Polymerase Chain Reaction: Basic Protocol Plus Fehlersuche und Optimierungsstrategien

Biology
 

Summary

PCR hat sich als eine übliche Technik in vielen molekularbiologisch arbeitenden Labors entstanden. Vorausgesetzt ist hier eine Kurzanleitung, um mehrere konventionelle PCR-Protokolle. Da jede Reaktion ist ein einzigartiges Experiment, optimale Voraussetzungen, um ein Produkt liefern zu variieren. Das Verständnis der Variablen in einer Reaktion ermöglicht eine wesentlich bessere Effizienz Fehlerbehebung, wodurch die Möglichkeit, das gewünschte Ergebnis zu erhalten.

Cite this Article

Copy Citation | Download Citations

Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J. Vis. Exp. (63), e3998, doi:10.3791/3998 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

In der biologischen Wissenschaften gab es technologische Fortschritte, die die Disziplin in goldenen Zeitalter katapultieren Entdeckungsreise. Zum Beispiel wurde das Gebiet der Mikrobiologie mit dem Aufkommen von Anton van Leeuwenhoek das Mikroskop, das die Wissenschaftler zu Prokaryoten zum ersten Mal zu visualisieren erlaubt verwandelt. Die Entwicklung der Polymerase-Kettenreaktion (PCR) ist eine jener Innovationen, die den Verlauf der molekularen Wissenschaft mit ihren Auswirkungen Spanning unzählige Teildisziplinen der Biologie verändert. Der theoretische Prozess wurde durch Keppe und Mitarbeitern im Jahr 1971 skizziert, allerdings war es noch 14 Jahre dauern, bis die komplette PCR-Verfahren wurde beschrieben und experimentell angewandt von Kary Mullis, während an der Cetus Corporation im Jahr 1985. Automatisierung und Ausgestaltung dieser Technik weiter mit der Einführung eines thermisch stabile DNA-Polymerase aus dem Bakterium Thermus aquaticus, damit der Name Taq DNA Polymerase.

Die PCR ist eine Powerful Amplifikationsverfahren, die eine hohe Verfügbarkeit von einem bestimmten Segment der DNA (dh, ein Amplikon) aus nur eine kleine Menge des Ausgangsmaterials (dh DNA-Matrize oder Zielsequenz) erzeugen kann. Während in der Regel unkompliziert und problemlos, es gibt Fallstricke, die die Reaktion produzieren falsche Ergebnisse erschweren. Wenn es fehlschlägt PCR lässt sich auf viele nicht-spezifische DNA-Produkte in verschiedenen Größen, die als Leiter oder Abstrich von Bands auf Agarosegelen erscheinen führen. Manchmal bilden keine Produkte überhaupt. Ein weiteres potentielles Problem tritt auf, wenn Mutationen unbeabsichtigt in den Amplikons eingeführt werden, was zu einer heterogenen Population von PCR-Produkten. PCR-Ausfälle werden kann frustrierend es sei denn, Geduld und sorgfältige Fehlerbehebung eingesetzt werden, zu klären und lösen das Problem (e). Dieses Protokoll werden die grundlegenden Prinzipien der PCR, eine Methode bereit, die in der Amplifikation der Zielsequenzen meisten führen wird, und präsentiert Strategien zur Optimierung einer Reaktion. Durch Einhalten dieses PCR, STudents sollte in der Lage:

  • Richten Sie Reaktionen und Temperaturwechsel Bedingungen für eine konventionelle PCR-Experiment
  • Verstehen Sie die Funktion der verschiedenen Reaktionskomponenten und ihre Gesamtwirkung auf einer PCR-Experiment
  • Gestaltung und Optimierung einer PCR-Experiment für jede DNA-Template
  • Problembehandlung fehlgeschlagener PCR-Experimente

Protocol

1. Designing Grundierungen

Konzeption geeigneter Primer ist wesentlich für die erfolgreiche Durchführung der PCR-Experiment. Beim Entwerfen eines Satzes von Primern auf eine bestimmte Region der DNA für die Amplifikation gewünscht ist, sollte eines Primers an die Plus-Strang, die der Konvention in der 5 '→ 3'-Richtung (auch als Sense-Strang bekannt oder nontemplate) orientiert und dem Temperdorn andere Primer sollte eine Ergänzung der Minus-Strang, die ausgerichtet ist in der 3 '→ 5'-Richtung (Antisense oder Template-Strang). Es gibt ein paar häufige Probleme, die bei der Gestaltung Primer entstehen: 1) Selbst-Primer-Anlagerung was zur Bildung von sekundären Strukturen wie Haarnadelschleifen (Abbildung 1a), 2) Primeranlagerung miteinander, eher dann die DNA-Vorlage, die Schaffung Primer Dimere (Abbildung 1b); 3) drastisch unterschiedlichen Schmelztemperaturen (T m) für die einzelnen Primer, so dass es schwierig ist, eine Glühtemperatur wählen! Es wird schonow beide Primer, um effizient zu ihrer Zielsequenz während Thermal Cycling (Abbildung 1c) (siehe die Abschnitte BERECHNUNG Schmelztemperatur (T m) und ÄNDERUNGEN AN-Bedingungen für weitere Informationen über T m s) zu binden.

  1. Unten ist eine Liste der Merkmale, die beim Entwerfen Primer werden sollte.
    1. Primer Länge sollte 15-30 Nukleotidreste (Basen) sein.
    2. Optimale GC-Gehalt sollte zwischen 40-60% liegen.
    3. Das 3'-Ende der Primer sollten ein G oder C, um die Primer zu klemmen und zu verhindern "Atmen" Enden, wodurch die Effizienz Grundierung. DNA "Atmen" tritt auf, wenn Enden nicht ausfransen, sondern bleiben geglüht oder gespalten. Die drei Wasserstoffbrücken in GC-Paare zu verhindern, Atmung, sondern erhöhen auch die Schmelztemperatur der Primer.
    4. Die 3'-Enden der Primer-Set, das einem Plus-Strang-Primer und einen Minus-Strang-Primer enthält, sollte nicht als c omplementary miteinander, kann auch das 3'-Ende eines einzelnen Primer komplementär zu anderen Sequenzen in den Primer. Die beiden Szenarien zur Bildung von Primer-Dimeren und Haarnadelschleifen führen, jeweils.
    5. Optimale Schmelztemperaturen (T m) für Primer Bereich zwischen 52-58 ° C, obwohl der Bereich um 45 bis 65 erweitert werden kann ° C Die endgültige T m für beide Primer sollten um nicht mehr als 5 ° C unterscheiden
    6. Di-Nukleotid-Wiederholungen (zB GCGCGCGCGC oder ATATATATAT) oder einzelne Base Läufe (zB AAAAA oder CCCCC) sollte vermieden werden, da sie dazu führen kann seitlich auf der grundierten Segment der DNA und oder Haarnadelschleife Strukturen zu bilden. Wenn dies wegen der Natur der DNA-Matrize, dann gehören nur Wiederholungen oder einzelne Base läuft mit einem Maximum von 4 Basen.

Hinweise:

  1. Es gibt viele Computerprogramme für den Einsatz in der Gestaltung Primerpaare zu unterstützen. NCBI Primer-Design-Toolw.ncbi.nlm.nih.gov / tools / Primer-blast / "target =" _blank "> http://www.ncbi.nlm.nih.gov/tools/primer-blast/ und Primer3 http://frodo .wi.mit.edu/primer3 / empfohlenen Webseiten sind für diesen Zweck.
  2. Zur Verstärkung des verwandten Pseudogene oder Homologe zu vermeiden kann es sinnvoll sein, um eine Explosion am NCBI, um für das Ziel-Spezifität der Primer zu überprüfen laufen.

2. Materialien und Reagenzien

  1. Beim Einrichten eines PCR-Experiment ist es wichtig, vorbereitet zu sein. Tragen Sie Handschuhe zur Vermeidung von Kontamination des Reaktionsgemisches oder Reagenzien. Fügen Sie eine negative Kontrolle, und wenn möglich eine positive Kontrolle.
  2. Ordnen Sie alle Reagenzien für die PCR-Experiment in einem frisch gefüllten Eimer Eis benötigt wird, und lassen Sie sie vollständig auftauen, bevor die Einrichtung einer Reaktion (Abbildung 2). Halten Sie die Reagenzien auf Eis während des ganzen Experiments.
    • Standard-PCR-Reagenzien umfassen einSatz von geeigneten Primern für das gewünschte Ziel-Gen oder DNA-Segment zu amplifizierenden DNA-Polymerase, einem Puffer für die spezifische DNA-Polymerase, Desoxynucleotide (dNTPs), DNA-Matrize, und steriles Wasser.
    • Zusätzliche Reagenzien können Magnesiumsalz Mg 2 + (in einer Endkonzentration von 0,5 bis 5,0 mM), Kaliumsalz K + (in einer Endkonzentration von 35 bis 100 mM), Dimethylsulfoxid (DMSO; in einer Endkonzentration von 1-10% ), Formamid (bei einer Endkonzentration von 1,25 bis 10%), Rinderserumalbumin (bei einer Endkonzentration von 10-100 g / ml), und Betain (bei einer Endkonzentration von 0,5 M bis 2,5 M). Additive werden in den Abschnitt Fehleranalyse diskutiert.
  3. Organisieren Laborgeräte auf der Werkbank.
    • Zu den Materialien gehören PCR-Röhrchen und Kappen, ein PCR-Tube-Rack, ein Ethanol-resistenten Marker, sowie eine Reihe von Mikroliterpipetten, die zwischen 1 verzichtet werden - 10 pl (P10), 2 bis 20 ul (P20), 20 bis 200 ul (P200)und 200 - 1000 ul (P1000), sowie ein Thermocycler.
    • Bei der Aufstellung mehrerer PCR-Experimente, dass alle die gleichen Reagenzien, können sie entsprechend skaliert werden und gemeinsam in einem Master-Gemisch (Master Mix) kombiniert. Dieser Schritt kann in einem sterilen 1,8 ml Mikrozentrifugenröhrchen durchgeführt werden (siehe Anmerkungen).
    • Um die Amplifikate aus einer PCR-Experiment, Reagenzien und Ausrüstung für die Agarosegelelektrophorese analysiert erforderlich ist. Um ungefähre Größe eines PCR-Produkts wird eine geeignete, im Handel erhältlich Molekulargewicht Größenstandard benötigt.

3. Einrichten eines Reaktionsgemisches

  1. Starten, indem eine Tabelle von Reagenzien, die zu dem Reaktionsgemisch zugegeben werden (siehe Tabelle 1) wird.
  2. Weiter, Label-PCR-Röhrchen (s) mit dem Ethanol-resistenten Marker.
  3. Reaktionsvolumina variieren je nach den Konzentrationen der Reagenzien Lager. Die Endkonzentrationen(CF) für einen typischen 50 ul Reaktion sind wie folgt.
    • X-Puffer (normalerweise vom Hersteller der DNA-Polymerase zugeführt wird; enthalten 15 mM MgCl 2). 5 l der 10X-Puffer pro Reaktion.
    • 200 pM dNTPs (50 uM jedes der vier Nukleotide). Fügen Sie 1 ul 10 mM dNTPs pro Reaktion (dATP, dCTP, dTTP und dGTP sind bei jeweils 2,5 mM).
    • 1,5 mM Mg 2 +. Fügen Sie nur dann, wenn es nicht vorhanden ist in der 10X-Puffer oder als für die PCR-Optimierung benötigt. Zum Beispiel erhalten Sie das 4,0 mM Mg 2 + für eine optimale Produktion Amplikon eines konservierten 566 bp DNA-Segments in einem nicht charakterisierten Mykobakteriophagen hinzufügen 8 ul 25 mM MgCl 2, um die Reaktion (Abbildung 3) gefunden erforderlich.
    • 20 bis 50 pmol eines jeden Primers. Fügen Sie 1 ul jeder 20 uM Primer.
    • In 10 April - 10 Juli Moleküle (oder etwa 1 bis 1000 ng) DNA-Matrize. In 0,5 ul 2NG / mu &; L genomische DNA Mykobakteriophagen.
    • In 0,5 bis 2,5 Einheiten DNA-Polymerase pro 50 &mgr; l-Reaktion (siehe Empfehlungen der Hersteller) Fügen Sie z. B. 0,5 ul Sigma 0,5 Einheiten / ul Taq DNA Polymerase.
    • Fügen QS sterilem destilliertem Wasser zu einer 50 ul Endvolumen pro Reaktion zu erhalten, wie in der Tabelle der Reagenzien vorher festgelegten (QS ist eine lateinische Abkürzung für quantum satis dh den Betrag, der benötigt wird). So wird 33 ul pro Reaktion benötigt, um die Lautstärke bis zu 50 ul zu bringen. Es sollte jedoch darauf hingewiesen, dass Wasser zuerst zugesetzt wird, sondern erfordert zunächst einen Tisch macht von Reagenzien und Bestimmung der Volumina aller anderen Reagenzien zu der Reaktion hinzugefügt werden.

4. Basic-PCR-Protokoll

  1. Legen Sie eine Platte mit 96 Vertiefungen in den Eiskübel als Halter für die 0,2 ml dünnwandigen PCR-Gefäße. Zulassen von PCR-Reagenzien zu 0,2 ml in kaltes dünnwandigen PCR-Röhrchen hinzugefügt werden, wird verhindert, nucleasE-Aktivität und unspezifischer Priming.
  2. Pipettieren Sie die folgenden PCR-Reagenzien in der folgenden Reihenfolge in ein 0,2 ml dünnwandigen PCR-Röhrchen (Abbildung 4): steriles Wasser, 10X PCR-Puffer, dNTPs, MgCl 2, Primer und Template-DNA (siehe Tabelle 1). Da Experimente mindestens eine negative Kontrolle, und eventuell einen positiven Einfluss haben sollten, ist es vorteilhaft, die Einrichtung eines Master-Mix in einem 1,8 ml Mikrozentrifugenröhrchen (siehe Erläuterung in Notes).
  3. In einem separaten 0,2 ml dünnwandigen PCR-Röhrchen (4) hinzuzufügen alle Reagentien mit Ausnahme der Ziel-DNA für eine negative Kontrolle (Erhöhung der Wasser für das fehlende Volumen zu kompensieren). Darüber hinaus sollte eine andere Reaktion (falls Reagenzien verfügbar sind) enthalten eine positive Kontrolle mit Template-DNA und Primer oder bereits bekannt, unter den gleichen Bedingungen wie die experimentellen PCR-Röhrchen zu verstärken.
  4. Taq DNA-Polymerase wird typischerweise in einer 50% Glycerol gelagertLösung und für eine vollständige Freisetzung in die Reaktionsmischung benötigt schonendes Mischen des PCR-Reagenzien und Abpipettieren mindestens 20-mal. Die Mikropipette sollte auf etwa die Hälfte der Reaktion Volumen des Master-Mix eingestellt werden, wenn das Mischen, und sollte darauf geachtet werden, dass Blasen zu vermeiden sein.
  5. Setzen Kappen an den 0,2 ml dünnwandigen PCR-Gefäße und legen Sie sie in den Thermocycler (Abbildung 5). Sobald der Deckel auf dem Thermocycler fest verschlossen wird das Programm starten (siehe Tabelle 2).
  6. Wenn das Programm fertig ist, können die 0,2 ml dünnwandigen PCR-Röhrchen abgenommen und bei 4 ° C gelagert werden PCR-Produkte können durch Laden Aliquots von jeder Reaktion in Vertiefungen von einem Agarosegel dann Färben DNA, die in dem Gel nach Elektrophorese mit Ethidiumbromid gewandert ist nachgewiesen werden. Wenn ein PCR-Produkt vorhanden ist, wird das Ethidiumbromid zwischen den Basen der DNA-Stränge zu interkalieren, so dass Bands zu visualisierenden mit einem UV-Strahler. </ Li>

Hinweise:

  1. Wenn die Einrichtung mehrerer PCR-Experimenten ist es vorteilhaft, ein Gemisch von Reagenzien, die für alle Reaktionen (dh Master Mix) zusammengefasst werden. Gewöhnlich ist der Cocktail enthält eine Lösung von DNA-Polymerase, dNTPs, Reaktionspuffer, und Wasser in ein 1,8 ml Mikrozentrifugenröhrchen montiert. Die Menge der verschiedenen Reagenzien zugegeben, um den Master Mix ist äquivalent zu der Gesamtzahl der Reaktionen plus 10% auf die nächste ganze Reaktion gerundet. Zum Beispiel, wenn es 10 x 0,1 = 1-Reaktion, dann (10 + 1) x 5 ul 10X-Puffer gleich 55 ul 10 × Puffer für die Master Mix. Die Reagenzien in den Master Mix gründlich durch vorsichtiges Pumpen der Kolben einer Mikropipette auf und ab etwa 20-mal, wie oben beschrieben vermischt. Jeder PCR-Röhrchen bekommt einen aliquoten Teil der Master-Mix, auf die die DNA-Vorlage, alle erforderlichen Grundierungen und Experiment-spezifischen Reagenzien zugesetzt werden (siehe Tabellen 1 und 7).
  2. Die following Website bietet einen Rechner zur Bestimmung der Anzahl von Kopien eines Matrizen-DNA ( http://www.uri.edu/research/gsc/resources/cndna.html ). Die Gesamtzahl der Kopien von doppelsträngigen DNA kann unter Verwendung der folgenden Gleichung berechnet werden:
    Anzahl der Kopien der DNA = (DNA-Menge (ng) x 6.022x10 23) / (Länge der DNA-x 1x10 9 ng / ml x 650 Dalton)
    Berechnung der Anzahl der Kopien der DNA verwendet wird, um zu bestimmen, wie viel Vorlage pro Reaktion benötigt wird.
  3. Falsch-positive Ergebnisse können als Folge der Übertragung aus einer anderen PCR-Reaktion, die man sich als eine Vielzahl unerwünschter Produkte auf einem Agarosegel nach der Elektrophorese auftreten würde. Deshalb ist es klug ist, um die richtige Technik zu nutzen, gehören eine negative Kontrolle (und der positiven Kontrolle, wenn möglich).
  4. Während Ethidiumbromid ist die häufigste Fleck foder Nukleinsäuren gibt es mehrere sicherer und weniger toxisch Alternativen. Die folgende Website beschreibt einige der Alternativen einschließlich Methylenblau, Kristallviolett, SYBR Safe, und Gel-Rot zusammen mit Beschreibungen, wie Sie mit und entdecken das Endprodukt ( http://bitesizebio.com/articles/ethidium-bromide-the- Alternativen / ).
  5. Während die meisten modernen PCR-Maschinen 0,2 ml Gefäße verwenden, können einige Modelle erfordern Reaktionen in 0,5 ml Röhrchen. Sehen Sie Ihren Thermocycler Handbuch, um die passende Größe Rohr zu bestimmen.

5. Berechnung der Schmelztemperatur (T m)

  1. Die Kenntnis der Schmelztemperatur (T m) der Primer ist unerlässlich für eine erfolgreiche PCR-Experiment. Obwohl es mehrere T m-Rechner verfügbar sind, ist es wichtig zu beachten, dass diese Berechnungen eine Schätzung der tatsächlichen T m fällig sind Mangel an spezifischen Informationen über eine bestimmte Reaktion und Annahmen in den Algorithmen für die T m-Rechner selbst gemacht. T m ≈ 4 (GC) + 2 (AT): Allerdings werden Nächster-Nachbar-thermodynamische Modelle über den eher konventionellen Berechnung bevorzugt. Der ehemalige geben genauere T m Schätzung, weil es unter Berücksichtigung der Stapelung Energie von benachbarten Basenpaaren. Letzteres wird immer häufiger, da die Berechnungen einfach sind und schnell von Hand gemacht werden verwendet. Siehe Abschnitt zur Fehlerbehebung für Informationen darüber, wie verschiedene PCR-Bedingungen und Additive beeinflussen Schmelztemperatur.
    Für die Berechnung der T m-Werte von nächsten Nachbarn thermodynamischen Modellen, eines der folgenden Rechner wird empfohlen:
    http://www6.appliedbiosystems.com/support/techtools/calc/
    edu / ~ Zimmer / oligoTMcalc.html "target =" _blank "> http://www.cnr.berkeley.edu/ ~ Zimmer / oligoTMcalc.html
    http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/
    http://www.finnzymes.com/tm_determination.html~~V
    http://mobyle.pasteur.fr/cgi-bin/portal.py? # Formen :: Schmelzen

6. Einrichten Thermal Cycling AGB

  1. PCR Thermocycler schnell Heizen und Kühlen der Reaktionsmischung, so dass für die Wärme-Denaturierung der doppelsträngigen DNA (Strangtrennung), Primer-Annealing an die Plus und Minus-Strängen der DNA-Matrize, und die Dehnung des PCR-Produkts. Rad gemessen auf Basis der Größe der Vorlage und dem GC-Gehalt der DNA berechnet. Die allgemeine formula beginnt mit einer anfänglichen Denaturierung bei 94 ° C bis 98 ° C je nach der optimalen Temperatur für die DNA-Polymerase-Aktivität und GC-Gehalt der DNA. Eine typische Reaktion wird mit einer 1 Minute Denaturierung bei 94 ° C starten Jegliche länger als 3 Minuten kann die DNA-Polymerase zu inaktivieren und zerstören seine enzymatische Aktivität. Ein Verfahren, wie Hot-Start-PCR bekannt, drastisch erweitert die anfängliche Denaturierung der Zeit von 3 Minuten bis zu 9 Minuten. Mit Hot-Start-PCR wird die DNA-Polymerase zugegeben, nachdem die anfänglichen Denaturierungsschritt übertrieben ist abgeschlossen. Dieses Protokoll Modifikation verhindert wahrscheinlich Inaktivierung der DNA-Polymerase-Enzym. Finden Sie im Abschnitt Fehlerbehebung in diesem Protokoll für weitere Informationen über Hot-Start PCR und andere alternative Methoden.
  2. Der nächste Schritt besteht darin, die Thermocycler, und das erste von 25 bis 35 Runden eines Drei-Stufen-Temperatur-Zyklus (Tabelle 2) einzuleiten. Während die Erhöhung der Anzahl von Zyklen über 35 wird in einem Ergebnisgrößere Menge an PCR-Produkte, zu viele Runden führt oft zu der Anreicherung von unerwünschten Nebenprodukten. Die drei Temperatur-Schritte in einem einzigen Zyklus zu schaffen drei Aufgaben: der erste Schritt denaturiert die Vorlage (und in späteren Zyklen, der Amplikons als auch), ermöglicht der zweite Schritt optimale Primer-Anlagerung, und die dritte Stufe ermöglicht die DNA-Polymerase zu binden die DNA-Matrize zu synthetisieren und das PCR-Produkt. Die Dauer und Temperatur jeder Stufe in einem Zyklus verändert werden, um die Produktion des gewünschten Amplikons zu optimieren.
    Die Zeit für die Denaturierung wird so kurz wie möglich gehalten. Gewöhnlich 10 bis 60 Sekunden reicht für die meisten DNA. Die Denaturierung Zeit und Temperatur variieren, abhängig vom GC-Gehalt der Matrizen-DNA, sowie die Rampen-Rate, die die Zeit, die der Thermocycler von einer Temperatur zur nächsten ändern. Die Temperatur für diesen Schritt ist in der Regel die gleichen wie die für das anfängliche Denaturierung Phase verwendet(Schritt 1 oben, z. B. 94 ° C).
    Ein 30 zweite Temperschritt folgt im Takt bei einer Temperatur von etwa 5 ° C unterhalb der scheinbaren T m der Primer (idealerweise zwischen 52 ° C bis 58 ° C).
    Der Zyklus schließt mit einer Dehnung Schritt. Die Temperatur hängt von der DNA-Polymerase für das Experiment ausgewählt. Zum Beispiel hat Taq DNA-Polymerase eine optimale Dehnung von 70 ° C bis 80 ° C und 1 Minute benötigt, um die ersten 2 kb länglichen, erfordert dann eine weitere Minute pro weitere 1 kb amplifiziert. Pfu-DNA-Polymerase ist ein weiteres thermostabilen Enzyms, das eine optimale Dehnung Temperatur von 75 ° C Pfu-DNA-Polymerase ist für die Verwendung in der PCR und Primer-Extension-Reaktionen, die erforderlich High Fidelity und erfordert 2 Minuten für alle 1 kb amplifiziert werden empfohlen. Siehe Empfehlungen des Herstellers für die exakte Temperaturen und Dehnung Dehnung der Zeit für jeden spezifischen DNA-Polymerase angegeben.
  3. Taq DNA-Polymerase, erlaubt die Zugabe von einem Adeninrest an das 3'-Enden der PCR-Produkte. Diese Änderung wird von der terminalen Transferase-Aktivität von Taq DNA-Polymerase vermittelt und ist nützlich für die nachfolgende molekulare Klonierung Prozeduren, die eine 3'-Überhang erfordern.
  4. Die Beendigung der Reaktion wird durch Abkühlen der Mischung auf 4 ° C erreicht und / oder durch Zugabe von EDTA auf eine Endkonzentration von 10 mM.

7. Wichtige Überlegungen bei der Fehlersuche PCR

Wenn Standard-PCR-Bedingungen nicht zu dem gewünschten Amplikon, PCR-Optimierung ist notwendig, um bessere Ergebnisse zu erzielen. Die Stringenz der Reaktion moduliert werden kann, so dass die Spezifität durch Veränderung Variablen eingestellt wird (zB ReagenzKonzentrationen, Radfahren Bedingungen), die das Ergebnis des Amplikons Profil beeinflussen. Zum Beispiel, wenn die Reaktion nicht stringent genug sind, werden viele falsche Amplikons mit variabler Länge erzeugt werden. Wenn die Reaktion ist zu streng, wird kein Produkt hergestellt werden. Fehlersuche PCR-Reaktionen kann ein frustrierendes Unterfangen manchmal sein. Jedoch kann eine sorgfältige Analyse und ein gutes Verständnis der Reagenzien in einer PCR-Experiment verwendet die Menge an Zeit und Tests, die die gewünschten Ergebnisse zu erhalten. Von all den Überlegungen, die Auswirkungen PCR Stringenz, Titration von Mg 2 + und / oder Manipulieren Glühtemperaturen wahrscheinlich die meisten Probleme lösen wird. Bevor jedoch etwas zu ändern, achten Sie darauf, dass ein fehlerhaftes Ergebnis war nicht auf menschliches Versagen zurückzuführen. Starten Sie durch Bestätigen Sie alle Reagenzien auf eine bestimmte Reaktion zugegeben und dass die Reagenzien wurden nicht kontaminiert. Beachten Sie auch die fehlerhaftes Ergebnis, und die folgenden Fragen stellen: Sind Primerdimere sichtbar auf dem Gel nach der ElektrophoreseWiderstand (Diese laufen wie kleine Bands <100 b in der Nähe der Unterseite der Bahn)? Gibt es nicht-spezifischen Produkte (Bands, die in einer anderen Größe als das gewünschte Produkt zu migrieren)? Gab es einen Mangel an einem Produkt? Ist der Ziel-DNA auf einem Plasmid oder in einer genomischen DNA-Extrakt? Auch ist es ratsam, den GC-Gehalt des gewünschten Amplikons zu analysieren.

  1. Bestimmen Sie zunächst, ob einer der PCR-Reagenzien katastrophal auf Ihre Reaktion sind. Dies kann durch die Ausarbeitung neuer Reagenzien (z. B. frische Vorräte arbeiten, neue Verdünnungen), und dann systematisch das Hinzufügen eines neuen Reagenz zu einem Zeitpunkt, zu Reaktionsgemischen erreicht werden. Dieser Prozess wird bestimmen, welche Reagenz war der Schuldige für die fehlgeschlagene PCR-Experiment. Im Fall von sehr alten DNA, die oft akkumuliert Inhibitoren, wurde gezeigt, dass die Zugabe von Rinderserumalbumin kann helfen, das Problem.
  2. Primer Dimere bilden kann, wenn Primer vorzugsweise selbst tempern oder Tempern mit dem anderen Primer in der Reaktion. Wenn dies der Fall ist, eine kleineProdukt von weniger als 100 bp auf dem Agarosegel angezeigt. Starten, indem das Verhältnis der Vorlage Primer, wenn der Primer-Konzentration in extremen Überschreitung des Template-Konzentration, dann werden die Primer mit größerer Wahrscheinlichkeit mit sich selbst oder miteinander über die DNA-Matrize zu tempern. Das Hinzufügen oder DMSO und mit einem heißen Start Temperaturzyklen Verfahren kann das Problem beheben. Am Ende kann es notwendig sein, neue Primer zu entwerfen.
  3. Unspezifische Produkte hergestellt werden, wenn die PCR Stringenz zu niedrig ist und kann nicht-spezifische PCR-Banden mit variabler Länge. Dies erzeugt eine Leiter auf einem Agarosegel. Es ist also ratsam, dass PCR-Bedingungen erhöhen Stringenz zu wählen. Ein Abstrich in verschiedenen Größen können auch aus Primer entwickelt, um stark repetitiven Sequenzen führen, wenn Verstärkung genomischer DNA. Jedoch können die gleichen Primer eine Zielsequenz auf einem Plasmid ohne auf das gleiche Problem zu amplifizieren.
  4. Der Mangel an PCR-Produkte beruht wahrscheinlich auf Reaktionsbedingungendas sind zu streng. Primer-Dimeren und Haarnadelschleifen, die mit den Primern oder in der denaturierten Template DNA bilden kann auch verhindern, Amplifikation von PCR-Produkten, weil diese Moleküle möglicherweise nicht mehr Basenpaaren mit der gewünschten DNA-Gegenstück.
  5. Wenn der GC-Gehalt wurde noch nicht analysiert, ist es Zeit, dies zu tun. PCR von GC-reichen Regionen (GC-Gehalt> 60%) stellen einige der größten Herausforderungen für die PCR. Es gibt jedoch zahlreiche Zusatzstoffe, die verwendet wurden zur Linderung der Herausforderungen.

8. Manipulieren von PCR-Reagenzien

Das Verständnis der Funktion der Reagenzien auf den konventionellen PCR verwendet wird, ist kritisch, wenn erste Entscheidungseinrichtung, wie am besten Reaktionsbedingungen zu verändern, um das gewünschte Produkt erhalten. Erfolg einfach kann auf die Veränderung der Konzentration von MgCl 2, KCl, dNTPs, Primer, Template-DNA oder DNA-Polymerase verlassen. Jedoch kann die falschen Konzentration solcher Reagenzien zu falschen Ergebnissen führen, die Verringerung der stringencY aus der Reaktion. Bei der Fehlersuche PCR, sollte nur ein Reagenz zu einer Zeit, manipuliert werden. Jedoch kann es klug sein, um die manipulierten Reagenz titrieren.

  1. Magnesiumsalz Mg 2 + (Endkonzentration in der Reaktion von 0,5 bis 5,0 mM)
    Thermostabile DNA-Polymerasen erfordern die Anwesenheit von Magnesium als Cofaktor bei der Reaktion aufeinander einwirken läßt. Ändern der Magnesium-Konzentration ist eine der einfachsten Reagenzien mit der vielleicht größten Einfluss auf die Stringenz der PCR zu manipulieren. Im Allgemeinen wird das PCR-Produkt Ausbeute unter Zusatz von höheren Konzentrationen von Mg 2 + zu erhöhen. Jedoch erhöhte Konzentrationen von Mg 2 + verringert auch die Spezifität und Genauigkeit der DNA-Polymerase. Die meisten Hersteller eine Lösung von Magnesiumchlorid (MgCl 2) zusammen mit der DNA-Polymerase und einem 10 × PCR-Puffer-Lösung. Den 10 x PCR-Puffer Lösungen können 15 mM MgCl 2, das ist genug für eine typische PCRUmsetzung, oder sie kann getrennt in einer Konzentration für eine bestimmte Reaktion optimiert zugesetzt werden. Mg 2 + ist nicht wirklich in der Reaktion verbraucht, aber die Reaktion kann ohne sie nicht vorhanden ist fortzufahren. Wenn es zu viel Mg 2 +, kann er vollständige Denaturierung der DNA-Vorlage durch die Stabilisierung der Duplex-Strang zu verhindern. Zuviel Mg 2 + kann auch stabilisieren unechte Primer-Anlagerung an falschen Standorten Vorlage und Abnahme der sich aufgrund einer unerwünschten PCR-Produkte. Wenn es nicht genügend Mg 2 +, wird die Reaktion nicht ab, was zu keinem PCR-Produkt.
  2. Kaliumsalz K + (Endkonzentration in der Reaktion von 35 bis 100 mM)
    Längere PCR-Produkte (10 bis 40 kb) profitieren von reduzierenden Kaliumsalz (KCl) aus seiner normalen 50 mM Reaktionskonzentration, oft in Verbindung mit der Zugabe von DMSO und / oder Glycerin. Wenn die gewünschte Amplicon unter 1000 bp langen und unspezifischer Produkte bilden, Spety kann durch Titration KCl verbessert werden, wodurch die Konzentration in Schritten von 10 mm bis 100 mM. Eine Erhöhung der Salzkonzentration ermöglicht kürzere DNA-Moleküle zu denaturieren, um vorzugsweise mehr DNA-Molekülen.
  3. Desoxynukleotid 5'-Triphosphate (letzte Reaktion Konzentration von 20 und jeweils 200 uM)
    Desoxynukleotid 5'-Triphosphate (dNTPs) können Probleme verursachen, für die PCR, wenn sie nicht an den entsprechenden Gegenwert Konzentrationen (dh [A] = [T] = [C] = [G]) und / oder aufgrund ihrer Instabilität aus wiederholt werden Einfrieren und Auftauen. Die übliche dNTP-Konzentration beträgt 50 uM von jedem der vier dNTPs. Jedoch kann eine PCR tolerieren Konzentrationen zwischen 20 und 200 um jeweils. Niedrigere Konzentrationen von dNTPs erhöhen kann sowohl die Spezifität und Genauigkeit der Reaktion, während übermäßige dNTP-Konzentrationen tatsächlich hemmen können PCR. Für längere PCR-Fragmente, kann eine höhere dNTP-Konzentration erforderlich. Eine große Änderung in der dNTP-Konzentration kann es erforderlich eine entstehendes Änderung der Konzentration von Mg 2 +.
  4. Thermisch stabile DNA-Polymerasen
    PCR-Enzymen und Puffern mit diesen Enzymen assoziiert haben einen langen Weg zurückgelegt, seit die ersten Taq DNA Polymerase erste beschäftigt war. Somit kann die Auswahl eines geeigneten Enzyms hilfreich sein für den Erhalt von gewünschten Amplikons Produkte. Zum Beispiel die Verwendung von Taq DNA-Polymerase kann über Pfu DNA-Polymerase bevorzugt sein, wenn Prozessivität und / oder die Zugabe eines Adenin-Rest an das 3'-Enden des PCR-Produkts gewünscht ist. Die Zugabe eines 3'-Adenin ist jetzt nützliche Strategie zur Klonierung PCR-Produkte in TA-Vektoren Whit 3 'Thymin Überhänge. Allerdings, wenn Treue ist wichtiger, ein Enzym wie Pfu kann eine bessere Wahl zu sein. Mehrere Hersteller haben eine Reihe von spezifischen DNA-Polymerasen für spezielle Bedürfnisse entwickelt wurde. Werfen Sie einen Blick auf die Reaktionsbedingungen und die Eigenschaften des gewünschten Amplikons, und dann passen die PCR-Experiment mit der entsprechenden DNA-polymerase. Die meisten Hersteller haben Tabellen, dass die Beihilfen DNA-Polymerase-Auswahl durch die Auflistung von Eigenschaften wie Treue, Ertrag, Geschwindigkeit, optimale Soll-Längen, und ob es nützlich für die GC-reiche Verstärkung oder Hot-Start PCR.
  5. Template-DNA
    DNA-Qualität und Reinheit wird einen wesentlichen Einfluss auf die Wahrscheinlichkeit einer erfolgreichen PCR-Experiment. DNA und RNA-Konzentrationen kann unter Verwendung ihrer optischen Dichte bei 260 nm (OD 260) werden. Die Masse der gereinigten Nukleinsäuren in Lösung wird bei 50 ug / ml doppelsträngige DNA oder 40 ug / ml für entweder RNA oder einzelsträngige DNA bei einer OD 260 = 1,0 berechnet. DNA-Extraktion Verunreinigungen sind häufig in der PCR-Inhibitoren und sollte sorgfältig vermieden werden. Gemeinsame DNA-Extraktion PCR-Inhibitoren schließen Proteine, RNA, organische Lösungsmittel und Reinigungsmittel. Wenn die maximale Absorption von Nukleinsäuren OD 260 zu der Proteine ​​OD280 (OD 260/280) verglichen wird, ist es möglich, dann selbst bestimmene eine Abschätzung der Reinheit der extrahierten DNA. Idealerweise ist das Verhältnis der OD 260/280 zwischen 1,8 und 2,0. Niedrigere OD 260/280 ist ein Hinweis auf Protein und / oder Lösungsmittel, die Kontamination, aller Wahrscheinlichkeit nach als problematisch für die PCR wird.
    Zusätzlich zu der Qualität der Matrizen-DNA, die Optimierung der Menge an DNA kann von großem Nutzen das Ergebnis einer PCR-Experiment. Obwohl es zweckmäßig, die Menge in ng / ul, die oft ist der Ausgang für moderne nanospectrophotometers bestimmen, wird die entsprechende Baugruppe für eine erfolgreiche PCR-Experiment die Anzahl der Moleküle. Das heißt, wie viele Kopien der DNA-Matrize eine Sequenz enthalten, die komplementär zu den PCR-Primer? Optimale Zielmoleküle zwischen 10 April - 10 Juli Moleküle und werden berechnet, wie in den Anmerkungen oben beschrieben wurde.

9. Zusatzreagenzien

Additive Reagenzien kann zu Ergebnissen führen, wenn alle Stricke reißen. Das Verständnis der Reagenzienund wofür werden sie verwendet, ist von entscheidender Bedeutung bei der Bestimmung der Reagenzien kann am wirksamsten bei der Akquisition des gewünschten PCR-Produkt. Zugabe von Reagenzien zu der Reaktion wird durch die Tatsache, dass eine Manipulation eines Reagens kann die nutzbare Konzentration eines anderen Reagenz beeinflussen kompliziert. Zusätzlich zu den unten aufgeführten Reagenzien sind im Handel erhältlichen Additiven proprietäre aus vielen Biotechnologieunternehmen zur Verfügung.

10. Zusatzstoffe, die GC-reichen Templates Profitieren

  1. Dimethylsulfoxid (Endkonzentration in der Reaktion von 1-10% DMSO)
    In PCR-Experimenten, bei denen die Matrizen-DNA ist besonders GC-reich (GC-Gehalt> 60%), indem DMSO kann die Reaktion durch Unterbrechung Basenpaarung und reduziert damit die T m zu erhöhen. Einige T m-Rechner eine variable Eintrag für die Zugabe von DMSO-Konzentration in der PCR-Experiment gewünscht. Jedoch kann das Hinzufügen von mehr als 2% DMSO erforderlich Hinzufügen von mehr DNA-Polymerase wie es war Dämonstrated zu Taq DNA-Polymerase hemmen.
  2. Formamid (letzte Reaktion Konzentration von 1,25 bis 10%)
    Wie DMSO, Formamid stört auch Basenpaarung bei gleichzeitiger Erhöhung der Stringenz der Primer-Annealing, die in weniger unspezifische Grundierung und erhöhte Amplifikationseffizienz führt. Formamid wurde auch gezeigt, dass ein Enhancer für die GC-reiche Vorlagen sein.
  3. 7-Desaza-2'-Desoxyguanosin-5'-Triphosphat (letzte Reaktion Konzentration von DC 7 GTP, 3 DC 7 GTP: 1 dGTP 50 uM)
    Mit 3 Teilen, oder 37,5 uM, der Guanosin Basenanalogon DC 7 GTP in Verbindung mit 1 Teil, oder 12,5 um, wird dGTP Bildung von Sekundärstrukturen im Produkt zu destabilisieren. Als das Amplifikat oder Matrizen-DNA denaturiert wird, wird es oft zu bilden Sekundärstrukturen wie Haarnadelschleifen. Der Einbau von DC 7 GTP in die DNA-Amplikon wird untersagen Bildung von diesen anormalen Strukturen.

Hinweis:

7 GTP dämpft das Signal von Ethidiumbromid-Färbung, weshalb es im Verhältnis 3:1 mit dGTP verwendet wird.

  1. Betain (letzte Reaktion Konzentration von 0,5 M bis 2,5 M)
    Betain (N, N, N-Trimethylglycin) eine zwitterionische Aminosäure-Analogon, das reduziert und kann sogar den DNA-Schmelztemperatur Abhängigkeit von Nukleotid-Zusammensetzung. Es wird als Zusatzstoff einer PCR-Amplifikation von GC-reichen Ziele zu unterstützen verwendet. Betain wird oft in Kombination mit DMSO eingesetzt und kann stark die Wahrscheinlichkeit erhöhen, zum Verstärken Target-DNA mit hohen GC-Gehalt.

11. Zusatzstoffe, die PCR in Gegenwart von Inhibitoren Hilfe

  1. Nicht ionische Detergenzien funktionieren zur sekundären Struktur zu unterdrücken und zur Stabilisierung der DNA-Polymerase. Nicht ionische Detergenzien wie Triton X-100, Tween 20, oder NP-40 bei Umsetzung Konzentrationen von 0,1 bis 1% verwendet werden, um Amplikon zu erhöhen. Allerdings konzentrations über 1% sein kann hemmend auf PCR. Die Anwesenheit von nicht-ionischen Detergenzien abnimmt PCR Stringenz, was möglicherweise zu falschen Produktbildung. Allerdings wird ihr Einsatz auch neutralisieren die hemmende Einfluss von SDS, eine gelegentliche Verunreinigungen der DNA-Extraktion-Protokolle.
  2. Die Zugabe der Proteine, wie Rinderserumalbumin (BSA) verwendet bei 400 ng / ul und / oder T4 Gen 32-Protein bei 150 ng / ul Hilfe PCR in Gegenwart von Inhibitoren wie FeCl 3, Hämin, Fulvinsäure, Huminsäure, Gerbsäuren, oder Auszüge aus Kot, frisches Wasser, und Meerwasser. Allerdings sind einige PCR-Inhibitoren, einschließlich Gallensalze, Bilirubin, EDTA, NaCl, SDS oder Triton X-100, durch die Zugabe von entweder BSA oder T4 Gen 32-Protein vermindert.

12. Änderungen an PCR-

  1. Optimierung der Glühtemperatur erhöht jeden PCR-Reaktion und sollte in Kombination mit anderen Additiven und / oder zusammen mit anderen mo betrachtet werden Prozessmodifikationen zum Radfahren Bedingungen. Somit, um die optimale Glühtemperatur Berechnung der folgenden Gleichung verwendet wird:
    T ein OPT = 0,3 m T Primer + 0,7 T m Produkt -14,9
    T m Primer wird als T m der weniger stabilen Paar unter Verwendung der Gleichung:
    T m Primer = ((AH ​​/ (As + R x ln (c / 4))) -273,15 + 16,6 log [K +] Wo AH ist die Summe der nächste Nachbar Enthalpieänderungen für Hybriden; As ist die Summe aus der Nächster-Nachbar-Entropie ist, R die Gaskonstante (1,99 cal K-1 mol-1) ist, C die Primerkonzentration und [K +] ist die Kalium-Konzentration.
    Die letztere Gleichung kann unter Verwendung eines der T m-Rechner auf der folgenden Website aufgeführt werden:
    rs / Schmelz / sup_mat / servers_list.html "target =" _blank "> http://protein.bio.puc.cl/cardex/servers/melting/sup_mat/servers_list.html
    T m Produkt wird wie folgt berechnet:
    T = 0,41 m Produkt (% GC) + 16,6 log [K +] - 675/product Länge
    Für die meisten PCR-Reaktionen die Konzentration von Kalium ([K +]) wird zu 50 mm betragen.
  2. Heißstart PCR ist eine vielseitig einsetzbare, in dem die anfängliche Denaturierung drastisch erhöht (Tabelle 4). Diese Modifikation kann mit oder ohne weitere Modifikationen an Rad-Bedingungen aufgenommen werden. Darüber hinaus ist es oft in Verbindung mit Additiven für temperamentvolle Amplikon-Bildung. In der Tat ist Heißstart PCR zunehmend als reguläre Aspekt der allgemeinen Zirkulation Bedingungen enthalten. Hot-Start wurde gezeigt, dass Amplikon Ausbeute zu erhöhen, bei gleichzeitiger Erhöhung der Spezifität und Genauigkeit der Reaktion.Das Grundprinzip hinter Heißstart PCR ist, um die Primer-Dimer und unspezifische Grundierung, die als Folge der Einführung der Reaktion unterhalb der T m führen kann zu beseitigen. Somit heizt ein typisches Warmstart Reaktion der Probe auf eine Temperatur oberhalb der optimalen T m, mindestens bis 60 ° C, bevor eine Amplifikation in der Lage zu rechnen ist. Im Allgemeinen wird die DNA-Polymerase aus der Reaktion während des ersten, länglichen, Denaturieren Zeit zurückgehalten. Obwohl andere Komponenten der Reaktion manchmal anstelle der DNA-Polymerase hier weggelassen werden wir uns auf die DNA-Polymerase zu konzentrieren. Es gibt mehrere Verfahren, die die DNA-Polymerase inaktiv zu bleiben oder physikalisch getrennt, bis die anfängliche Denaturierung Zeitraum abgeschlossen ist, einschließlich der Verwendung eines festen Wachsbarriere, Anti-DNA-Polymerase-Antikörper und akzessorischen Proteinen erlauben. Alternativ kann die DNA-Polymerase einfach zu der Reaktion gegeben werden, nachdem die anfängliche Denaturierung Zyklus abgeschlossen ist.
  3. Touchdown-PCR (TD-PCR) istdazu vorgesehen, einen Teil der Vermutung ausarbeiten von den T m Berechnung Einschränkungen, die durch die berechneten Bracketing Glühtemperaturen. Das Konzept ist auf zwei Phasen des Zyklus-Bedingungen (Tabelle 5) zu entwerfen. Die erste Phase beschäftigt immer niedrigeren Glühtemperaturen jeden zweiten Zyklus (traditionell 1,0 ° C), beginnend bei 10 ° C über und endet bei der berechneten T m oder leicht darunter. Die zweite Phase nutzt die Standard-3-Schritt Bedingungen die Glühtemperatur auf 5 ° C unterhalb der berechneten T m für weitere 20 bis 25 Zyklen. Die Funktion der ersten Phase, zu lindern Mispriming und zu einem 4-fach Vorteil des richtigen Produkts. So wurde nach 10 Zyklen, wäre eine 410-fach Vorteil 4.096 Kopien des richtigen Produkts über ein störender Grundierung ergeben.
    • Stepdown PCR ähnelt TD-PCR mit weniger Schritten in der ersten Phase der Grundierung. Als ein Beispiel, senkt die erste Phase Glühtemperaturen jedezweiten Zyklus von 3 ° C, beginnend bei 10 ° C oberhalb und endet bei 2 ° C unterhalb der berechneten T m. Wie TD-PCR, verwendet der zweiten Phase die Standard-3-Schritt Bedingungen die Glühtemperatur auf 5 ° C unterhalb der berechneten T m für weitere 20 bis 25 Zyklen. Dies würde es das richtige Produkt eine 256-fach Vorteil gegenüber falsche Grundierung Produkte.
    • Verlangsamung PCR ist einfach eine Modifikation des TD-PCR und wurde zur Verstärkung extrem GC-reich (über 83%) Sequenzen (Tabelle 6) erfolgreich. Das Konzept berücksichtigt eine relativ neue Funktion mit modernen Thermocycler, die Anpassung der Rampe Geschwindigkeit sowie die Abkühlgeschwindigkeit ermöglicht assoziiert. Das Protokoll nutzt auch DC 7 GTP zu 2 ° Strukturbildung, die die Reaktion hemmen könnte, zu reduzieren. Die Rampe Geschwindigkeit bis 2,5 ° C gesenkt s -1 bei einer Abkühlgeschwindigkeit von 1,5 ° C s -1 für die Glühzyklen. Die erste Phase beginnt mit einer einnungsarmglühen Temperatur von 70 ° C und reduziert die Annealingtemperatur um 1 ° C alle 3 Runden, bis es 58 ° C erreicht Die zweite Phase wird dann weiterhin mit einer Glühtemperatur von 58 ° C für weitere 15 Zyklen.
  4. Nested PCR ist ein leistungsfähiges Werkzeug verwendet werden, um störende Produkte zu beseitigen. Die Verwendung von nested Primer ist besonders hilfreich, wenn es mehrere paraloge Gene in einem Genom vorhanden sind oder wenn es niedriger Kopienzahl einer Zielsequenz in einer heterogenen Population von orthologen Sequenzen. Das grundlegende Verfahren umfasst zwei Sätze von Primern, die eine Region der DNA zu amplifizieren. Die äußeren Primer überspannen das Segment von Interesse und werden verwendet, um PCR-Produkte, die oft unspezifisch in 20 bis 30 Zyklen zu erzeugen. Ein kleines Aliquot der Regel etwa 5 ul von dem ersten 50 ul Reaktion wird dann als Template-DNA für weitere 20 bis 30 Runden der Amplifikation unter Verwendung des zweiten Satzes von Primern, die an einer internen Stelle relativ Glühen verwendetzu dem ersten Satz.

Andere PCR-Protokolle sind stärker spezialisiert und gehen über den Rahmen dieses Papiers. Beispiele umfassen RACE-PCR, Multiplex-PCR, Vectorette-PCR, quantitative-PCR und RT-PCR.

13. Repräsentative Ergebnisse

Repräsentative PCR-Ergebnisse wurden unter Befolgung der grundlegenden PCR-Protokolle oben beschrieben erzeugt. Die Ergebnisse beinhalten verschiedene Strategien zur Fehlerbehebung die Wirkung von verschiedenen Reagenzien und Bedingungen für die Reaktion zeigen. Gene aus der Bäckerhefe Saccharomyces cerevisiae und aus einem nicht charakterisierten Mykobakteriophagen wurden in diesen Experimenten verstärkt. Der Standard-3-Schritt-PCR-Protokoll in Tabelle 2 dargestellt wurde, wurde für alle drei nachfolgend beschriebenen Versuche angestellt.

Vor dem Einrichten des PCR-Experiment, die genomische DNA sowohl von S. cerevisiae und die Mykobakteriophagen wurden quantifiziert und auf eine Konzentration verdünnt, die würde allow zwischen 10 4 und 10 7 Moleküle DNA pro Reaktion. Die Arbeitsbedingungen Aktien wurden wie folgt hergestellt. Eine genomische Hefe-DNA-Präparation ergab 10 4 ng / ul. Eine Verdünnung auf 10 ng / ul wurde durch Zugabe von 48 ul in 452 ul TE-Puffer pH 8,0 generiert. Seit dem S. cerevisiae Genom ist etwa 12,5 MB, 10 ng enthalten 7,41 X 10 5 Moleküle. Die genomische DNA-Präparation Mykobakteriophagen ergab 313 ng / ul. Eine Verdünnung auf 2 ng / ul wurde durch Zugabe von 6,4 ul in 993,6 ul TE-Puffer pH 8,0 generiert. Diese Phagen-DNA ist etwa 67 KB. Somit enthält 1 ng 2,73 x 10 7 Moleküle, die an der oberen Grenze der DNA im allgemeinen für eine PCR verwendet wird. Die Arbeitsbedingungen Bestände wurden dann verwendet, um die Master-Mix-Lösungen in der Tabelle 7 skizziert generieren. Experimente variiert Zyklusbedingungen wie unten beschrieben.

In Abbildung 3a, genomische DNA aus S. cerevisiae wurde als Matrize zur Amplifikationdie GAL3 Gen, das ein Protein in Galactose-Metabolismus beteiligt kodiert. Das Ziel dieses Experiments war es, die optimale Mg 2 +-Konzentration für diesen Satz von Reagenzien zu prüfen. Kein MgCl 2 war in der ursprünglichen PCR-Puffer und musste in den Konzentrationen mit einer Reichweite getestet von 0,0 mm bis 5,0 mm angegeben ergänzt werden. Wie in der Figur gezeigt, wird ein PCR-Produkt der erwarteten Größe (2098 bp) ausgehend von einem Mg 2 +-Konzentration von 2,5 mM (Spur 6) mit einer optimalen Konzentration von 4,0 mM (Spur 9). Die empfohlene Konzentration des Herstellers betrug 1,5 mM, die die Menge in typischen PCR-Puffer vorgesehen ist. Es mag überraschen, überschritten die nötige Konzentration für die Produktbildung in diesem Experiment benötigt diesen Betrag.

Eine andere DNA-Template wurde für das Experiment in Abbildung 3b dargestellt verwendet. Genomische DNA aus einer Mykobakteriophagen wurde verwendet, um eine konservierte 566 bp DNA-Segment zu amplifizieren.Wie bei der vorherigen Experiment hatte die optimale Mg 2 +-Konzentration bestimmt werden soll. Wie in 3b gezeigt, erfordert Amplifikation des gewünschten PCR-Produkt mindestens 2,0 mM Mg 2 + (Spur 5). Während es Variabilität bei der Menge des Produkts in steigenden Konzentrationen von MgCl 2 gebildet ist, wurde die PCR-Produkt bei 4 mM beobachtet Mg 2 + (Spur 9), die gleiche Konzentration der Hefe GAL3 Gens beobachtet.

Beachten Sie, dass in den Experimenten in den 3A und 3B dargestellt, eine diskrete Bande wurden unter Verwendung der zyklischen Bedingungen als optimal auf der Grundlage Primer Annealing-Temperaturen. Insbesondere betrug die Denaturierungstemperatur 95 ° C mit einer Annealingtemperatur von 61 ° C, und die Extension erfolgte für 1 Minute bei 72 ° C für 30 Zyklen. Der letzte 5 Minuten Verlängerung wurde dann bei 72 ° C durchgeführt Für das dritte Experiment in Abbildung 3c präsentierten in 3c gezeigt, was ein diskretes Band in 3a wird ein Abstrich von unspezifischen unter diesen suboptimalen Zyklusbedingungen. Darüber hinaus mit der allgemeinen Stringenz der Reaktion reduziert wird, eine geringere Menge an Mg 2 + ist erforderlich, um ein Amplikon zu bilden.

Alle drei Experimente zeigen, dass, wenn Mg 2 +-Konzentrationen zu niedrig sind, gibt es kein Amplifikat Produktion. Diese Ergebnisse zeigen auch, dass, wenn die beiden Rad-Bedingungenkorrekt konstruiert und Reagenzien sind bei optimalen Konzentrationen erzeugt die PCR-Experiment eine diskrete Amplikon entsprechend der erwarteten Größe. Die Ergebnisse zeigen die Bedeutung der Durchführung von PCR-Experimente auf einem hinreichend hohen Stringenz (zB diskrete Banden im Vergleich zu einem Abstrich). Darüber hinaus zeigen die Experimente, dass die Änderung eines Parameters kann einen anderen Parameter beeinflussen, was sich auf den Ausgang der Reaktion.

Reagens Die Konzentration der Stammlösungen Volumen 13X **
Master Mix
Endkonzentration
Sterilem H 2 O QS auf 50 ul QS auf 650 ul
PCR-Puffer 10X 5 ul 65 ul 1X
dNTPs 10 mM 1 ul 13 ul 200 uM
MgCl 2 25 mM 3 ul 39 ul 1,5 mM
Forward-Primer 20 uM = 20 pmol / ul 1 ul 13 ul 20 pmol
Reverse-Primer- 20 uM = 20 pmol / ul 1 ul 13 ul 20 pmol
Template-DNA Variable Variable Variable ~ 10 5 Moleküle
Taq DNA-Polymerase 5 Einheiten / ul * 0,5 ul 6,5 ul 2,5 Einheiten
50 ul / Reaktion

Tabelle 1. PCR-Reagenzien in der Reihenfolge ihres hinzugefügt werden soll.

* Einheiten können von Hersteller zu Hersteller

** Fügen Sie alle Reagenzien auf dem Master Mix ohne jede Notwendigkeit in der Titration oder jenes kann variabel sein, um die Reaktion. Der Master-Mix in der obigen Tabelle dargestellt ist, für 11, 2 zusätzliche Reaktionen Reaktionen berechnet, um sicherzustellen, Pipette Transfer Verlust gibt es genug zu aliquoten zu jedem Reaktionsgefäß unterzubringen.

Standard-3-Schritt-PCR-Cycling
Zyklusschrittanzeige Temperatur Zeit Anzahl der Zyklen
Initiale Denaturierung 94 ° C bis 98 ° C 1 Minute 1
Denaturierung
Glühen
Erweiterung
94 ° C
5 ° C unter T m
70 ° C bis 80 ° C
10 bis 60 Sekunden
30 Sekunden
Amplicon und DNA-Polymerase abhängig
25-35
Letzte Extension 70 & dzB; C bis 80 ° C 5 Minuten 1
Halten Sie * 4 ° C 1

Tabelle 2. Standard-3-Schritt-PCR-Cycling.

* Die Thermocycler haben die Fähigkeit zur Pause bei 4 ° C unbegrenzt am Ende der Zyklen.

70 ° C bis 80 ° C
2-Schritt-PCR-Cycling
Zyklusschrittanzeige Temperatur Zeit Anzahl der Zyklen
Initiale Denaturierung 94 ° C bis 98 ° C 1 Minute 1
Denaturierung
Annealing / Extension
10 bis 60 Sekunden
Amplicon und DNA-Polymerase abhängig
25-35
Letzte Extension 70 ° C bis 80 ° C 5 Minuten 1

Tabelle 3. 2-Schritt-PCR-Cycling.

Hot Start PCR-Cycling
Zyklusschrittanzeige Temperatur Zeit Cycles
Initiale Denaturierung 60 ° C bis 95 ° C 5 Minuten fügen Sie dann DNA-Polymerase 1
Denaturierung
Glühen
Erweiterung
94 ° C
5 ° C unter T m
70 ° C bis 80 ° C
10 bis 60 Sekunden
30 Sekunden
Amplicon und DNA-Polymerase abhängig
25-35
Letzte Extension 70 ° C bis 80 ° C 5 Minuten 1

Tabelle 4. Hot Start PCR-Cycling.

Touchdown PCR-Cycling
Zyklusschrittanzeige Temperatur Zeit Cycles
Initiale Denaturierung 94 ° C bis 98 ° C 1
Denaturierung
Glühen
Erweiterung
94 ° C
X = 10 ° C über T m
70 ° C bis 80 ° C
10 bis 60 Sekunden
30 Sekunden
Amplicon und DNA-Polymerase abhängig
2
Denaturierung
Glühen


Erweiterung
94 ° C
X-1 ° C 1 ° C zu reduzieren jeden zweiten Zyklus
70 ° C bis 80 ° C
10 bis 60 Sekunden
30 Sekunden
Amplicon und Polymerase-abhängige
28
Denaturierung
Glühen
Erweiterung 94 ° C
5 ° C unter T m
70 ° C bis 80 ° C
10 bis 60 Sekunden
30 Sekunden
Amplicon und DNA-Polymerase abhängig
20-25
Letzte Extension 70 ° C bis 80 ° C 5 Minuten 1

Tabelle 5. Touchdown PCR-Cycling.

Verlangsamung PCR-Cycling
Zyklusschrittanzeige Temtur Zeit Cycles
Initiale Denaturierung 94 ° C bis 98 ° C 1 Minute 1
Denaturierung
Glühen
Erweiterung
94 ° C
X ° C = 10 ° C oberhalb von T m
70 ° C bis 80 ° C
10 bis 60 Sekunden
30 Sekunden
Amplicon und Polymerase-abhängige
2
Denaturierung
Glühen


Erweiterung
94 ° C
X-1 ° C 1 ° C zu reduzieren jeden zweiten Zyklus
70 ° C bis 80 ° C *
10 bis 60 Sekunden
30 Sekunden
Einmplicon und Polymerase-abhängige
28
Denaturierung
Glühen
Erweiterung
94 ° C
5 ° C unter T m
70 ° C bis 80 ° C
10 bis 60 Sekunden
30 Sekunden
Amplicon und Polymerase-abhängige
20-25
Letzte Extension 70 ° C bis 80 ° C 5 Minuten 1

Tabelle 6. Verlangsamung PCR-Cycling.

* Für Abschwächung PCR wird die Änderungsgeschwindigkeit bis 2,5 ° C gesenkt s -1 bei einer Abkühlgeschwindigkeit von 1,5 ° C s -1 für die Glühzyklen.

Stammlösung Volume hinzugefügt, um 50 pl Reaktion 13 X Hefe Master Mix 13 X Phage Master Mix Endkonzentration
Sterilem H 2 O qs auf 50 ul ul = 31 oder 30,5 qs auf 650 ul = 396,5 qs auf 520 ul = 403 ul
PCR-Puffer 10X 5 ul 65 ul 65 ul 1X
10 mM 1 ul 13 ul 13 ul 200 uM
MgCl 2 Titration Gestellt zu jeder Reaktion Gestellt zu jeder Reaktion Gestellt zu jeder Reaktion Variable sehen Titration
Forward-Primer 20 uM = 20 pmol / ul 1 ul 13 ul 13 ul 20 pmol
Reverse-Primer- 20 uM = 20 pmol / ul 1 ul 13 ul 13 ul 20 pmol
Template-DNA 2 ng / ul Phagen oder 10 ng / ul Hefe 0,5 ul ul Phage oder ein Hefe- 6,5 ul 13 ul ~ 10 7 Moleküle Phage oder ~ 10 5 Moleküle Hefe
Polymerase 0,5 Einheiten / ul ** 0,5 ul 6,5 ul 6,5 ul 0,5 Einheiten / Reaktion
40 ul + 10 (Titration) ul / Reaktion TITRATION
[MgCl 2] 0,00 mm 0,5 mM 1,0 mM 1,5 mM 2,0 mM 2,5 mM 3,0 mM 3,5 mM 4,0 mM 4,5 mM 5,0 mM
MgCl 2 0,00 ul 1,00 ul 2,00 ul 3,0 ul 4,00 ul 5,00 ul 6,00 ul 7,00 ul 8,00 ul 9,00 ul 10,00 ul
H 2 O 10,00 ul 9,00 ul 8,00 ul 7,00 ul 6,00 ul 5,00 ul 4,00 ul 3,00 ul 2,00 ul 1,00 ul 0,00 ul

<strong> Tabelle 7. Titration von Mg 2 + in Abbildung 3 verwendet.

1
Abbildung 1. Allgemeine Probleme, die mit Primer und 3-Schritt-PCR-Amplifikation der Ziel-DNA entstehen. (A) Self-Primer-Anlagerung, was zur Bildung von sekundären Haarnadelschleife Struktur. Beachten Sie, dass Primer nicht immer an den äußersten Enden anlagern kann und kleinere Schleifen-Strukturen zu bilden. (B) Primer Annealing miteinander, als Template-DNA, wodurch Primerdimere. Wenn die Primer zueinander Glühen daß sie zu den Enden Primer zu verlängern. (C) PCR-Zyklen Erzeugen eines spezifischen Amplikon. Standard-3-Schritt-PCR-Biking Denaturierung der Matrizen-DNA, Primer-Annealing und Verlängerung der Ziel-DNA (Amplikon) durch DNA-Polymerase.

2
Abbildung 2. Eiseimer mit ReagEltern, Pipetten und Racks für eine PCR erforderlich. (1.) P-200 Pipette (2). P-1000 Pipette (3.) P-20 Pipette (4.) P-10 Pipette (5.) 96-Well-Platte und 0,2 ml dünnwandigen PCR-Röhrchen , (6). Reagenzien einschließlich Taq-Polymerase, 10X PCR-Puffer, MgCl 2, steriles Wasser, dNTPs, Primer und Matrizen-DNA, (7). 1,8 ml Röhrchen und Rack.

Abbildung 3
3. Beispiel eines Mg 2 +-Titrationen verwendet, um eine PCR-Experiment unter Verwendung einer Standard-3-Schritt-PCR-Protokoll zu optimieren. (A) S. cerevisiae Genomische Hefe-DNA wurde als Matrize verwendet, um eine 2098 bp GAL3 Gen zu amplifizieren. In den Spuren 1-6, wobei die Mg 2 +-Konzentration zu niedrig ist, es entweder kein Produkt gebildet (Spuren 1-5) oder sehr wenig Produkt gebildet (Spur 6). Lanes 7-11 stellen optimalen Konzentrationen von Mg 2 + für dieses PCR-Experiment wie durch das Vorhandensein des 2098 bp-Amplikon Produkt angegeben. (B) Der uncharacterized Mykobakteriophagen genomischen DNA-Matrize verwendet, um ein 566 bp-Amplikon zu verstärken. Die Spuren 1 - 4, ist die Mg 2 +-Konzentration zu niedrig ist, was durch das Fehlen des Produkts zeigte. Lanes 5-11 stellen optimalen Konzentrationen von Mg 2 + für dieses PCR wie durch die Anwesenheit der Amplikons 566 kb Produkt angegeben. (C). S. cerevisiae Genomische Hefe-DNA wurde als Matrize verwendet, um eine 2098 bp zu amplifizieren GAL3 wie in einem Panel. Jedoch, die Annealingtemperatur von 61 ° C bis 58 ° C reduziert, was zu einer nicht-spezifischen PCR-Banden mit variabler Länge Herstellung eines Schmiereffekt auf dem Agarosegel. Die Spuren 1 - 4, wenn der Mg 2 +-Konzentration zu niedrig ist, gibt es kein Produkt gebildet. Lanes 5-8 stellen optimalen Konzentrationen von Mg 2 + für dieses PCR wie durch das Vorhandensein einer Schmierschicht und Band um den 2098 KB Amplikon Produktgröße zu sehen. Lanes 9 bis 11 weisen auf eine übermäßig strenge Bedingungen ohne Produkt gebildet. (Ac) Spuren: 12 ist, belastenve Kontrolle, die nicht enthielt keine DNA. Spur M (Marker) wurde mit NEB 1kb Ladder geladen.

Abbildung 4
Abbildung 4. Sterile Röhrchen für die PCR verwendet. (1.) 1,8 ml-Tube (2.) 0,2 ml einzelnen dünnwandigen PCR-Röhrchen, (3.) 0,2 ml Streifen dünnwandigen PCR-Röhrchen und Kappen.

Abbildung 5
Abbildung 5. Thermocycler. Geschlossen Thermocycler linke Bild. Rechtes Bild enthält 0,2 ml dünnwandigen PCR-Röhrchen im Heizblock eines offenen Thermocycler platziert.

Discussion

PCR hat sich zu einem unverzichtbaren Werkzeug in der biologischen Wissenschaft Arsenal. PCR hat den Kurs der Wissenschaft verändert Biologen erlaubt, Macht über die Genome liefern, und machen Hybrid-Gene mit neuartigen Funktionen, so dass spezifische und genaue klinische Tests, Einblicke in Genome und Vielfalt, sowie einfach Klonierung von Genen für die weitere biochemische Analyse. PCR-Anwendung wird nur durch die Phantasie des Wissenschaftlers, der seine Macht ausübt begrenzt. Es gibt viele Bücher und Papiere, die neue spezialisierte Anwendungen der PCR zu beschreiben, und viele mehr werden über die nächste Generation der biologischen Wissenschaft entwickelt werden. Doch unabhängig von den erwarteten Ansätzen hat sich die fundamentalen Rahmenbedingungen die gleichen geblieben. PCR, in seiner ganzen Größe, ist ein in vitro-Anwendung, große Mengen an ein bestimmtes Segment der DNA zu erzeugen.

Entwerfen einer PCR-Experiment erfordert Denken und Geduld. Die Ergebnisse in Abbildung 3 dargestellt beispielhaft eine der wichtigsten challenges bei der Konzeption einer Optimierungsstrategie für die PCR. Das heißt, als ein Parameter der PCR geändert wird, kann das Einfluss auf andere. Als Beispiel, wenn der erste PCR wurde bei einer suboptimalen Glühtemperatur (58 ° C) mit einem optimalen Mg 2 +-Konzentration von 2,0 mM, dann ist das Ergebnis würde ein Abstrich, wie in 3c zu sehen. Ein Versuch, die Schmierschicht auflösen könnte erfordert den Aufbau PCR-Bedingungen mit Reaktionen, die 2,0 mM MgCl 2 und Anpassung der Annealingtemperatur auf 61 ° C. Jedoch, wie in Abbildung 3a zu sehen, würde dies zu keinem Produkt. Folglich ist es ratsam, Reagenzien titrieren, anstatt das Hinzufügen einer Konzentration auf eine einzige Reaktion, bei der Fehlersuche falschen Ergebnissen. Außerdem sind die häufigsten Anpassungen, die für die Optimierung eines PCR-Experiment erforderlich sind, um die Mg 2 +-Konzentration zu verändern und die Härtungstemperaturen zu korrigieren. Allerdings, wenn diese Änderungen nicht minimieren oder aufzuheben falschen Ergebnissen, die Titration von additives und / oder Verändern der Radsport Zustand Protokolle wie in den Tabellen 6.2 beschrieben, kann das Problem zu lindern. Wenn alle Stricke reißen, Redesign der Primer und versuchen, versuchen Sie es erneut.

Disclosures

Ich habe nichts zu offenbaren.

Acknowledgments

Besonderen Dank an Kris Reddi an der UCLA für die Einrichtung Reagenzien und Gele gießen und auf Erin Sanders an der UCLA für Inspiration, Anleitung und Unterstützung und das Korrekturlesen des Manuskripts. Ich würde auch dank Giancarlo Costaguta und Gregory S. Payne gerne zur Versorgung der Hefe genomischer DNA und Primer, die GAL3 Gens zu amplifizieren. Ich möchte auch Bhairav ​​Schah zur Aufnahme von Bildern der Laborgeräte und Reagenzien verwendet, um Abbildungen 2 machen danke - 4. Finanzierung für dieses Projekt wurde von HHMI (HHMI Grant Nr. 52006944) zur Verfügung gestellt.

Materials

Name Company Catalog Number Comments
Taq Polymeras Sigma-Aldrich D4545-25UN
dNTPs Qiagen 201225
0.2 ml Thin Wall Tubes PCR tubes Bio-Rad 223-9469
0.2 ml Thin Wall Tube caps Bio-Rad 223-9472
EDTA disodium salt dihydrate Sigma-Aldrich E5134
Trizma-HCl Sigma-Aldrich T-3253
Custom Phage Primer Invitrogen 25441F_RL6_Contig2_68k TACTGCAACGCGATGTTGCG
Custom Phage Primer Invitrogen 26007R_RL6_ Contig2_68k TCACCATCAATCGTGGCGGT
Custom Yeast Primer Integrated DNA Technologies SacI-Gal3(-256) ACCTGGAGCTCCTATTT TAACATGTGGATTTCTTGAAAGAATGAAATCG
Custom Yeast Primer Integrated DNA Technologies Gal3(1848)-SacI CGGATGGAGCTCGCGT GAAGGTAATTTTTTTTTATGTCTCCG
Thermal Cycler Bio-Rad 170-9703 My Cycler
Agarose ISC BioExpress E-3120-500
Gel electrophoresis Hoeffer Scientific Instruments Model HE33
1 kb DNA Ladder New England Biolabs N3232S
Bio Rad Power Pack Bio-Rad 164-5050 PowerPac Basic
Gel Doc system Fotodyne Incorporated FOTO/Analyst Investigator FX Workstation

DOWNLOAD MATERIALS LIST

References

  1. Albert, J., Fenyo, E. M. Simple sensitive, and specific detection of human immunodeficiency virus type 1 in clinical specimens by polymerase chain reaction with nested primers. J. Clin. Microbiol. 28, 1560-1564 (1990).
  2. Baskaran, N., et al. Uniform amplification of a mixture of deoxyribonucleic acids with varying GC content. Genome Res. 6, 633-638 (1996).
  3. Blanchard, M. M., Taillon-Miller, P., Nowotny, P., Nowotny, V. PCR buffer optimization with uniform temperature regimen to facilitate automation. PCR Methods Appl. 2, 234-240 (1993).
  4. Borer, P. N., Dengler, B., Tinoco, I. Jr, Uhlenbeck, O. C. Stability of ribonucleic acid double-stranded helices. J. Mol. Biol. 86, 843-853 (1974).
  5. Breslauer, K. J., Frank, R., Blocker, H., Marky, L. A. Predicting DNA duplex stability from the base sequence. Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750 (1986).
  6. Chou, Q., Russell, M., Birch, D. E., Raymond, J., Bloch, W. Prevention of pre-PCR mis-priming and primer dimerization improves low-copy-number amplifications. Nucleic Acids Res. 20, 1717-1723 (1992).
  7. Coleman, W. B., Tsongalis, G. J. Diagnostics for the clinical laboration. Humana Press. (2005).
  8. D'Aquila, R. T., et al. Maximizing sensitivity and specificity of PCR by pre-amplification heating. Nucleic Acids Res. 19, 3749 (1991).
  9. Dieffenbach, C. W., Lowe, T. M., Dveksler, G. S. General concepts for PCR primer design. PCR Methods Appl. 3, S30-S37 (1993).
  10. Don, R. H., Cox, P. T., Wainwright, B. J., Baker, K., Mattick, J. S. 'Touchdown' PCR to circumvent spurious priming during gene amplification. Nucleic Acids Res. 19, 4008 (1991).
  11. Erlich, H. A., Gelfand, D., Sninsky, J. J. Recent advances in the polymerase chain reaction. Science. 252, 1643-1651 (1991).
  12. Frey, U. H., Bachmann, H. S., Peters, J., Siffert, W. PCR-amplification of GC-rich regions: 'slowdown PCR. Nat. Protoc. 3, 1312-1317 (2008).
  13. Haqqi, T. M., Sarkar, G., David, C. S., Sommer, S. S. Specific amplification with PCR of a refractory segment of genomic DNA. Nucleic Acids Res. 16, 11844 (1988).
  14. Henke, W., Herdel, K., Jung, K., Schnorr, D., Loening, S. A. Betaine improves the PCR amplification of GC-rich DNA sequences. Nucleic Acids Res. 25, 3957-3958 (1997).
  15. Innis, M. A., Gelfand, D. H., Sninsky, J. J., White, T. J. PCR Protocols: A guide to methods and applications. Academic Press, Inc. San Diego. (1990).
  16. King, N. Methods in Molecular Biology. 630, Humana Press. (2010).
  17. Kleppe, K., Ohtsuka, E., Kleppe, R., Molineux, I., Khorana, H. G. Studies on polynucleotides. XCVI. Repair replications of short synthetic DNA's as catalyzed by DNA polymerases. J. Mol. Biol. 56, 341-361 (1971).
  18. Korbie, D. J., Mattick, J. S. Touchdown PCR for increased specificity and sensitivity in PCR amplification. Nat. Protoc. 3, 1452-1456 (2008).
  19. Kramer, M. F., Coen, D. M. Enzymatic amplification of DNA by PCR: standard procedures and optimization. Curr. Protoc. Toxicol. Appendix 3, 1-14 (2001).
  20. Kramer, M. F., Coen, D. M. The polymerase chain reaction. Curr. Protoc. Protein Sci. Appendix 4, Appendix 4J (2002).
  21. Kreader, C. A. Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein. Appl. Environ. Microbiol. 62, 1102-1106 (1996).
  22. Kwok, S., et al. Identification of human immunodeficiency virus sequences by using in vitro enzymatic amplification and oligomer cleavage detection. J. Virol. 61, 1690-1694 (1987).
  23. McConlogue, L., Brow, M. A., Innis, M. A. Structure-independent DNA amplification by PCR using 7-deaza-2'-deoxyguanosine. Nucleic Acids Res. 16, 9869 (1988).
  24. Mullis, K. B. The unusual origin of the polymerase chain reaction. Sci. Am. 262, 56-65 (1990).
  25. Mullis, K. B. Target amplification for DNA analysis by the polymerase chain reaction. Ann. Biol. Clin. (Paris). 48, 579-582 (1990).
  26. Mullis, K. B. The polymerase chain reaction in an anemic mode: how to avoid cold oligodeoxyribonuclear fusion). PCR Methods Appl. 1, 1-4 (1991).
  27. Mullis, K. B., Faloona, F. A. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol. 155, 335-350 (1987).
  28. Paabo, S., Gifford, J. A., Wilson, A. C. Mitochondrial DNA sequences from a 7000-year old brain. Nucleic Acids Res. 16, 9775-9787 (1988).
  29. Rees, W. A., Yager, T. D., Korte, J., von Hippel, P. H. Betaine can eliminate the base pair composition dependence of DNA melting. Biochemistry. 32, 137-144 (1993).
  30. Roux, K. H., Hecker, K. H. One-step optimization using touchdown and stepdown PCR. Methods Mol. Biol. 67, 39-45 (1997).
  31. Rychlik, W., Spencer, W. J., Rhoads, R. E. Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res. 18, 6409-6412 (1990).
  32. Saiki, R. K., et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 239, 487-491 (1988).
  33. Saiki, R. K., et al. Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science. 230, 1350-1354 (1985).
  34. Sambrook, J. A. R., David, W. Molecular Cloning A Laboratory Manual. 2, 3, Cold Spring Harbor Laboratory Press. (2001).
  35. Sarkar, G., Kapelner, S., Sommer, S. S. Formamide can dramatically improve the specificity of PCR. Nucleic Acids Res. 18, 7465 (1990).
  36. Smit, V. T., et al. KRAS codon 12 mutations occur very frequently in pancreatic adenocarcinomas. Nucleic Acids Res. 16, 7773-7782 (1988).
  37. Wilson, I. G. Inhibition and facilitation of nucleic acid amplification. Appl. Environ. Microbiol. 63, 3741-3751 (1997).
  38. Wu, R. Methods in Enzymology. 218, Academic Press, Inc. San Diego. (1993).

Comments

1 Comment

  1. Thanks for the great overview of the all-important PCR procedure. I will no doubt reference it often in the future.

    I have a PCR troubleshooting question...what do to about streaking on the gel after a successful amplification? My bands are nice and bright and where they are supposed to be, but there is a heavily-streaked "path" starting at the wells and following until the end where my bands are. Is there something I can do about my PCR conditions, or the thermocycler settings? Any comments would be appreciated.

    Reply
    Posted by: Doug E.
    September 8, 2013 - 1:23 PM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics