسين إنتاج AMPLICON المطلوب.
    يتم الاحتفاظ الوقت لاتخاذ الخطوة تمسخ قصيرة قدر الإمكان. عادة 10 إلى 60 ثانية كافية لمعظم القوالب DNA. قد تمسخ الوقت ودرجة الحرارة تختلف تبعا للمحتوى GC للDNA القالب، وكذلك معدل المنحدر، وهو الوقت الذي يستغرقه cycler الحرارية لتغيير درجة الحرارة من إلى أخرى. درجة الحرارة لهذه الخطوة عادة ما يكون نفسه الذي استعمل للمرحلة الأولي تمسخ(الخطوة رقم 1 أعلاه، على سبيل المثال، 94 ° C).
    A 30 الخطوة الثانية الصلب يلي في إطار دورة في درجة حرارة تعيين حوالي 5 ° C تحت T م الظاهري للالاشعال (مثالي بين 52 ° C إلى 58 ° C).
    دورة يختتم خطوة استطالة. درجة الحرارة يعتمد على البلمرة DNA المحدد للتجربة. على سبيل المثال، طق بوليميريز الحمض النووي لديه درجة الحرارة المثلى للاستطالة 70 ° C إلى 80 ° C ويتطلب 1 دقيقة لإطالة الأولى 2 كيلوبايت، ثم يتطلب دقيقة اضافية لكل كيلوبايت 1 تضخيم إضافية. PFU DNA البلمرة هو آخر انزيم بالحرارة التي تحتوي على درجة الحرارة المثلى من 75 استطالة ° C. ويوصى PFU DNA البلمرة PCR للاستخدام في وردود الفعل التي تتطلب تمديد التمهيدي الدقة العالية ويتطلب 2 دقيقة لكل كيلو بايت يتم تضخيمه من 1 إلى. انظر التوصيات الشركة المصنعة لدرجات الحرارة استطالة الوقت المحدد واستطالة أشار البلمرة DNA لكل محددة.
  3. طق، يسمح بإضافة بقايا الأدينين لغايات 3 'من جميع المنتجات PCR. وتوسط هذا التعديل من قبل النشاط ترانسفيراز محطة من البلمرة DNA طق ومفيد لاحقة إجراءات الاستنساخ الجزيئي التي تتطلب عبء 3'.
  4. ويتحقق إنهاء رد فعل من جانب تقشعر لها الأبدان الخليط إلى 4 ° C و / أو عن طريق إضافة EDTA إلى تركيز النهائي من 10 مم.

7. اعتبارات هامة عند استكشاف أخطاء PCR

إذا معيار ظروف PCR لا تسفر عن AMPLICON المطلوب، PCR الأمثل هو ضروري لتحقيق نتائج أفضل. قد صرامة يكون رد فعل منظم بحيث يتم تعديل حسب متغيرات خصوصية تغيير (على سبيل المثال، كاشفتركيزات، وظروف ركوب الدراجات) التي تؤثر على نتائج AMPLICON الشخصي. على سبيل المثال، إذا كان رد الفعل ليست صارمة بما فيه الكفاية، سيتم إنشاء العديد من amplicons زائفة مع أطوال متغير. إذا كانت ردة الفعل صارمة جدا، سيتم إنتاج أي منتج. استكشاف الأخطاء وإصلاحها قد تكون ردود الفعل PCR مسعى محبطة في بعض الأحيان. ومع ذلك، يمكن تحليل دقيق وفهم جيد لالكواشف المستخدمة في تجربة PCR تقليل كمية من الوقت والتجارب اللازمة للحصول على النتائج المرجوة. من الاعتبارات التي تؤثر على جميع PCR الصرامة، المعايرة من 2 مغ / و+ أو التلاعب درجات الحرارة الصلب المرجح أن يحل معظم المشاكل. ومع ذلك، قبل تغيير أي شيء، تأكد أن النتيجة خاطئة لم يكن بسبب خطأ بشري. بدء بتأكيد تم إضافة جميع الكواشف الى رد فعل معين، والتي لم تلوث الكواشف. تأخذ علما أيضا نتيجة خاطئة، وطرح الأسئلة التالية: هل dimers التمهيدي مرئية على هلام بعد electrophoresis (هذه تشغيل ك عصابات صغيرة <100 ب بالقرب من أسفل الممر)؟ هناك منتجات محددة غير (العصابات التي تهاجر في حجم مختلف عن المنتج المطلوب)؟ كان هناك نقص في أي منتج؟ هو DNA الهدف على البلازميد أو في استخراج الحمض النووي الجيني؟ أيضا، فإنه من الحكمة لتحليل محتوى GC للAMPLICON المطلوب.

  1. أولا تحديد إذا كان أي من الكواشف PCR هي كارثية على رد فعلك. ويمكن تحقيق هذا من خلال إعداد الكواشف الجديدة (على سبيل المثال، طازجة الأسهم العاملة، التخفيفات الجديدة)، ومن ثم إضافة منهجية جديدة كاشف 1 في وقت لمخاليط رد فعل. وهذه العملية تحديد أي كاشف كان الجاني للتجربة فاشلة PCR. في حالة DNA قديم جدا، والتي غالبا ما تتراكم مثبطات، فقد ثبت أن إضافة مصل بقري الزلال قد تساعد على التخفيف من المشكلة.
  2. يمكن dimers التمهيدي عندما شكل الاشعال تفضيلي يصلب يصلب النفس أو إلى غيرها من التمهيدي في رد الفعل. إذا حدث هذا، صغيرةسوف المنتج أقل من 100 BP تظهر على هلام الاغاروز. تبدأ من خلال تغيير نسبة إلى قالب التمهيدي، وإذا كان تركيز التمهيدي ما يزيد على تركيز الشديد القالب، ثم الاشعال سوف تكون أكثر عرضة ليصلب لأنفسهم أو غيرها من كل أنحاء قالب DNA. قد مضيفا DMSO وأو باستخدام طريقة بدء الساخنة ركوب الدراجات الحرارية حل المشكلة. في النهاية قد يكون من الضروري لتصميم الاشعال جديدة.
  3. ويتم إنتاج منتجات غير محددة عندما PCR الصرامة المفرطة الناتجة منخفضة في نطاقات غير محددة PCR مع أطوال متغير. هذا ينتج تأثير سلم على هلام الاغاروز. فمن المستحسن أن تختار ثم الظروف التي تزيد من صرامة PCR. ويجوز للتشويه من مختلف الأحجام يؤدي أيضا من الاشعال مصممة لتسلسل المتكررة للغاية عندما تضخيم الحمض النووي الجيني. ومع ذلك، قد الاشعال نفس تضخيم تسلسل الهدف على البلازميد دون مواجهة نفس المشكلة.
  4. عدم وجود منتجات PCR من المرجح بسبب ظروف التفاعلالتي هي صارمة جدا. قد dimers التمهيدي والهياكل التي تشكل حلقة منعطف حاد مع الاشعال أو في قالب DNA التشويه والتحريف أيضا منع التضخيم من المنتجات PCR لأن هذه الجزيئات قد لا الزوج مع نظيره قاعدة DNA المطلوب.
  5. إذا لم يتم تحليل محتوى GC، فقد حان الوقت للقيام بذلك. PCR من المناطق الغنية GC (GC المحتوى> 60٪) تشكل بعض من أعظم التحديات التي تواجه PCR. ومع ذلك، هناك العديد من المواد المضافة التي استخدمت للمساعدة في تخفيف التحديات.

8. التلاعب PCR الكواشف

فهم وظيفة الكواشف المستخدمة في PCR التقليدية أمر بالغ الأهمية عند اتخاذ قرار أفضل أولا كيف لتغيير ظروف التفاعل للحصول على المنتج المطلوب. النجاح قد تعتمد ببساطة على تغيير تركيز MgCl بوكل، dNTPs، الاشعال، DNA القالب، أو البلمرة DNA. ومع ذلك، قد تركيز خاطئ من الكواشف أن يؤدي إلى نتائج زائفة، وخفض stringencذ من رد الفعل. عند استكشاف أخطاء PCR، ينبغي التلاعب بها واحد فقط في وقت واحد كاشف. ومع ذلك، قد يكون من الحكمة أن عاير كاشف التلاعب بها.

  1. المغنيسيوم المغنيسيوم ملح 2 + (تركيز النهائي من 0.5 إلى رد فعل 5.0 ملم)
    بلمرة DNA بالحرارة يتطلب وجود المغنيسيوم ليكون بمثابة العامل المساعد خلال عملية التفاعل. تغيير تركيز المغنيسيوم هو واحد من أسهل الكواشف لمعالجة مع ولعل أكبر تأثير على صرامة PCR. بشكل عام، فإن العائد الناتج PCR زيادة مع إضافة قدر أكبر من تركيزات المغنيسيوم 2 +. ومع ذلك، زيادة تركيزات المغنيسيوم 2 + ستنخفض أيضا خصوصية والإخلاص من البلمرة DNA. معظم الشركات المصنعة وتشمل محلول كلوريد المغنيسيوم (MgCl 2) جنبا إلى جنب مع البلمرة DNA ومنطقة عازلة PCR حل 10X. قد PCR 10 X المحاليل تحتوي على 15 MgCl 2 مم، وهو ما يكفي لPCR نموذجيةويمكن إضافة رد الفعل، أو بشكل منفصل عند تركيز الأمثل لرد فعل معين. ملغم لا تستهلك 2 + فعلا في رد الفعل، ولكن لا يمكن متابعة رد فعل دون أن يكون الحاضر. عندما يكون هناك الكثير من المغنيسيوم 2 +، فإنه قد منع تمسخ كاملة من الحمض النووي القالب عن طريق تثبيت حبلا المزدوجة. الكثير من المغنيسيوم + 2 يمكن أيضا استقرار زائف الصلب من الاشعال إلى مواقع غير صحيحة والقالب خصوصية انخفاض الناتج في المنتجات PCR غير مرغوب فيها. عندما لا يوجد ما يكفي المغنيسيوم 2 +، فإن رد فعل عدم المتابعة، لم ينجم عنها أي منتج PCR.
  2. البوتاسيوم K الملح + (تركيز النهائي تفاعل بين 35 و 100 مم)
    المنتجات PCR أطول (10 إلى 40 KB) الاستفادة من الحد من ملح البوتاسيوم (بوكل) من رد فعل العادية تركيز 50 مم، في كثير من الأحيان جنبا إلى جنب مع إضافة / DMSO وأو الجلسرين. إذا كان المطلوب هو AMPLICON أقل من 1000 BP وطويلة المنتجات غير محددة وتشكيل، specificiيمكن أن يتحسن المتوفرة من قبل المعايرة بوكل، وزيادة التركيز في زيادات تصل إلى 10 ملم 100 ملم. زيادة تركيز الملح يسمح جزيئات DNA أقصر لتفسد تفضيلي لجزيئات DNA تعد.
  3. Deoxynucleotide 5'-triphosphates (تركيز النهائي رد فعل 20 و 200 ميكرومتر لكل منهما)
    يمكن Deoxynucleotide 5'-triphosphates (dNTPs) يسبب مشاكل للPCR إذا لم تكن بتركيزات ما يعادل المناسبة (أي [A] = [T] = [C] = [G]) و / أو بسبب عدم الاستقرار على من يتكرر تجميد والذوبان. تركيز dNTP المعتاد هو 50 ميكرومتر كل من dNTPs الأربعة. ومع ذلك، يمكن تحمل تركيزات PCR بين 20 و 200 ميكرومتر لكل منهما. قد تركيزات أقل من dNTPs زيادة كل من خصوصية والإخلاص للتفاعل مع تركيزات dNTP المفرطة يمكن أن تمنع في الواقع PCR. ومع ذلك، لشظايا PCR-أطول، قد تكون هناك حاجة إلى تركيز أعلى dNTP. ويجوز للتغير كبير في تركيز dNTP تستلزم المراسلاتponding تغيير في تركيز المغنيسيوم 2 +.
  4. بلمرة DNA الحرارية مستقرة
    قد تأتي الانزيمات PCR ومخازن المرتبطة بتلك الانزيمات شوطا طويلا منذ كان يعمل أولا DNA بوليميراز طق الأولية. وهكذا، يمكن اختيار المناسب انزيم تكون مفيدة للحصول على منتجات AMPLICON المطلوب. قد يكون من المفضل على سبيل المثال استخدام البلمرة DNA بوليميراز DNA طق على PFU إذا هو المطلوب processivity و / أو إضافة بقايا الأدنين لغايات 3 'للمنتج PCR. "أصبح الأدينين استراتيجية مفيدة للمنتجات PCR الاستنساخ في ناقلات TA مثقال ذرة 3 'إضافة لمدة 3 يتدلى الثايمين. ومع ذلك، إذا الإخلاص هو أكثر أهمية قد انزيم مثل PFU يكون الخيار الافضل. لديك العديد من المصنوعات مجموعة من بلمرة DNA محددة مصممة لتلبية الاحتياجات المتخصصة. نلقي نظرة على ظروف التفاعل وخصائص AMPLICON المطلوب، والمباراة ثم التجربة مع PCR DNA المناسب عolymerase. معظم المصنوعات يكون اختيار الجداول التي البلمرة DNA المساعدات حسب الخصائص القائمة مثل الإخلاص، والغلة، والسرعة، وأطوال الهدف الأمثل، وعما إذا كان من المفيد لتضخيم الغنية GC أو الساخنة PCR البداية.
  5. قالب DNA
    وجودة ونقاء DNA يكون لها تأثير كبير على احتمالات نجاح تجربة PCR. يمكن تحديد الحمض النووي RNA وتركيزات باستخدام قياسات الكثافة البصرية الخاصة بهم في 260 نانومتر (OD 260). يتم حساب كتلة تنقية الأحماض النووية في حل عند 50 ميكروغرام / مل من الحمض النووي الذين تقطعت بهم السبل المزدوج أو 40 ميكروغرام / مل إما RNA أو DNA الذين تقطعت بهم السبل واحد في لOD 260 = 1.0. الملوثات استخراج DNA هي مثبطات شيوعا في PCR وينبغي تجنب بعناية. مثبطات المشتركة استخراج الحمض النووي من البروتين وتشمل PCR، RNA، المذيبات العضوية، والمنظفات. باستخدام أقصى قدر من الاستيعاب من الأحماض النووية OD 260 مقارنة بما كان عليه من البروتينات OD280 (OD 260/280)، أنه من الممكن أن determinه تقديرا لنقاء DNA المستخرج. من الناحية المثالية، فإن نسبة OD 260/280 ما بين 1.8 و 2.0. أقل OD 260/280 يدل على البروتين و / أو تلوث المذيبات التي، في جميع الاحتمالات، لن يكون مشكلة بالنسبة للPCR.
    قد بالإضافة إلى نوعية القالب الحمض النووي، والتحسين من كمية DNA تستفيد كثيرا نتيجة لتجربة PCR. على الرغم من أنها مريحة لتحديد كمية ميكرولتر في نانوغرام /، والذي غالبا ما يكون ناتج عن nanospectrophotometers الحديثة، الوحدة التي لتجربة ناجحة PCR هو عدد الجزيئات. وهذا هو، كم عدد نسخ الحمض النووي القالب تحتوي على تسلسل مكملة لالاشعال PCR؟ الجزيئات المستهدفة هي الأمثل بين 10 أبريل - 10 يوليو الجزيئات ويمكن أن يحسب كما هو موضح في الملاحظات أعلاه.

9. الكواشف المضافة

قد تسفر عن نتائج الكواشف المضافة عندما فشل كل شيء آخر. فهم الكواشفوما يتم استخدامها لأمر بالغ الأهمية في تحديد الكواشف قد تكون أكثر فعالية في الحصول على المنتج المطلوب PCR. معقد إضافة الكواشف إلى رد فعل من حقيقة أن التلاعب واحد كاشف قد تؤثر على تركيز قابلة للاستخدام من آخر كاشف. بالإضافة إلى الكواشف المذكورة أدناه، والملكية المضافة المتاحة تجاريا وتتوفر من شركات التكنولوجيا الحيوية كثيرة.

10. المواد المضافة التي تستفيد قوالب GC ريتش

  1. Dimethylsulfoxide (تركيز النهائي من رد فعل DMSO٪ 1-10)
    في التجارب التي PCR DNA القالب بشكل خاص الغنية GC (GC المحتوى> 60٪)، مضيفا DMSO قد يؤدي إلى تعزيز التفاعل من خلال تعطيل قاعدة الاقتران وخفض فعالية T م. بعض الآلات الحاسبة م T تشمل إدخال متغير لإضافة تركيز DMSO المطلوب في التجربة PCR. ومع ذلك، قد أضاف أكثر من 2٪ DMSO تتطلب إضافة المزيد من البلمرة DNA كما كان شيطان strated لمنع طق بوليميريز الحمض النووي.
  2. الفورماميد (تركيز النهائي من رد فعل 1،25-10٪)
    مثل DMSO، الفورماميد يعطل أيضا قاعدة الاقتران مع زيادة صرامة التمهيدي الصلب، والذي ينتج في أقل فتيلة غير محددة وزيادة كفاءة استخدام التضخيم. الفورماميد وقد تبين أيضا أن يكون محسن لقوالب GC الغنية.
  3. 7-deaza-2'-deoxyguanosine 5'-ثلاثي الفوسفات (تركيز النهائي من رد فعل DC 7 GTP، 3 DC 7 GTP: 1 dGTP 50 ميكرومتر)
    باستخدام 3 أجزاء، أو ميكرومتر 37.5، من غوانوزين قاعدة التناظرية GTP 7 العاصمة بالتزامن مع 1 جزء، أو ميكرومتر 12.5، سوف dGTP زعزعة استقرار تشكيل هياكل الثانوية في المنتج. كما DNA AMPLICON أو القالب هو التشويه والتحريف، فإنه غالبا ما تشكل الهياكل الثانوية مثل الحلقات القاسي. وإدماج DC 7 GTP في AMPLICON DNA تحظر تشكيل هذه الهياكل الشاذة.

ملاحظة:

الحمار = "jove_content"> DC 7 GTP خفف إشارة من تلطيخ بروميد إيثيديوم وهذا هو السبب يتم استخدامه في نسبة 03:01 مع dGTP.

  1. البيتين (تركيز النهائي من رد فعل 0.5M 2.5M ل)
    البيتين (N، N، N-trimethylglycine) هو ثنائي الشحنة وهو التناظرية الأحماض الأمينية التي قد يقلل وحتى القضاء على درجة حرارة انصهار الاعتماد على تكوين الحمض النووي النوكليوتيدات. يتم استخدامه كمادة مضافة للمساعدة التضخيم PCR الأهداف الغنية GC. ويعمل في كثير من الأحيان بالاشتراك مع البيتين DMSO ويمكن أن تعزز كثيرا من فرص DNA الهدف تضخيم مع محتوى GC عالية.

11. المواد المضافة التي تساعد PCR في وجود مثبطات

  1. المنظفات الأيونية غير تعمل لقمع الثانوية تشكيل هيكل والمساعدة على استقرار بوليميريز الحمض النووي. ويمكن استخدام المنظفات الأيونية غير تريتون مثل X-100، توين 20، أو 40 NP بتركيزات رد فعل من 0.1 إلى 1٪ من أجل زيادة الإنتاج AMPLICON. ومع ذلك، concentrقد ations أعلى من 1٪ ليكون المثبطة PCR. وجود المنظفات الأيونية غير PCR يقلل صرامة، مما قد يؤدي إلى تشكيل المنتج زائفة. ومع ذلك، تحييد استخدامها أيضا يؤثر المثبطة للSDS، والملوثات عرضية من البروتوكولات استخراج الحمض النووي.
  2. إضافة بروتينات معينة مثل الأبقار مصل الزلال (BSA) المستخدمة في 400 نانوغرام / ميكرولتر و / أو T4 البروتين الجيني 32 ب 150 PCR المساعدات نانوغرام / ميكرولتر في وجود مثبطات مثل FeCl هيمن، حمض fulvic، حمض الدبالية، التانيك الأحماض، أو مقتطفات من البراز، والمياه العذبة، والمياه البحرية. ومع ذلك، لا يتم تخفيف بعض مثبطات PCR، بما في ذلك الأملاح الصفراوية، البيليروبين، EDTA، كلوريد الصوديوم، SDS، أو تريتون X-100، وذلك إما إضافة أو T4 BSA جين البروتين 32.

12. تعديلات على شروط ركوب الدراجات

  1. وتحقيق الاستفادة المثلى من درجة حرارة الصلب تعزيز أي رد فعل PCR وينبغي النظر في تركيبة مع غيرها من المواد المضافة و / أو جنبا إلى جنب مع غيرها من مو difications لظروف ركوب الدراجات. وبالتالي، من أجل حساب درجة الحرارة المثلى الصلب يعمل المعادلة التالية:
    T A = 0،3 الأراضي الفلسطينية المحتلة التمهيدي م T + 0.7 م T المنتج -14،9
    يتم احتساب T م التمهيدي وم T للزوج أقل استقرارا باستخدام المعادلة:
    T م التمهيدي = ((ΔH / (R + X ΔS LN (ج / 4))) -273،15 + 16،6 سجل [K +] أين ΔH هو مجموع التغيرات في المحتوى الحراري أقرب جار للهجن؛ ΔS هو مجموع أقرب جار التغييرات الكون؛ R هو ثابت الغاز (1.99 كال K-1 مول-1)؛ C هو تركيز التمهيدي، و[K +] هو تركيز البوتاسيوم.
    ويمكن حسابها باستخدام المعادلة الأخيرة واحدة من الآلات الحاسبة م T المدرجة في الموقع التالي:
    RS / ذوبان / sup_mat / servers_list.html "الهدف =" _blank "> http://protein.bio.puc.cl/cardex/servers/melting/sup_mat/servers_list.html
    يتم احتساب T م المنتج على النحو التالي:
    T = 0.41 م المنتج (GC٪) + 16.6 سجل [K +] - طول 675/product
    لتفاعلات PCR معظم تركيز البوتاسيوم ([K +]) ستكون 50 ملي.
  2. بداية ساخنة PCR هو تعديل تنوعا التي يتم زيادة الوقت تمسخ الأولي بشكل كبير (الجدول 4). ويمكن إدراج هذا التعديل مع أو بدون تعديلات أخرى لظروف ركوب الدراجات. وعلاوة على ذلك، غالبا ما تستخدم بالاقتران مع مواد مضافة للتشكيل AMPLICON المزاجية. في الواقع، يتم تضمين متزايد الساخنة بداية PCR باعتباره جانبا من الظروف العادية ركوب الدراجات العام. وقد تجلى بداية ساخنة لزيادة الغلة AMPLICON، مع زيادة خصوصية والإخلاص للتفاعل.الأساس المنطقي وراء PCR بداية ساخنة هو القضاء التمهيدي-ديمر وفتيلة غير المحددة التي قد تؤدي نتيجة لإنشاء رد الفعل أقل من متر T. وهكذا، فإن رد فعل نموذجي بداية ساخنة مع ارتفاع درجات الحرارة العينة إلى درجة حرارة أعلى من T م الأمثل، على الأقل إلى 60 درجة مئوية قبل أي التضخيم قادر على أن يحدث. بشكل عام، يتم حجب البلمرة DNA من رد الفعل الأولي خلال والوقت وتغيير طبيعة ممدود. على الرغم من أن يتم حذف بعض الأحيان المكونات الأخرى للتفاعل البلمرة بدلا من DNA، وهنا سوف نركز على البلمرة DNA. هناك العديد من الطرق التي تسمح للبوليميراز DNA أن تبقى غير نشطة أو فصل ماديا حتى فترة تمسخ الأولي انتهت، بما في ذلك استخدام الشمع حاجزا صلبا، والأجسام المضادة لمكافحة البلمرة DNA والبروتينات التبعي. بدلا من ذلك، ببساطة البلمرة DNA يمكن ان تضاف الى رد فعل بعد دورة تمسخ الأولي كاملة.
  3. PCR هبوط (TD-PCR) هوتعتزم اتخاذ بعض تخمين العمل للخروج من حساب القيود T م بواسطة أقواس درجات الحرارة محسوبة الصلب. مفهوم هو تصميم مرحلتين من ظروف ركوب الدراجات (الجدول 5). المرحلة الأولى توظف تباعا درجات حرارة منخفضة الصلب كل دورة الثانية (تقليديا 1،0 درجة مئوية)، ابتداء من الساعة 10 ° C أعلاه وإنهاء T م في حساب أو أقل قليلا. المرحلة الثانية يستخدم معيار 3-الخطوة الظروف مع درجة حرارة الصلب وضعت في أقل من 5 ° C م T المحسوبة لآخر دورات 20 حتي 25. وينبغي على وظيفة المرحلة الأولى تخفيف mispriming، تمنح ميزة 4-أضعاف على المنتج الصحيح. وهكذا، بعد 10 دورات، وميزة أضعاف العائد 410-4096 نسخ من المنتج الصحيح على أي فتيلة زائفة.
    • Stepdown PCR يشبه TD-PCR مع عدد أقل من الزيادات في المرحلة الأولى من فتيلة. على سبيل المثال، المرحلة الأولى يقلل من درجات الحرارة الصلب كلالدورة الثانية من C ° 3، ابتداء من الساعة 10 ° C أعلاه وإنهاء في 2 ° C أدناه م T المحسوبة. مثل TD-PCR، المرحلة الثانية يستخدم معيار 3-الخطوة الظروف مع درجة حرارة الصلب وضعت في أقل من 5 ° C م T المحسوبة لآخر دورات 20 حتي 25. وسيتيح ذلك للميزة المنتج الصحيح 256-أضعاف خلال منتجات فتيلة كاذبة.
    • PCR التباطؤ هو مجرد تعديل TD-PCR وكانت ناجحة للغاية لتضخيم GC الغنية (فوق 83٪) تسلسل (الجدول 6). مفهوم يأخذ في الاعتبار ميزة جديدة نسبيا المرتبطة cyclers الحرارية الحديثة، والذي يسمح بتعديل سرعة الطريق المنحدر، وكذلك معدل التبريد. بروتوكول يستخدم أيضا DC 7 GTP للحد من تشكيل هيكل 2 ° يمكن أن تمنع رد الفعل. وخفضت سرعة الطريق المنحدر إلى 2.5 ° C ث -1 مع معدل التبريد من 1.5 ° C ق -1 للدورات الصلب. المرحلة الأولى تبدأ مع لnealing ° C درجة حرارة 70 و يقلل من درجة حرارة الصلب بنسبة 1 ° C كل الجولات 3 حتى يصل 58 ° C. المرحلة الثانية ثم يستمر مع درجة حرارة الصلب C ° 58 من لدورات إضافية 15.
  4. PCR المتداخلة هو أداة قوية تستخدم للقضاء على منتجات زائفة. استخدام بادئات متداخلة هي مفيدة بشكل خاص عندما تكون هناك جينات عدة paralogous في الجينوم واحد أو عندما يكون هناك انخفاض في عدد النسخ من تسلسل الهدف ضمن السكان غير متجانسة من متواليات orthologous. الإجراء ينطوي الأساسية مجموعتين من الاشعال أن تضخيم منطقة واحدة من الحمض النووي. تنتشر على الاشعال الجزء الخارجي من الفائدة وتستخدم لتوليد المنتجات PCR التي غالبا ما تكون غير محددة في 20 إلى 30 دورة. ثم يتم استخدام A قسامة صغيرة، عادة حوالي 5 ميكرولتر من رد فعل أول 50 ميكرولتر، كما DNA القالب لمدة 20 حتي 30 جولات من التضخيم باستخدام مجموعة ثانية من أجهزة الاشعال أن يصلب إلى الموقع النسبي الداخليةإلى المجموعة الأولى.

بروتوكولات أخرى PCR هي أكثر تخصصا وتتجاوز نطاق هذه الورقة. ومن الأمثلة على ذلك RACE-PCR، PCR-ملتيبليكس، Vectorette PCR، PCR-الكمي، وRT PCR.

13. ممثل النتائج

وقد تم توليد نتائج PCR ممثل باتباع البروتوكولات الأساسية PCR هو موضح أعلاه. نتائج دمج استراتيجيات استكشاف الأخطاء وإصلاحها عدة للتدليل على أثر الكواشف المختلفة والظروف على رد الفعل. وتضخمت جينات الخميرة من خميرة الخباز في مهدها وMycobacteriophage من uncharacterized في هذه التجارب. كان يعمل مستوى 3-PCR خطوة بروتوكول المبينة في الجدول 2 لجميع التجارب الثلاث المذكورة أدناه.

قبل إعداد التجربة PCR، والحمض النووي الجيني من كل من S. وتم قياس كمية خميرة وMycobacteriophage وتضعف إلى تركيز التي من شأنها أن ألوث بين 10 4 10 7 وجزيئات من الحمض النووي في رد الفعل. وأعدت أسهم تعمل على النحو التالي. وأسفر DNA الجيني الخميرة إعداد 10 4 نانوغرام / ميكرولتر. ولدت A التخفيف إلى 10 نانوغرام / ميكرولتر من خلال إضافة 48 ميكرولتر إلى 452 ميكرولتر من العازلة TE 8.0 درجة الحموضة. منذ S. الجينوم هو خميرة حوالي 12.5 ميجا بايت، 10 نانوغرام تحتوي على 7،41 X 10 5 الجزيئات. أسفرت عن الحمض النووي الجيني Mycobacteriophage إعداد 313 نانوغرام / ميكرولتر. ولدت A التخفيف إلى 2 نانوغرام / ميكرولتر من خلال إضافة 6.4 ميكرولتر إلى 993،6 ميكرولتر من العازلة TE 8.0 درجة الحموضة. هذا هو بالعاثية DNA حوالي 67 كيلو بايت. وبالتالي، 1 نانوغرام يحتوي على 2،73 X 10 7 الجزيئات، والذي هو عند الحد الاعلى من DNA تستخدم عادة لPCR. ثم استخدمت مخزونات العمل لتوليد حلول ميكس ماجستير المبينة في الجدول 7. تباينت التجارب ظروف ركوب الدراجات كما هو موضح أدناه.

في الشكل 3A، الحمض النووي الجيني من S. تم استخدام خميرة كقالب لتضخيمالجين GAL3، الذي يشفر بروتين المشاركة في عملية التمثيل الغذائي الجالاكتوز. كان الهدف لهذه التجربة لتحديد أفضل تركيز المغنيسيوم + 2 لهذه المجموعة من الكواشف. لم يكن MgCl 2 موجودة في المخزن المؤقت الأصلي PCR وكان لا بد من استكمالها في تركيزات أشار مع مجموعة من اختبارها 0.0 ملم إلى 5.0 ملم. كما هو مبين في الشكل، وهو منتج PCR من الحجم المتوقع (2098 BP) يظهر بدءا من المغنيسيوم 2 + تركيز 2.5 ملم (حارة 6) مع التركيز الأمثل عند 4.0 ملي مول (حارة 9). كان تركيز الموصى بها من قبل الشركة المصنعة قدمت 1.5 مم، وهو المبلغ المنصوص عليه في مخازن نموذجية PCR. ولعل من المدهش، تجاوز تركيز الضرورية اللازمة لتشكيل المنتج في هذه التجربة هذا المبلغ.

تم استخدام قالب DNA مختلفة عن التجربة المعروضة في الشكل 3B. تم استخدام الحمض النووي الجيني من Mycobacteriophage لتضخيم الحمض النووي الحفظ BP 566 قطعة.مثل التجربة السابقة، وكان الأمثل المغنيسيوم تركيز + 2 يحدد لاحقا. كما هو مبين في الشكل 3B، التضخيم للمنتج PCR المطلوب يتطلب على الأقل 2.0 مم المغنيسيوم 2 + (حارة 5). في حين كان هناك المزيد من التقلبات في كمية المنتج تشكلت في زيادة تركيزات MgCl ولوحظ المنتج الأكثر PCR في 4 مم المغنيسيوم 2 + (حارة 9)، لاحظ نفس التركيز لجين GAL3 الخميرة.

لاحظ أنه في التجارب المعروضة في 3A 3B الأرقام و، تم الحصول على الفرقة منفصلة باستخدام الدراجات ظروف يعتقد أنها الأمثل يعتمد على درجات الحرارة التمهيدي الصلب. على وجه التحديد، كانت درجة الحرارة 95 درجة مئوية تمسخ مع درجة حرارة الصلب C ° من 61 عاما، وجرى تمديد الخروج لمدة 1 دقيقة في 72 درجة مئوية لمدة 30 دورات. وقد تم تمديد المباراة النهائية ثم 5 دقائق عند 72 ° C. لعرض التجربة الثالثة في الشكل 3C الشكل 3C، ما كان فرقة منفصلة في الشكل 3A، ويصبح مسحة من المنتجات غير محددة في ظل هذه الظروف ركوب الدراجات دون المستوى الأمثل. وعلاوة على ذلك، مع الصرامة العام للتفاعل تخفيض، وهو مبلغ أقل من المغنيسيوم 2 + مطلوب لتشكيل AMPLICON.

جميع التجارب الثلاث توضح أنه عندما تركيزات المغنيسيوم + 2 منخفضة للغاية، وليس هناك إنتاج AMPLICON. هذه النتائج تظهر أيضا أنه عندما كل الشروط الدراجاتتم تصميم بشكل صحيح والكواشف بتركيزات الأمثل، وتجربة PCR تنتج AMPLICON سرية المقابلة لحجم المتوقع. تظهر النتائج على أهمية إجراء التجارب PCR في التشدد عالية بما فيه الكفاية (على سبيل المثال، والعصابات سرية مقابل مسحة). وعلاوة على ذلك، تشير التجارب أن تغيير معلمة واحدة يمكن أن تؤثر مقياس آخر، مما يؤثر على نتيجة التفاعل.

كاشف تركيز حلول الأسهم حجم 13X **
ماجستير ميكس
تركيز النهائي
العقيمة H 2 O QS إلى 50 ميكرولتر QS إلى 650 ميكرولتر
PCR العازلة 10X 5 ميكرولتر 65 ميكرولتر 1X
dNTP في 10 ملي 1 ميكرولتر 13 ميكرولتر 200 ميكرومتر
MgCl 2 25 ملم 3 ميكرولتر 39 ميكرولتر 1.5 مم
إلى الأمام التمهيدي 20 ميكرون = 20 بمول / ميكرولتر 1 ميكرولتر 13 ميكرولتر 20 بمول
عكس التمهيدي 20 ميكرون = 20 بمول / ميكرولتر 1 ميكرولتر 13 ميكرولتر 20 بمول
قالب DNA متغير متغير متغير ~ 10 5 الجزيئات
طق DNA البلمرة 5 وحدة / ميكرولتر * 0،5 ميكروليتر ميكرولتر 6.5 2.5 وحدة
50 ميكرولتر / الرد

ينبغي الجدول 1. الكواشف PCR في ترتيب إضافتها.

* قد تختلف بين الشركات المصنعة وحدات

إضافة ** جميع الكواشف إلى مزيج ماجستير استبعاد أي في حاجة إلى المعايرة أو التي قد تكون المتغير إلى رد فعل. يتم حساب ميكس ماجستير مبين في الجدول أعلاه لمدة 11 زائد 2 ردود الفعل ردود الفعل إضافية لاستيعاب فقدان ماصة نقل ضمان وجود ما يكفي لقسامة إلى كل أنبوب التفاعل.

معيار 3-PCR خطوة ركوب الدراجات
دورة خطوة درجة الحرارة مرة عدد الدورات
الأولي تمسخ 94 ° C إلى 98 ° C 1 دقيقة 1
تمسخ
الصلب
تمديد
94 ° C
5 ° C أدناه T م
70 ° C إلى 80 ° C
10 حتي 60 ثانية
30 ثانية
وDNA بوليميراز AMPLICON تعتمد
25-35
ملحق النهائي 70 & دعلى سبيل المثال؛ C إلى 80 ° C 5 دقائق 1
* عقد 4 ° C 1

الجدول 2. القياسية ركوب الدراجات 3-PCR الخطوة.

* معظم cyclers الحرارية لديهم القدرة على التوقف في 4 درجات مئوية لأجل غير مسمى في نهاية الدورات.

70 ° C إلى 80 ° C
2-PCR خطوة ركوب الدراجات
دورة خطوة درجة الحرارة مرة عدد الدورات
الأولي تمسخ 94 ° C إلى 98 ° C 1 دقيقة 1
تمسخ
الصلب / ملحق
10 حتي 60 ثانية
وDNA بوليميراز AMPLICON تعتمد
25-35
ملحق النهائي 70 ° C إلى 80 ° C 5 دقائق 1

الجدول 3. 2-PCR خطوة ركوب الدراجات.

البداية الساخنة ركوب الدراجات PCR
دورة خطوة درجة الحرارة مرة دورات
الأولي تمسخ 60 ° C إلى 95 ° C 5 دقائق ثم تضاف البلمرة DNA 1
تمسخ
الصلب
تمديد
94 ° C
5 ° C أدناه T م
70 ° C إلى 80 ° C
10 حتي 60 ثانية
30 ثانية
وDNA بوليميراز AMPLICON تعتمد
25-35
ملحق النهائي 70 ° C إلى 80 ° C 5 دقائق 1

الجدول 4. الساخنة ركوب الدراجات PCR ابدأ.

هبوط PCR ركوب الدراجات
دورة خطوة درجة الحرارة مرة دورات
الأولي تمسخ 94 ° C إلى 98 ° C 1
تمسخ
الصلب
تمديد
94 ° C
X = 10 درجة مئوية فوق T م
70 ° C إلى 80 ° C
10 حتي 60 ثانية
30 ثانية
وDNA بوليميراز AMPLICON تعتمد
2
تمسخ
الصلب


تمديد
94 ° C
X-1 ° C 1 ° C تقليل كل دورة أخرى
70 ° C إلى 80 ° C
10 حتي 60 ثانية
30 ثانية
وتعتمد بوليميريز AMPLICON
28
تمسخ
الصلب
تمديد 94 ° C
5 ° C أدناه T م
70 ° C إلى 80 ° C
10 حتي 60 ثانية
30 ثانية
وDNA بوليميراز AMPLICON تعتمد
20-25
ملحق النهائي 70 ° C إلى 80 ° C 5 دقائق 1

الجدول 5. هبوط المكوك PCR ركوب الدراجات.

تباطؤ PCR ركوب الدراجات
دورة خطوة تيمperature مرة دورات
الأولي تمسخ 94 ° C إلى 98 ° C 1 دقيقة 1
تمسخ
الصلب
تمديد
94 ° C
X ° C = 10 ° C أعلاه T م
70 ° C إلى 80 ° C
10 حتي 60 ثانية
30 ثانية
وتعتمد بوليميريز AMPLICON
2
تمسخ
الصلب


تمديد
94 ° C
X-1 ° C 1 ° C تقليل كل دورة أخرى
70 ° C إلى 80 ° C *
10 حتي 60 ثانية
30 ثانية
Aوتعتمد بوليميريز mplicon
28
تمسخ
الصلب
تمديد
94 ° C
5 ° C أدناه T م
70 ° C إلى 80 ° C
10 حتي 60 ثانية
30 ثانية
وتعتمد بوليميريز AMPLICON
20-25
ملحق النهائي 70 ° C إلى 80 ° C 5 دقائق 1

الجدول 6. التباطؤ PCR ركوب الدراجات.

* لPCR التباطؤ، وخفض سرعة الطريق المنحدر إلى 2.5 ° C ث -1 مع معدل التبريد من 1.5 ° C ق -1 للدورات الصلب.

الأسهم الحل وأضاف حجم رد الفعل إلى 50 ميكرولتر 13 ماجستير الخميرة X ميكس 13 X بالعاثية ماجستير ميكس تركيز النهائي
العقيمة H 2 O QS إلى 50 ميكرولتر = 31 ميكرولتر أي 30.5 QS إلى 650 ميكرولتر = 396،5 QS إلى 520 ميكرولتر = 403 ميكرولتر
PCR العازلة 10X 5 ميكرولتر 65 ميكرولتر 65 ميكرولتر 1X
10 ملي 1 ميكرولتر 13 ميكرولتر 13 ميكرولتر 200 ميكرومتر
MgCl 2 المعايرة بالتحليل الكيماوي وأضاف أن كل رد فعل وأضاف أن كل رد فعل وأضاف أن كل رد فعل انظر متغير المعايرة
إلى الأمام التمهيدي 20 ميكرون = 20 بمول / ميكرولتر 1 ميكرولتر 13 ميكرولتر 13 ميكرولتر 20 بمول
عكس التمهيدي 20 ميكرون = 20 بمول / ميكرولتر 1 ميكرولتر 13 ميكرولتر 13 ميكرولتر 20 بمول
قالب DNA 2 نانوغرام / ميكرولتر بالعاثية الخميرة أو 10 نانوغرام / ميكرولتر 0،5 ميكرولتر بالعاثية أو 1 ميكرولتر الخميرة ميكرولتر 6.5 13 ميكرولتر ~ 10 7 الجزيئات أو فج] ~ الخميرة 5 الجزيئات 10
البلمرة 0،5 وحدات / ميكرولتر ** 0،5 ميكروليتر ميكرولتر 6.5 ميكرولتر 6.5 0،5 وحدات / الرد
40 ميكرولتر + 10 (المعايرة) ميكرولتر / الرد المعايرة بالتحليل الكيماوي
[MgCl 2] 0،00 ملم 0.5 مم 1.0 ملم 1.5mM 2.0 مم 2.5 ملم 3.0 مم 3.5 ملم 4.0 ملم 4.5 مم 5.0 ملم
MgCl 2 0،00 ميكروليتر 1،00 ميكروليتر 2،00 ميكروليتر 3،0 ميكروليتر 4،00 ميكروليتر 5،00 ميكروليتر 6،00 ميكروليتر 7،00 ميكروليتر 8،00 ميكروليتر 9،00 ميكروليتر 10،00 ميكرولتر
H 2 O 10،00 ميكرولتر 9،00 ميكروليتر 8،00 ميكروليتر 7،00 ميكروليتر 6،00 ميكروليتر 5،00 ميكروليتر 4،00 ميكروليتر 3،00 ميكروليتر 2،00 ميكروليتر 1،00 ميكروليتر 0،00 ميكروليتر

<STRONG> الجدول 7. المعايرة من المغنيسيوم 2 + المستخدمة في الشكل 3.

الشكل 1
الشكل 1. المشاكل الشائعة التي تنشأ مع الاشعال و3-PCR التضخيم خطوة من DNA الهدف. (أ) الذاتي من الصلب الاشعال مما يؤدي إلى تشكيل هيكل حلقة دبوس الشعر الثانوية. نلاحظ أن الاشعال لا يصلب دائما في أقصى الغايات، وربما تشكيل هياكل أصغر حلقة. (ب) التمهيدي الصلب لبعضها البعض، بدلا من القالب الحمض النووي، وخلق dimers التمهيدي. وبمجرد أن يصلب الاشعال لبعضها البعض سوف استطال إلى أقاصي التمهيدي. (ج) دورات PCR توليد AMPLICON محددة. معيار 3-PCR خطوة الدراجات تشمل تمسخ من الحمض النووي القالب، الصلب من الاشعال، وتمديد DNA الهدف (AMPLICON) من خلال البلمرة DNA.

الشكل 2
دلو الثلج الرقم 2. مع reagالوالدان، ماصات، والرفوف اللازمة لPCR. (1). P-200 ماصة، (2) P-1000 ماصة، (3). P-20 ماصة، (4). ماصة P-10، (5.) 96 لوحة جيدا و 0.2 مل أنابيب رقيقة الجدران PCR ، (6). الكواشف بما في ذلك بوليميريز طق، 10X العازلة PCR، MgCl الماء المعقم، dNTPs، الاشعال، وDNA القالب، (7). أنابيب مل 1.8 و الحامل.

الشكل 3
الشكل 3. مثال لمعايرة المغنيسيوم + 2 تستخدم لتحسين تجربة PCR باستخدام معيار بروتوكول 3-PCR الخطوة. (أ) S. تم استخدام خميرة الحمض النووي الجيني الخميرة كقالب لتضخيم الجين GAL3 2098 سنة مضت. في الممرات 1-6، حيث تركيز المغنيسيوم + 2 منخفض جدا، وهناك إما تشكيل أي منتج (الممرات 1-5) أو القليل جدا المنتج شكلت (حارة 6). الممرات 7 حتي 11 تمثل تركيزات الأمثل للالمغنيسيوم 2 + PCR لهذه التجربة كما يدل على ذلك وجود للمنتج 2098 AMPLICON BP. (ب) uncharacteriتم استخدام الحمض النووي الجيني زيد قالب mycobacteriophage لتضخيم AMPLICON BP 566. الممرات 1-4، وتركيز المغنيسيوم + 2 منخفض جدا، كما يدل على ذلك عدم وجود المنتج. الممرات 5 حتي 11 تمثل تركيزات الأمثل للالمغنيسيوم 2 + لهذا PCR كما يدل على ذلك وجود المنتج 566 AMPLICON كيلو بايت. (ج). S. تم استخدام خميرة الحمض النووي الجيني الخميرة كقالب لتضخيم 2098 BP GAL3 الجين كما هو مبين في الفريق. ومع ذلك، تم تخفيض درجة حرارة الصلب C ° من 61 حتي 58 درجة مئوية، مما أدى إلى نطاقات غير محددة PCR مع أطوال متغير إحداث تأثير تلطيخ على هلام الاغاروز. شكلت 4، حيث تركيز المغنيسيوم + 2 منخفض جدا، لا يوجد أي منتج - الممرات 1. الممرات 5-8 تمثل تركيزات الأمثل للالمغنيسيوم 2 + PCR لهذا من وجهة نظر وجود مسحة والفرقة حول حجم المنتج AMPLICON KB 2098. الممرات 9 حتي 11 تدل على شروط صارمة بشكل مفرط مع أي منتج تشكيلها. (AC) انز 12 هو negatiهاء السيطرة التي لم تحتو على أي DNA القالب. تم تحميل حارة M (علامة) مع سلم 1KB NEB.

الشكل 4
الشكل 4. أنابيب معقمة تستخدم لPCR. (1). أنبوب مل 1.8 (2) فرد رقيقة أنبوب 0.2 مل PCR الجدران، (3). قطاع مل 0،2 رقيقة الجدران أنابيب PCR وقبعات.

الشكل 5
الشكل 5. cycler الحرارية. أغلقت الحرارية cycler الصورة اليسرى. الصورة الصحيحة يحتوي على 0،2 مل أنابيب رقيقة الجدران PCR وضعت في كتلة التدفئة من cycler الحرارية ومفتوحة.

Discussion

أصبح أداة لا غنى عنها PCR في ترسانة العلوم البيولوجية. غيرت مجرى PCR العلوم السماح علماء الأحياء لانتاج الطاقة على الجينوم، وجعل الجينات المختلطة مع وظائف جديدة، مما يتيح إجراء تجارب سريرية محددة ودقيقة، والحصول على نظرة ثاقبة الجينوم والتنوع، فضلا عن جينات الاستنساخ ببساطة لتحليل كيميائي حيوي آخر. ويقتصر تطبيق PCR فقط من الخيال للعالم أن يتمتع قوتها. هناك العديد من الكتب والأوراق التي تصف استخدامات متخصصة جديدة من PCR، وسيتم تطوير غيرها الكثير في الجيل القادم من العلوم البيولوجية. ومع ذلك، بغض النظر عن النهج المتوقع، فقد ظل الإطار الأساسي نفسه. PCR، في عظمته كل شيء، هو تطبيق في المختبر لتوليد كميات كبيرة من شريحة محددة من الحمض النووي.

تصميم تجربة PCR يتطلب تفكيرا والصبر. النتائج مبين في الشكل 3 مثالا واحدا من الفصل الرئيسيةallenges عند تصميم استراتيجية التحسين لPCR. وهذا هو، كما يتم تغيير معلمة واحدة من PCR، فإنه قد يؤثر آخر. وعلى سبيل المثال، إذا تم تنفيذ PCR الأولي بها في درجة حرارة دون المستوى الأمثل الصلب (58 ° C) مع المغنيسيوم 2 + الأمثل تركيز ملي 2.0، ثم ستكون النتيجة إنتاج مسحة كما رأينا في الشكل 3C. قد محاولة لتشويه تنطوي حل إقامة ظروف PCR مع ردود الفعل التي تحتوي على 2،0 ملم MgCl 2 وضبط درجة حرارة الصلب إلى 61 ° C. ومع ذلك، كما رأينا في الشكل 3A، فإن هذا لن تسفر عن أي منتج. وبالتالي، فإنه من المستحسن أن عاير الكواشف، بدلا من إضافة أحد تركيز على رد فعل واحد، عندما مخرج نتائج زائفة. أيضا، التعديلات الأكثر شيوعا التي مطلوبة من أجل تحسين تجربة PCR هي لتغيير تركيز المغنيسيوم + 2 لتصحيح ودرجات الحرارة الصلب. ومع ذلك، إذا كانت هذه التغييرات لا تلغي أو تقلل نتائج شاذة، المعايرة من additiقد فيس و / أو تغيير بروتوكولات حالة ركوب الدراجات كما هو موضح في الجداول 2-6 التخفيف من المشكلة. إذا فشل كل شيء آخر، إعادة تصميم الاشعال وحاول، حاول مرة أخرى.

Disclosures

ليس لدي ما تكشف.

Acknowledgments

شكر خاص لكريس Reddi في جامعة كاليفورنيا لإقامة الكواشف والمواد الهلامية وتتدفق إلى ايرين ساندرز في جامعة كاليفورنيا للإلهام والتوجيه، والدعم، وتصحيح التجارب المطبعية المخطوطة. وأود أيضا أن جيانكارلو بفضل Costaguta وغريغوري S. باين لتوريد الحمض النووي الجيني الخميرة والاشعال لتضخيم الجين GAL3. وأود أيضا أن أشكر Bhairav ​​شاه لالتقاط الصور من المعدات المخبرية والكواشف المستخدمة لجعل الشكلين 2 - 4. وقدمت التمويل لهذا المشروع من قبل HHMI (HHMI منحة رقم 52006944).

Materials

Name Company Catalog Number Comments
Taq Polymeras Sigma-Aldrich D4545-25UN
dNTPs Qiagen 201225
0.2 ml Thin Wall Tubes PCR tubes Bio-Rad 223-9469
0.2 ml Thin Wall Tube caps Bio-Rad 223-9472
EDTA disodium salt dihydrate Sigma-Aldrich E5134
Trizma-HCl Sigma-Aldrich T-3253
Custom Phage Primer Invitrogen 25441F_RL6_Contig2_68k TACTGCAACGCGATGTTGCG
Custom Phage Primer Invitrogen 26007R_RL6_ Contig2_68k TCACCATCAATCGTGGCGGT
Custom Yeast Primer Integrated DNA Technologies SacI-Gal3(-256) ACCTGGAGCTCCTATTT TAACATGTGGATTTCTTGAAAGAATGAAATCG
Custom Yeast Primer Integrated DNA Technologies Gal3(1848)-SacI CGGATGGAGCTCGCGT GAAGGTAATTTTTTTTTATGTCTCCG
Thermal Cycler Bio-Rad 170-9703 My Cycler
Agarose ISC BioExpress E-3120-500
Gel electrophoresis Hoeffer Scientific Instruments Model HE33
1 kb DNA Ladder New England Biolabs N3232S
Bio Rad Power Pack Bio-Rad 164-5050 PowerPac Basic
Gel Doc system Fotodyne Incorporated FOTO/Analyst Investigator FX Workstation

DOWNLOAD MATERIALS LIST

References

  1. Albert, J., Fenyo, E. M. Simple sensitive, and specific detection of human immunodeficiency virus type 1 in clinical specimens by polymerase chain reaction with nested primers. J. Clin. Microbiol. 28, 1560-1564 (1990).
  2. Baskaran, N., et al. Uniform amplification of a mixture of deoxyribonucleic acids with varying GC content. Genome Res. 6, 633-638 (1996).
  3. Blanchard, M. M., Taillon-Miller, P., Nowotny, P., Nowotny, V. PCR buffer optimization with uniform temperature regimen to facilitate automation. PCR Methods Appl. 2, 234-240 (1993).
  4. Borer, P. N., Dengler, B., Tinoco, I. Jr, Uhlenbeck, O. C. Stability of ribonucleic acid double-stranded helices. J. Mol. Biol. 86, 843-853 (1974).
  5. Breslauer, K. J., Frank, R., Blocker, H., Marky, L. A. Predicting DNA duplex stability from the base sequence. Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750 (1986).
  6. Chou, Q., Russell, M., Birch, D. E., Raymond, J., Bloch, W. Prevention of pre-PCR mis-priming and primer dimerization improves low-copy-number amplifications. Nucleic Acids Res. 20, 1717-1723 (1992).
  7. Coleman, W. B., Tsongalis, G. J. Diagnostics for the clinical laboration. Humana Press. (2005).
  8. D'Aquila, R. T., et al. Maximizing sensitivity and specificity of PCR by pre-amplification heating. Nucleic Acids Res. 19, 3749 (1991).
  9. Dieffenbach, C. W., Lowe, T. M., Dveksler, G. S. General concepts for PCR primer design. PCR Methods Appl. 3, S30-S37 (1993).
  10. Don, R. H., Cox, P. T., Wainwright, B. J., Baker, K., Mattick, J. S. 'Touchdown' PCR to circumvent spurious priming during gene amplification. Nucleic Acids Res. 19, 4008 (1991).
  11. Erlich, H. A., Gelfand, D., Sninsky, J. J. Recent advances in the polymerase chain reaction. Science. 252, 1643-1651 (1991).
  12. Frey, U. H., Bachmann, H. S., Peters, J., Siffert, W. PCR-amplification of GC-rich regions: 'slowdown PCR. Nat. Protoc. 3, 1312-1317 (2008).
  13. Haqqi, T. M., Sarkar, G., David, C. S., Sommer, S. S. Specific amplification with PCR of a refractory segment of genomic DNA. Nucleic Acids Res. 16, 11844 (1988).
  14. Henke, W., Herdel, K., Jung, K., Schnorr, D., Loening, S. A. Betaine improves the PCR amplification of GC-rich DNA sequences. Nucleic Acids Res. 25, 3957-3958 (1997).
  15. Innis, M. A., Gelfand, D. H., Sninsky, J. J., White, T. J. PCR Protocols: A guide to methods and applications. Academic Press, Inc. San Diego. (1990).
  16. King, N. Methods in Molecular Biology. 630, Humana Press. (2010).
  17. Kleppe, K., Ohtsuka, E., Kleppe, R., Molineux, I., Khorana, H. G. Studies on polynucleotides. XCVI. Repair replications of short synthetic DNA's as catalyzed by DNA polymerases. J. Mol. Biol. 56, 341-361 (1971).
  18. Korbie, D. J., Mattick, J. S. Touchdown PCR for increased specificity and sensitivity in PCR amplification. Nat. Protoc. 3, 1452-1456 (2008).
  19. Kramer, M. F., Coen, D. M. Enzymatic amplification of DNA by PCR: standard procedures and optimization. Curr. Protoc. Toxicol. Appendix 3, 1-14 (2001).
  20. Kramer, M. F., Coen, D. M. The polymerase chain reaction. Curr. Protoc. Protein Sci. Appendix 4, Appendix 4J (2002).
  21. Kreader, C. A. Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein. Appl. Environ. Microbiol. 62, 1102-1106 (1996).
  22. Kwok, S., et al. Identification of human immunodeficiency virus sequences by using in vitro enzymatic amplification and oligomer cleavage detection. J. Virol. 61, 1690-1694 (1987).
  23. McConlogue, L., Brow, M. A., Innis, M. A. Structure-independent DNA amplification by PCR using 7-deaza-2'-deoxyguanosine. Nucleic Acids Res. 16, 9869 (1988).
  24. Mullis, K. B. The unusual origin of the polymerase chain reaction. Sci. Am. 262, 56-65 (1990).
  25. Mullis, K. B. Target amplification for DNA analysis by the polymerase chain reaction. Ann. Biol. Clin. (Paris). 48, 579-582 (1990).
  26. Mullis, K. B. The polymerase chain reaction in an anemic mode: how to avoid cold oligodeoxyribonuclear fusion). PCR Methods Appl. 1, 1-4 (1991).
  27. Mullis, K. B., Faloona, F. A. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol. 155, 335-350 (1987).
  28. Paabo, S., Gifford, J. A., Wilson, A. C. Mitochondrial DNA sequences from a 7000-year old brain. Nucleic Acids Res. 16, 9775-9787 (1988).
  29. Rees, W. A., Yager, T. D., Korte, J., von Hippel, P. H. Betaine can eliminate the base pair composition dependence of DNA melting. Biochemistry. 32, 137-144 (1993).
  30. Roux, K. H., Hecker, K. H. One-step optimization using touchdown and stepdown PCR. Methods Mol. Biol. 67, 39-45 (1997).
  31. Rychlik, W., Spencer, W. J., Rhoads, R. E. Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res. 18, 6409-6412 (1990).
  32. Saiki, R. K., et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 239, 487-491 (1988).
  33. Saiki, R. K., et al. Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science. 230, 1350-1354 (1985).
  34. Sambrook, J. A. R., David, W. Molecular Cloning A Laboratory Manual. 2, 3, Cold Spring Harbor Laboratory Press. (2001).
  35. Sarkar, G., Kapelner, S., Sommer, S. S. Formamide can dramatically improve the specificity of PCR. Nucleic Acids Res. 18, 7465 (1990).
  36. Smit, V. T., et al. KRAS codon 12 mutations occur very frequently in pancreatic adenocarcinomas. Nucleic Acids Res. 16, 7773-7782 (1988).
  37. Wilson, I. G. Inhibition and facilitation of nucleic acid amplification. Appl. Environ. Microbiol. 63, 3741-3751 (1997).
  38. Wu, R. Methods in Enzymology. 218, Academic Press, Inc. San Diego. (1993).

Comments

1 Comment

  1. Thanks for the great overview of the all-important PCR procedure. I will no doubt reference it often in the future.

    I have a PCR troubleshooting question...what do to about streaking on the gel after a successful amplification? My bands are nice and bright and where they are supposed to be, but there is a heavily-streaked "path" starting at the wells and following until the end where my bands are. Is there something I can do about my PCR conditions, or the thermocycler settings? Any comments would be appreciated.

    Reply
    Posted by: Doug E.
    September 8, 2013 - 1:23 PM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics