Polymerase Chain Reaction: protocollo Basic Plus Strategies Risoluzione dei problemi e ottimizzazione

Biology
 

Summary

PCR è emerso come una tecnica comune in molti laboratori di biologia molecolare. A condizione: ecco un breve resoconto di diversi protocolli convenzionali di PCR. Poiché ogni reazione è un esperimento unico, condizioni ottimali richiesti per generare un prodotto variare. Comprendere le variabili in una reazione permetterà di migliorare notevolmente l'efficienza di risoluzione dei problemi, aumentando così la possibilità di ottenere il risultato desiderato.

Cite this Article

Copy Citation | Download Citations

Lorenz, T. C. Polymerase Chain Reaction: Basic Protocol Plus Troubleshooting and Optimization Strategies. J. Vis. Exp. (63), e3998, doi:10.3791/3998 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Nelle scienze biologiche ci sono stati progressi tecnologici che catapulteranno la disciplina in età d'oro della scoperta. Ad esempio, il campo della microbiologia è stato trasformato con l'avvento di microscopio Anton van Leeuwenhoek, che ha permesso agli scienziati di visualizzare procarioti per la prima volta. Lo sviluppo della reazione a catena della polimerasi (PCR) è una di quelle innovazioni che hanno cambiato il corso della scienza molecolare con il suo impatto si estende innumerevoli sottodiscipline in biologia. Il processo teorico è stato delineato dal Keppe e collaboratori nel 1971, tuttavia, è stato altri 14 anni fino a quando la procedura completa PCR è stata descritta e sperimentale applicata da Kary Mullis mentre al Cetus Corporation nel 1985. Automazione e perfezionamento di questa tecnica progredito con l'introduzione di un DNA polimerasi termica stabile dal Thermus aquaticus batterio, di conseguenza il nome DNA polimerasi Taq.

PCR è un powetecnica di amplificazione rful che può generare un ampio rifornimento di uno specifico segmento di DNA (cioè, un amplicone) da solo una piccola quantità di materiale di partenza (cioè, DNA templato o sequenza bersaglio). Anche se semplice e generalmente senza problemi, ci sono delle trappole che complicano la reazione di produzione di falsi risultati. Quando PCR non si può portare a molti prodotti non specifici di DNA di varie dimensioni che appaiono come una scala o di striscio di bande su gel di agarosio. Talvolta sono prodotti formare affatto. Un altro potenziale problema si verifica quando le mutazioni vengono involontariamente introdotti negli ampliconi, risultante in una popolazione eterogenea di prodotti di PCR. Guasti di PCR può diventare frustrante se non la pazienza e la risoluzione dei problemi attenta sono impiegati per risolvere e risolvere il problema (s). Questo protocollo illustra i principi fondamentali della PCR, fornisce una metodologia che comporta l'amplificazione di sequenze bersaglio maggior parte, e presenta le strategie per ottimizzare una reazione. Seguendo questa guida PCR, students dovrebbe essere in grado di:

  • Impostare le reazioni e le condizioni termiche in bicicletta per un esperimento di PCR convenzionale
  • Comprendere la funzione dei vari componenti della reazione e il loro effetto complessivo su un esperimento di PCR
  • Progettare e ottimizzare un esperimento di PCR per qualsiasi modello di DNA
  • Risoluzione dei problemi falliti esperimenti di PCR

Protocol

1. Progettazione Primers

Progettare primer appropriati è essenziale per il buon esito di un esperimento di PCR. Nella progettazione di un set di primer a una regione specifica di DNA desiderato per l'amplificazione, un innesco deve ricombinarsi al filamento più, che per convenzione è orientato nella direzione 5 '→ 3' (anche noto come il filamento senso o nontemplate) e la altro primer dovrebbe integrare il filamento negativo, che è orientato in 3 '→ direzione 5' (antisenso o filamento stampo). Ci sono alcuni problemi comuni che si verificano durante la progettazione di inneschi: 1) auto-appaiamento dei primer causando formazione di strutture secondarie quali anse a forcina (Figura 1a); 2) primer ricottura tra loro, piuttosto che il modello di DNA, creando innesco dimeri (Figura 1b), 3) drasticamente diverse temperature di fusione (T m) per ogni primer, il che rende difficile selezionare una temperatura di ricottura, che saranno tuttiow entrambi i primer di legarsi in modo efficiente per la loro sequenza bersaglio durante Termale ciclismo (Figura 1c) (Si vedano le sezioni CALCOLO temperatura di fusione (T m) e MODIFICHE ALLE CONDIZIONI DI CICLISMO per ulteriori informazioni su T m s).

  1. Di seguito è riportato un elenco di caratteristiche che dovrebbero essere considerati quando si progetta primer.
    1. Primer lunghezza dovrebbe essere 15-30 residui nucleotidici (basi).
    2. Optimal contenuto GC deve essere compresa tra 40-60%.
    3. L'estremità 3 'del primer dovrebbe contenere un G oppure C al fine di bloccare il primer e prevenire "respiro" dei fini, aumentando l'efficienza priming. DNA "respirare" si verifica quando finisce non rimanere ricotto, ma mischia o dividersi. I tre legami idrogeno a coppie CG impedire la respirazione, ma anche aumentare la temperatura di fusione dei primers.
    4. L'estremità 3 'di una serie di primer, che include un primer più filamento e un primer filamento negativo, non dovrebbe essere c omplementary tra loro, né l'estremità 3 'di un singolo primer complementare alle altre sequenze del primer. Questi due scenari provocare la formazione di dimeri di primer e delle strutture ad anello tornanti, rispettivamente.
    5. Temperature di fusione ottimali (T m) per la gamma di primer tra i 52-58 ° C, anche se il campo può essere ampliata a 45-65 ° C. La m finale T per entrambi i primers dovrebbero differire di non più di 5 ° C.
    6. Di-nucleotide ripetizioni (per esempio, o GCGCGCGCGC ATATATATAT) o piste di singole basi (per esempio, o AAAAA CCCCC) deve essere evitata in quanto possono causare lo scivolamento lungo il segmento mano di fondo di strutture di DNA e per formare o tornante. Se inevitabile a causa della natura dello stampo di DNA, poi solo comprendono ripete o base singola eseguito con un massimo di 4 basi.

Note:

  1. Ci sono molti programmi progettati per aiutare nella progettazione di coppie di primer. NCBI Primer strumento di progettazionew.ncbi.nlm.nih.gov / tools / primer-blast / "target =" _blank "> http://www.ncbi.nlm.nih.gov/tools/primer-blast/ e Primer3 http://frodo .wi.mit.edu/primer3 / sono siti web consigliati per questo scopo.
  2. Per evitare l'amplificazione di pseudogeni omologhi correlati o potrebbe essere utile eseguire un colpo sulla NCBI per verificare la specificità per il bersaglio dei primer.

2. Materiali e reagenti

  1. Quando si imposta un esperimento di PCR, è importante essere preparati. Indossare guanti per evitare di contaminare la miscela di reazione o reagenti. Includere un controllo negativo, e se possibile un controllo positivo.
  2. Disporre tutti i reagenti necessari per l'esperimento PCR in un secchio di ghiaccio appena riempito, e lasciarli scongelare completamente prima di impostare una reazione (Figura 2). Mantenere i reagenti in ghiaccio durante l'esperimento.
    • Reagenti PCR standard includonoset di inneschi appropriati per il gene target desiderato o segmento di DNA da amplificare, DNA polimerasi, un buffer per la DNA polimerasi specifica, deossinucleotidi (dNTP), DNA stampo, e acqua sterile.
    • Altri reagenti possono includere sali di magnesio Mg 2 + (ad una concentrazione finale di 0,5 a 5,0 mm), sale di potassio K + (ad una concentrazione finale di 35 a 100 mm), dimetilsolfossido (DMSO, ad una concentrazione finale del 1-10% ), formammide (ad una concentrazione finale di 1,25-10%), sieroalbumina bovina (ad una concentrazione finale di 10-100 pg / ml), e betaina (ad una concentrazione finale di 0,5 M a 2,5 M). Gli additivi sono discussi ulteriormente nella sezione risoluzione dei problemi.
  3. Organizzare attrezzature di laboratorio sul banco di lavoro.
    • I materiali includono provette PCR e berretti, un portaprovette PCR, un etanolo resistente ingombro, e una serie di Micropipettatrici che distribuiscono tra 1 - 10 pl (P10), 2 - 20 pl (P20), 20 - 200 pl (P200)e 200 - 1000 pl (P1000), nonché un termociclatore.
    • Quando si imposta diversi esperimenti PCR che utilizzano tutti gli stessi reagenti, possono essere opportunamente scalati e combinate insieme in una miscela master (Master Mix). Questo passaggio può essere fatto in una provetta sterile 1,8 ml (vedi Note).
    • Per analizzare gli ampliconi derivanti da un esperimento PCR, reagenti e attrezzature per elettroforesi su gel di agarosio è richiesto. Per approssimare le dimensioni di un prodotto di PCR, un appropriato, disponibile in commercio dimensioni standard di peso molecolare è necessaria.

3. Impostazione di una miscela di reazione

  1. Inizia facendo una tabella di reagenti che verranno aggiunti alla miscela di reazione (vedi Tabella 1).
  2. Successivamente, etichetta PCR tubo (s) con l'etanolo resistente marcatore.
  3. Volumi di reazione variano a seconda delle concentrazioni dei reagenti fotografici. Le concentrazioni finali(CF) per una tipica reazione di 50 microlitri sono i seguenti.
    • X tampone (solitamente fornita dal costruttore del DNA polimerasi; può contenere 15 mM MgCl 2). Aggiungere 5 microlitri di tampone 10X per reazione.
    • 200 pM dNTP (50 mM di ciascuno dei quattro nucleotidi). Aggiungere 1 ml di 10 mM dNTP per reazione (dATP, dCTP, dGTP e dTTP sono a 2,5 mM ciascuno).
    • 1,5 mM Mg 2 +. Aggiungere solo se non è presente nel buffer 10X o come necessario per l'ottimizzazione PCR. Ad esempio, per ottenere il 4,0 mM Mg 2 + necessaria per la produzione ampliconi ottimale di un segmento di DNA conservato 566 bp trovato in uno Mycobacteriophage non caratterizzato aggiungere 8 pl di 25 mM MgCl 2 alla reazione (Figura 3).
    • 20-50 pmol di ciascun primer. Aggiungere 1 ml di ogni primer 20 pM.
    • Aggiungi 10 da 4 a 10 7 molecole (o circa 1 a 1000 ng) modello di DNA. Aggiungere 0,5 microlitri di 2NG / & mu; L DNA genomico Mycobacteriophage.
    • Aggiungi 0,5 a 2,5 unità di DNA polimerasi per reazione di 50 microlitri (vedere le raccomandazioni del costruttore) Ad esempio, aggiungere 0,5 microlitri di Sigma 0,5 Unità / ul DNA polimerasi Taq.
    • Aggiungi QS acqua sterile distillata per ottenere un volume di 50 microlitri per reazione finale di pre-determinata nella tabella dei reagenti (QS è la sigla in latino quanto basta cioè l'importo che è necessario). Così, il 33 microlitri per reazione è necessaria per portare il volume fino a 50 pl. Tuttavia, va rilevato che l'acqua viene aggiunto per primo, ma richiede inizialmente facendo una tabella di reagenti e la determinazione dei volumi di tutti gli altri reagenti aggiunti alla reazione.

4. Base PCR protocollo

  1. Inserire una piastra a 96 pozzetti nel secchiello del ghiaccio, come un supporto per i 0,2 ml pareti sottili tubi di PCR. Permettere reagenti PCR da aggiungere a freddo da 0,2 ml in tubi a parete sottile per PCR aiuterà a prevenire nuclease l'attività e priming non specifico.
  2. Pipettare i seguenti reagenti PCR nel seguente ordine: 0,2 ml in un tubo sottile parete PCR (Figura 4): acqua sterile, 10X tampone PCR, dNTPs, MgCl 2, primer e DNA stampo (vedi Tabella 1). Dal momento che gli esperimenti devono avere almeno un controllo negativo, ed eventualmente un controllo positivo, è opportuno istituire un Master Mix in una provetta da microcentrifuga 1,8 ml (vedi spiegazione in Notes).
  3. In una separata da 0,2 ml a parete sottile provette per PCR (Figura 4) aggiungere tutti i reagenti, ad eccezione del DNA modello per un controllo negativo (aumentare l'acqua per compensare il volume mancante). Inoltre, un'altra reazione (se i reagenti sono disponibili) dovrebbe contenere un controllo positivo usando il DNA stampo e primer o precedentemente noti per amplificare nelle stesse condizioni sperimentali i tubi PCR.
  4. Taq DNA polimerasi è tipicamente memorizzato in una glicerolo 50%soluzione e per dispersione totale nella miscela di reazione richiede dolce miscelazione dei reagenti PCR pipettando su e giù almeno 20 volte. La micropipetta deve essere impostata su circa la metà del volume di reazione del master mix durante la miscelazione e la cura dovrebbe essere presa per evitare l'introduzione di bolle.
  5. Mettere protezioni alle 0,2 ml pareti sottili tubi di PCR e metterli nel termociclatore (Figura 5). Una volta che il coperchio del termociclatore sia chiuso saldamente avviare il programma (vedi tabella 2).
  6. Quando il programma ha finito, i 0,2 ml pareti sottili tubi di PCR può essere rimosso e conservato a 4 ° C. I prodotti della PCR può essere rilevato caricando aliquote di ciascuna reazione in pozzetti di un gel di agarosio poi colorazione DNA che è migrato nel gel elettroforesi seguente con bromuro di etidio. Se un prodotto PCR è presente, il bromuro di etidio si intercalarsi tra le basi dei filamenti di DNA, consentendo bande di essere visualizzati con un illuminatore UV. </ Li>

Note:

  1. Durante l'impostazione più esperimenti di PCR, è vantaggioso per assemblare una miscela di reagenti comuni a tutte le reazioni (cioè, Master Mix). Solitamente il cocktail contiene una soluzione di DNA polimerasi, dNTPs, tampone di reazione, e acqua montato in una provetta 1,8 ml. La quantità di ciascun reagente aggiunto al Master Mix è equivalente al numero totale di reazioni più 10% arrotondato all'intero più vicino reazione. Per esempio, se ci sono 10 x 0,1 = 1 reazione, poi (10 + 1) x 5 microlitri tampone 10X uguale 55 microlitri di tampone 10X per Master Mix. I reagenti nel Master Mix vengono miscelati accuratamente delicatamente lo stantuffo di pompaggio un micropipettatore su e giù per circa 20 volte come descritto sopra. Ogni tubo PCR riceve una aliquota della Master Mix per cui il modello di DNA, i primer necessari, e sperimentare specifici reagenti vengono quindi aggiunti (vedi tabelle 1 e 7).
  2. Il followisito ng offre un calcolatore per determinare il numero di copie di DNA di stampo ( http://www.uri.edu/research/gsc/resources/cndna.html ). Il numero totale di copie di DNA a doppio filamento può essere calcolata utilizzando la seguente equazione:
    Numero di copie di DNA = (quantità di DNA (ng) x 6.022x10 23) / (lunghezza x del DNA 1x10 9 ng / ml x 650 Dalton)
    Calcolo del numero di copie di DNA viene utilizzato per determinare la quantità di template necessari per la reazione.
  3. I falsi positivi possono verificarsi come conseguenza di riporto da un'altra reazione PCR che sarebbe visualizzate come più prodotti indesiderati su un gel di agarosio dopo elettroforesi. Pertanto, è prudente usare la tecnica corretta, includere un controllo negativo (e il controllo positivo quando possibile).
  4. Mentre bromuro di etidio è la più comune f macchiao acidi nucleici ci sono molte alternative più sicure e meno tossici. Il seguente sito web descrive alcune delle alternative tra cui blu di metilene, Crystal Violet, SYBR provvisoria e Gel Red con le descrizioni di come utilizzare e rilevare il prodotto finale ( http://bitesizebio.com/articles/ethidium-bromide-the- alternatives ).
  5. Mentre la maggior parte delle moderne macchine per PCR utilizzare provette da 0,2 ml, alcuni modelli possono richiedere una risposta in provette da 0,5 ml. Consultare il manuale termica ciclisti per determinare il tubo di dimensioni appropriate.

5. Temperatura di fusione Calcolo (T m)

  1. Conoscere la temperatura di fusione (T m) dei primer è indispensabile per un esperimento riuscito PCR. Sebbene vi siano molti calcolatori T m disponibile, è importante notare che questi calcoli sono una stima del reale T m dovuta alla mancanza di informazioni specifiche su una particolare reazione e ipotesi formulate negli algoritmi per le calcolatrici m T stessi. Tuttavia, primi vicini modelli termodinamici sono da preferire il calcolo più convenzionale: T m ≈ 4 (GC) + 2 (AT). Il primo darà più accurata stima T m perché prende in considerazione l'energia sovrapposizione di coppie di basi vicine. Quest'ultimo viene utilizzato più spesso, perché i calcoli sono semplici e possono essere fatto in fretta a mano. Vedere la sezione Risoluzione dei problemi per informazioni su come le varie condizioni di PCR e additivi influenzano temperatura di fusione.
    Per il calcolo dei valori m dalla più vicina T-neighbor modelli termodinamici, uno dei calcolatori si raccomandano i seguenti:
    http://www6.appliedbiosystems.com/support/techtools/calc/
    edu / ~ "target =" zimmer / oligoTMcalc.html _blank "> ~ http://www.cnr.berkeley.edu/ zimmer / oligoTMcalc.html
    http://www.idtdna.com/analyzer/Applications/OligoAnalyzer/
    http://www.finnzymes.com/tm_determination.html~~V
    http://mobyle.pasteur.fr/cgi-bin/portal.py? N. Titolo: forme di fusione

6. Creazione di condizioni termiche in bicicletta

  1. Termociclatori PCR termici rapidamente calore e raffreddare la miscela di reazione, consentendo indotta dal calore denaturazione del DNA duplex (separazione filamento), appaiamento dei primer ai fili più e meno dello stampo di DNA, e allungamento del prodotto della PCR. Tempi di ciclo sono calcolati in base alla dimensione del modello e il contenuto di GC del DNA. Il generale formula inizia con una fase di denaturazione iniziale a 94 ° C a 98 ° C a seconda della temperatura ottimale per l'attività di DNA polimerasi e contenuto di GC del DNA stampo. Una tipica reazione inizia con una denaturazione uno minuti a 94 ° C. Le più di 3 minuti può inattivare la DNA polimerasi, distruggendo la sua attività enzimatica. Un metodo, noto come PCR hot-start, si estende drasticamente il tempo iniziale di denaturazione da 3 minuti fino a 9 minuti. Con PCR hot-start, la DNA polimerasi è aggiunto dopo la fase iniziale di denaturazione esagerata è finito. Questa modifica protocollo evita probabile inattivazione dell'enzima DNA polimerasi. Consultare la sezione Risoluzione dei problemi di questo protocollo per ulteriori informazioni su Hot Start PCR e altri metodi alternativi.
  2. Il passo successivo è impostare il termociclatore di avviare il primo 25 a 35 cicli di tre fasi ciclo di temperatura (Tabella 2). Aumentando il numero di cicli di sopra dei 35 determinerà unamaggiore quantità di prodotti di PCR, troppi giri si traduce spesso in l'arricchimento di prodotti secondari indesiderati. Le tre fasi di temperatura in un singolo ciclo eseguire tre compiti: il primo passo denatura il modello (e in cicli successivi, gli ampliconi oltre), il secondo passo permette ricottura ottimale dei primer, e il terzo passo permette la DNA polimerasi a legarsi stampo di DNA e sintetizzare il prodotto di PCR. La durata e la temperatura di ogni fase di un ciclo può essere modificato per ottimizzare la produzione dell'amplicone desiderato.
    Il tempo per l'operazione di denaturazione viene mantenuto il più breve possibile. Genere da 10 a 60 secondi è sufficiente per la maggior parte dei modelli di DNA. Il tempo di denaturazione e la temperatura può variare a seconda del contenuto di GC del DNA stampo, così come la pendenza della rampa, che è il tempo che impiega il termociclatore di cambiare da una temperatura al successivo. La temperatura di questo passo è in genere uguale a quello utilizzato per la fase iniziale di denaturazione(Passo # 1; esempio, 94 ° C).
    Un secondo passo 30 ricottura segue all'interno del ciclo ad una temperatura impostata circa 5 ° C sotto la m apparente T dei primer (preferibilmente tra 52 ° C a 58 ° C).
    Il ciclo si conclude con una fase di allungamento. La temperatura dipende dalla DNA polimerasi scelto per l'esperimento. Ad esempio, la Taq DNA polimerasi ha una temperatura ottimale allungamento di 70 ° C a 80 ° C e richiede 1 minuto per allungare i primi 2 kb, richiede quindi un minuto in più per ogni 1 kb amplificati. Pfu DNA polimerasi è un enzima termostabile che ha una temperatura ottimale allungamento di 75 ° C. Pfu DNA polimerasi è raccomandato per l'uso in reazioni di PCR e di estensione di primer che richiedono alta fedeltà e richiede 2 minuti per ogni 1 kb da amplificare. Vedere indicazioni del produttore per le temperature di allungamento e l'ora esatta allungamento indicati per ogni specifico DNA polimerasi.
  3. Taq DNA polimerasi, permette l'aggiunta di un residuo di adenina alla 3 'estremità di tutti i prodotti di PCR. Questa modifica è mediata dall'attività transferasi terminale della polimerasi Taq DNA ed è utile per le successive procedure di clonazione molecolare che richiedono un 3'-sbalzo.
  4. Terminazione della reazione si ottiene il raffreddamento della miscela a 4 ° C e / o con l'aggiunta di EDTA ad una concentrazione finale di 10 mM.

7. Considerazioni importanti per la risoluzione di PCR

Se normali condizioni di PCR non danno l'amplicone desiderato, PCR ottimizzazione è necessario per conseguire risultati migliori. La stringenza di una reazione può essere modulata in modo tale che la specificità viene regolato alterando variabili (ad esempio, reagenteconcentrazioni, condizioni ciclismo) che influenzano il risultato del profilo amplicone. Ad esempio, se la reazione non è sufficientemente rigorosi, molti ampliconi spuri verrà generato con lunghezze variabili. Se la reazione è troppo rigida, nessun prodotto sarà prodotto. Risoluzione dei problemi reazioni di PCR può essere uno sforzo, a volte frustrante. Tuttavia, un'attenta analisi e una buona comprensione dei reagenti usati in un esperimento di PCR può ridurre la quantità di tempo e prove necessarie per ottenere i risultati desiderati. Di tutte le considerazioni che rigore l'impatto PCR, la titolazione del Mg 2 + e / o manipolare temperature di ricottura probabilmente verranno risolti molti problemi. Tuttavia, prima di cambiare qualsiasi cosa, essere sicuri che un risultato sbagliato non era dovuto a errore umano. Inizia confermando tutti i reagenti sono stati aggiunti a una data reazione e che i reagenti non sono stati contaminati. Anche prendere atto del risultato errato, e porsi le seguenti domande: sono dimeri di primer visibili sul gel elettroforetico doporesistenza (si tratta di esecuzione come piccole bande <100 b vicino al fondo della corsia)? Ci sono prodotti non specifici (bande che migrano in una dimensione diversa rispetto al prodotto desiderato)? C'è stata una mancanza di qualsiasi prodotto? Il DNA bersaglio su un plasmide o in un DNA genomico? Inoltre, è opportuno analizzare il contenuto GC dell'amplicone desiderato.

  1. In primo luogo determinare se uno qualsiasi dei reagenti PCR sono catastrofiche per la tua reazione. Ciò può essere ottenuto preparando nuovi reagenti (ad esempio, freschi di scorte, diluizioni nuovi), e poi aggiungendo sistematicamente un reagente nuovo alla volta di miscele di reazione. Questo processo determinerà quale reagente è stato il colpevole per l'esperimento fallito PCR. Nel caso di DNA molto antica, che si accumula spesso inibitori, è stato dimostrato che l'aggiunta di siero albumina bovina può contribuire ad alleviare il problema.
  2. Dimeri di primer possono formare quando primer preferenzialmente sé annealing o ricombinarsi l'altro primer nella reazione. In questo caso, una piccolaprodotto di meno di 100 bp apparirà sul gel di agarosio. Avviare alterando il rapporto di template di primer; se la concentrazione dei primer in eccesso è estremo sul modello di concentrazione, allora gli inneschi sarà più probabile di ricottura a se stessi o l'altro su DNA stampo. L'aggiunta di DMSO e o utilizzando un caldo metodo ciclo termico inizio può risolvere il problema. Alla fine può essere necessario progettare nuovi primer.
  3. Prodotti non specifici sono prodotte quando stringenza PCR è eccessivamente basso con conseguente non-specifiche bande PCR con lunghezze variabili. Ciò produce un effetto scala su un gel di agarosio. È quindi opportuno scegliere le condizioni di PCR che aumentano stringenza. Uno striscio di varie dimensioni possono anche derivare da primer disegnati per sequenze altamente ripetitive quando amplificare DNA genomico. Tuttavia, gli stessi primer può amplificare una sequenza bersaglio su un plasmide senza incontrare lo stesso problema.
  4. La mancanza di prodotti di PCR è probabilmente dovuto alle condizioni di reazioneche sono troppo rigide. Dimeri di primer e le strutture ad anello a gomito che formano con i primer o nel DNA denaturato modello può anche impedire l'amplificazione di prodotti di PCR perché queste molecole non possono più coppie di basi con la controparte DNA desiderato.
  5. Se il contenuto GC non è stato analizzato, è ora di farlo. PCR di regioni ricche di GC (contenuto di GC> 60%) rappresentano alcune delle più grandi sfide per PCR. Tuttavia, ci sono molti additivi che sono stati utilizzati per contribuire ad alleviare le sfide.

8. Manipolazione di reagenti PCR

Comprendere la funzione dei reagenti usati in convenzionali PCR è critico quando prima decidere come meglio alterare condizioni di reazione per ottenere il prodotto desiderato. Successo semplicemente può invocare cambiando la concentrazione di MgCl 2, KCl, dNTPs, primer, DNA stampo, o DNA polimerasi. Tuttavia, la concentrazione di tali reagenti errato può portare a risultati spuri, diminuendo il stringency della reazione. Quando risoluzione di PCR, un solo reagente deve essere manipolato per volta. Tuttavia, può essere prudente per titolare il reagente manipolato.

  1. Magnesio sale di Mg 2 + (concentrazione di reazione finale di 0,5 a 5,0 mm)
    DNA polimerasi termostabili richiedono la presenza di magnesio ad agire come cofattore durante il processo di reazione. Cambiare la concentrazione di magnesio è uno dei più facili da manipolare con reagenti forse il più grande impatto sul rigore della PCR. In generale, la resa del prodotto PCR aumenta con l'aggiunta di una maggiore concentrazione di Mg 2 +. Tuttavia, un aumento delle concentrazioni di Mg 2 + anche diminuire la specificità e la fedeltà della DNA polimerasi. La maggior parte dei produttori includono una soluzione di cloruro di magnesio (MgCl 2) con la DNA polimerasi e una soluzione tampone PCR 10X. Le X 10 PCR soluzioni tampone può contenere 15 mM MgCl 2, che è sufficiente per un tipico PCRreazione, o può essere aggiunto separatamente ad una concentrazione ottimizzato per una particolare reazione. Mg 2 + non si consuma nella reazione, ma la reazione non può procedere senza che sia presente. Quando vi è troppo Mg 2 +, si può impedire la denaturazione completa dello stampo di DNA mediante la stabilizzazione del duplex filamento. Troppo Mg 2 + anche in grado di stabilizzare spuria appaiamento dei primer a siti modelli errati e specificità conseguente diminuzione indesiderati prodotti di PCR. Quando non c'è abbastanza Mg 2 +, la reazione non procede, con conseguente nessun prodotto di PCR.
  2. Sale di potassio K + (concentrazione di reazione finale di 35 a 100 mm)
    Longer prodotti PCR (10 a 40 kb) beneficiano riduzione del sale di potassio (KCl) dalla sua concentrazione normale reazione 50 mM, spesso in combinazione con l'aggiunta di DMSO e / o glicerolo. Se l'amplicone desiderato è inferiore a 1000 bp e lunghe prodotti non specifici stanno formando, Specificity può essere migliorata per titolazione KCl, aumentando la concentrazione in incrementi di 10 mm fino a 100 mM. Aumentando la concentrazione di sale permette di molecole di DNA più brevi per denaturare preferenzialmente molecole di DNA più lunghi.
  3. Deossinucleotide 5'-trifosfati (concentrazione di reazione finale di 20 e 200 pM ciascuno)
    Deossinucleotide 5'-trifosfati (dNTP) può causare problemi per PCR se non sono le concentrazioni appropriate equivalenti (cioè, [A] = [T] = [C] = [G]) e / o causa della loro instabilità da ripetuti congelamento e scongelamento. La concentrazione di dNTP usuale è di 50 micron di ciascuno dei quattro dNTP. Tuttavia, PCR può tollerare concentrazioni tra 20 e 200 pM ciascuno. Basse concentrazioni di dNTP può aumentare la specificità e la fedeltà della reazione, mentre le concentrazioni dNTP eccessive può effettivamente inibire PCR. Tuttavia, per lunghi PCR-frammenti, una maggiore concentrazione dNTP può essere richiesto. Un grande cambiamento nella concentrazione di dNTP, può richiedere una corrisponristagni variazione della concentrazione di Mg 2 +.
  4. Termici DNA polimerasi stabili
    Enzimi PCR e tamponi associati a tali enzimi hanno percorso una lunga strada da quando l'iniziale DNA polimerasi Taq prima assunzione. Così, la scelta di un enzima appropriato può essere utile per l'ottenimento di prodotti ampliconi desiderati. Ad esempio l'uso di Taq DNA polimerasi può essere preferito Pfu DNA polimerasi se processività e / o l'aggiunta di un residuo di adenina estremità 3 'del prodotto di PCR è desiderato. L'aggiunta di un 3 'adenina è diventata una strategia di clonazione utile prodotti PCR in vettori TA millesimo 3' sporgenze timina. Tuttavia, se la fedeltà è più importante un enzima come Pfu può essere una scelta migliore. Diversi produttori hanno una vasta gamma di DNA polimerasi specifici studiati per esigenze specifiche. Date un'occhiata alle condizioni di reazione e le caratteristiche del amplicone desiderato, quindi abbinare l'esperimento PCR con il DNA appropriate polymerase. La maggior parte produce hanno tabelle che gli aiuti di DNA polimerasi selezione in base alle caratteristiche annunci come la fedeltà, la resa, velocità, lunghezza target ottimale, e se è utile per l'amplificazione GC ricchi o hot start PCR.
  5. Modello di DNA
    Qualità del DNA e la purezza avrà un effetto rilevante sulla probabilità di un esperimento riuscito PCR. DNA e RNA concentrazione può essere determinata utilizzando le misurazioni della densità ottica a 260 nm (OD 260). La massa di acidi nucleici purificati in soluzione viene calcolata a 50 ug / ml di DNA a doppio filamento o 40 pg / ml di RNA o DNA a singolo filamento in una OD 260 = 1,0. Contaminanti di estrazione del DNA sono inibitori comuni in PCR e dovrebbero essere accuratamente evitati. Comuni inibitori di estrazione di DNA PCR includono proteine, RNA, solventi organici, e detergenti. Usando il massimo assorbimento di acidi nucleici OD 260 rispetto a quella delle proteine ​​OD280 (OD 260/280), è possibile determine una stima della purezza di DNA estratto. Idealmente, il rapporto di OD 260/280 è compreso tra 1,8 e 2,0. Lower OD 260/280 è indicativa di proteine ​​e / o contaminazione solvente che, con ogni probabilità, sarà problematico per PCR.
    Oltre alla qualità del DNA stampo, l'ottimizzazione della quantità di DNA può grande beneficio il risultato di un esperimento PCR. Sebbene sia conveniente per determinare la quantità in microlitri ng /, che è spesso l'uscita per nanospectrophotometers moderni, l'unità rilevante per un esperimento di successo PCR è il numero di molecole. Cioè, il numero di copie di DNA templato contiene una sequenza complementare al primer PCR? Molecole bersaglio sono ottimali tra 10 aprile-10 Luglio molecole e può essere calcolata come è stato descritto nelle note sopra.

9. Additivi Reagenti

Reagenti additivo può dare risultati quando tutto il resto fallisce. Comprendere i reagentie che sono utilizzati per è critico nel determinare quali reagenti possono essere più efficaci nella acquisizione del prodotto desiderato PCR. Aggiunta di reagenti per la reazione è complicata dal fatto che la manipolazione di un reagente può influenzare la concentrazione utile di un altro reagente. In aggiunta ai reagenti di seguito elencati, proprietari additivi disponibili in commercio sono disponibili molte aziende biotecnologiche.

10. Gli additivi che favoriscono modelli GC Rich

  1. Dimetilsolfossido (concentrazione di reazione finale di DMSO% 1-10)
    In esperimenti di PCR in cui il DNA stampo è particolarmente ricco GC (contenuto di GC> 60%), l'aggiunta di DMSO può migliorare la reazione interrompendo l'appaiamento delle basi e di ridurre sensibilmente il T m. Alcuni calcolatori m T include un ingresso variabile per aggiungere la concentrazione di DMSO desiderata nell'esperimento PCR. Tuttavia, l'aggiunta di più del 2% DMSO può richiedere l'aggiunta di più di DNA polimerasi come è stato dimostratodimostrato di inibire la DNA polimerasi Taq.
  2. Formammide (concentrazione di reazione finale di 1,25-10%)
    Come DMSO, formammide inoltre interrompe l'appaiamento delle basi, mentre aumentando la severità di primer ricottura, che si traduce in meno aspecifica priming e maggiore efficienza di amplificazione. Formammide ha anche dimostrato di essere un potenziatore di modelli GC ricche.
  3. 7-deaza-2'-desossiguanosina 5'-trifosfato (concentrazione di reazione finale di dc 7 GTP, GTP 3 dc 7: 1 pM dGTP 50)
    Uso 3 parti, o 37,5 pM, della base di guanosina analogico dc 7 GTP in combinazione con 1 parte, o 12,5 pM, dGTP destabilizzerà formazione di strutture secondarie nel prodotto. Come il DNA amplificato o modello è denaturato, si formano spesso strutture secondarie come i cicli tornanti. Incorporazione di DC 7 GTP nel DNA amplicone impedirà la formazione di queste strutture aberranti.

Note:

7 GTP attenua il segnale di colorazione con etidio bromuro è per questo che viene utilizzato in un rapporto 3:1 con dGTP.

  1. Betaine (concentrazione di reazione finale di 0.5M a 2.5M)
    Betaina (N, N, N-trimetilglicina) è un analogo zwitterionici amminoacido che riduce e può anche eliminare la dipendenza di fusione DNA temperatura composizione nucleotidica. Viene utilizzato come additivo per aiutare l'amplificazione PCR dei ricchi GC bersagli. Betaine è spesso utilizzato in combinazione con DMSO e può migliorare notevolmente le possibilità di DNA bersaglio di amplificazione ad alto contenuto di GC.

11. Additivi che aiutano PCR in presenza di inibitori

  1. Detergenti non ionici operato per sopprimere la formazione della struttura secondaria e aiutare a stabilizzare la DNA polimerasi. Detergenti non ionici come Triton X-100, Tween 20, o NP-40 può essere utilizzata a concentrazioni di reazione di 0,1 a 1%, al fine di aumentare la produzione amplicone. Tuttavia, Conc.ni superiori all'1% possono essere inibire PCR. La presenza di detergenti non ionici diminuisce rigore PCR, che potrebbe condurre alla formazione del prodotto spurio. Tuttavia, il loro uso anche neutralizzare l'effetto inibitorio della SDS, un contaminante occasionale di protocolli di estrazione del DNA.
  2. L'aggiunta di proteine ​​specifiche, quali albumina sierica bovina (BSA) usato a 400 ng / pl e / o T4 gene proteina 32 a 150 aiuto PCR ng / pl in presenza di inibitori come FeCl 3, emina, acido fulvico, acido umico, acidi tannici, o estratti di feci, acqua fresca e acqua marina. Tuttavia, alcuni inibitori della PCR, compresi sali biliari, bilirubina, EDTA, NaCl, SDS, o Triton X-100, non sono compensati da aggiunta di una BSA o T4 gene proteina 32.

12. Modifiche alle Condizioni Ciclismo

  1. Ottimizzazione la temperatura di ricottura aumenterà qualsiasi reazione PCR e dovrebbe essere considerata in combinazione con altri additivi e / o insieme ad altri mo difiche tecniche alle condizioni ciclismo. Pertanto, per calcolare la temperatura di ricottura ottimale la seguente equazione è utilizzato:
    T a = OPT 0,3 T Primer m + 0,7 m T Product -14,9
    Primer T m viene calcolato come m T della coppia meno stabile usando l'equazione:
    T m Primer = ((AH ​​/ (ΔS + R x ln (c / 4))) -273,15 + 16,6 log [K +] Dove AH è la somma delle variazioni più vicina entalpia di ibridi; ΔS è la somma dei più vicini variazioni di entropia prossimo, R è la costante dei gas (1,99 cal K-1 mol-1); C è la concentrazione di fondo, e [K +] è la concentrazione di potassio.
    L'equazione Quest'ultimo può essere calcolato usando uno dei calcolatori m T elencate al seguente indirizzo:
    rs / fusione / sup_mat / servers_list.html "target =" _blank "> http://protein.bio.puc.cl/cardex/servers/melting/sup_mat/servers_list.html
    T prodotto m è calcolato come segue:
    T Product m = 0,41 (% GC) + 16,6 log [K +] - lunghezza 675/product
    Per la maggior parte delle reazioni PCR la concentrazione di potassio ([K +]) sta per essere di 50 mm.
  2. Hot start PCR è una modifica versatile in cui è aumentato il tempo di denaturazione iniziale drasticamente (Tabella 4). Questa modifica può essere incorporato con o senza altre modifiche alle condizioni di ciclismo. Inoltre, viene spesso utilizzato in combinazione con additivi per la formazione amplicon temperamento. In effetti, hot start PCR è sempre inclusa come un aspetto normale di condizioni generali ciclismo. Hot Start ha dimostrato di aumentare la resa amplicone, mentre aumentando la specificità e la fedeltà della reazione.La logica di hot start PCR è di eliminare primer-dimero e non specifico innesco che può essere una conseguenza della creazione della reazione al di sotto del T m. Così, una tipica reazione di inizio caldo riscalda il campione a una temperatura superiore alla ottimale T m, almeno a 60 ° C prima di qualsiasi amplificazione è in grado di verificarsi. In generale, la DNA polimerasi è trattenuto dalla reazione durante il periodo iniziale, allungata, tempo di denaturazione. Sebbene altri componenti della reazione sono talvolta omessi posto del DNA polimerasi, qui ci si concentrerà sul DNA polimerasi. Esistono vari metodi che consentono la DNA polimerasi di rimanere inattivo o fisicamente separati fino al periodo denaturazione iniziale è completata, compreso l'uso di una barriera di cera solida, anticorpi anti-DNA polimerasi, e proteine ​​accessorie. In alternativa, la DNA polimerasi può semplicemente essere aggiunti alla reazione dopo il ciclo di denaturazione iniziale è completata.
  3. Touchdown PCR (TD-PCR) èdestinato ad assumere alcune delle congettura risolve le limitazioni di calcolo m T mettendo fra parentesi le temperature calcolate ricottura. Il concetto è quello di progettare due fasi di condizioni di ciclismo (Tabella 5). La prima fase impiega successivamente basse temperature di ricottura ogni secondo ciclo (tradizionalmente 1,0 ° C), a partire da 10 ° C al di sopra e infine nella calcolato T m o leggermente inferiore. La seconda fase utilizza lo standard 3-passo le condizioni con la temperatura di ricottura fissato al 5 ° C al di sotto del m calcolato T per altri 20 a 25 cicli. La funzione della prima fase deve alleviare mispriming, conferendo un 4-volte vantaggio per il prodotto corretto. Così, dopo 10 cicli, un vantaggio di 410 volte darebbe 4096 copie del prodotto corretto su ogni innesco spurie.
    • Stepdown PCR è simile a TD-PCR con meno incrementi nella prima fase di adescamento. Come esempio, la prima fase abbassa la temperatura di ricottura ognisecondo ciclo di 3 ° C, a partire da 10 ° C al di sopra e la finitura a 2 ° C inferiore alla calcolato T m. Come TD-PCR, la fase due utilizza lo standard 3-passo le condizioni con la temperatura di ricottura fissato al 5 ° C al di sotto del calcolata T m per 20 a 25 cicli. Ciò consentirebbe il prodotto corretto un vantaggio di 256 volte rispetto ai prodotti adescamento falsi.
    • Rallentamento PCR è semplicemente una modifica del TD-PCR ed ha avuto successo per amplificare GC estremamente ricca (oltre il 83%) sequenze (Tabella 6). Il concetto tiene conto di una caratteristica relativamente nuova associata con le moderne termociclatori, che permette la regolazione della velocità di rampa e la velocità di raffreddamento. Il protocollo utilizza anche dc 7 GTP per ridurre la formazione della struttura 2 ° che potrebbe inibire la reazione. La velocità di rampa viene abbassata a 2,5 ° C s -1 con una velocità di raffreddamento di 1,5 ° C s -1 per i cicli di ricottura. La prima fase inizia con un unonealing temperatura di 70 ° C e riduce la temperatura di ricottura di 1 ° C ogni 3 cicli fino a raggiungere 58 ° C. La seconda fase prosegue poi con una temperatura di riassociazione di 58 ° C per altri 15 cicli.
  4. Nested PCR è un potente strumento utilizzato per eliminare i prodotti spuri. L'uso di primer nested è particolarmente utile quando vi sono diversi geni paralogous in un singolo genoma o quando vi è basso numero di copie di una sequenza bersaglio all'interno di una popolazione eterogenea di sequenze ortologhi. La procedura di base prevede due set di primers che amplificano una singola regione del DNA. I primer esterni cavallo del segmento di interesse e vengono utilizzati per generare i prodotti di PCR che sono spesso non specifico in 20 a 30 cicli. Una piccola aliquota, solitamente circa 5 microlitri dalla prima reazione di 50 pl, viene quindi utilizzata come DNA di stampo per altri 20 a 30 cicli di amplificazione con la seconda serie di primer che annealing ad una posizione relativa internaalla prima serie.

Altri protocolli di PCR sono più specializzati e vanno oltre lo scopo di questo documento. Esempi includono RACE-PCR, Multiplex-PCR, Vectorette-PCR,-PCR quantitativa, e RT-PCR.

13. Risultati rappresentativi

Risultati rappresentativi PCR sono stati generati seguendo i protocolli di base PCR descritto sopra. I risultati incorporano diverse strategie di risoluzione dei problemi per dimostrare l'effetto di diversi reagenti e condizioni sulla reazione. I geni del lievito Saccharomyces cerevisiae erba e da un Mycobacteriophage non caratterizzato sono stati amplificati in questi esperimenti. Lo standard 3-step PCR protocollo descritto nella Tabella 2 è stato impiegato per tutte le tre esperimenti descritti di seguito.

Prima di iniziare l'esperimento PCR, il DNA genomico sia da S. cerevisiae e il Mycobacteriophage sono stati quantificati e diluito ad una concentrazione che allow tra 10 4 e 10 7 molecole di DNA per reazione. Le scorte di lavoro sono stati preparati come segue. Un DNA genomico preparato lievito prodotto 10 4 ng / pl. Una diluizione a 10 ng / pl è stato generato con l'aggiunta di 48 microlitri in 452 pl di pH 8,0 tampone TE. Poiché il S. genoma cerevisiae è di circa 12,5 Mb, 10 ng contiene 7,41 x 10 5 molecole. Il DNA genomico preparato Mycobacteriophage prodotto 313 ng / pl. Una diluizione a 2 ng / pl è stato generato con l'aggiunta di 6,4 pl in 993,6 pl di pH 8,0 tampone TE. Questo DNA del fago è di circa 67 Kb. Quindi, 1 ng contiene 2,73 x 10 7 molecole, che è al limite superiore di DNA generalmente utilizzati per una PCR. Le scorte di lavoro sono stati poi utilizzati per generare le soluzioni di Master Mix delineati nella Tabella 7. Esperimenti varia condizioni di ciclo come descritto di seguito.

In figura 3a, il DNA genomico da S. cerevisiae è stato usato come stampo per amplificareGAL3 il gene, che codifica per una proteina coinvolta nel metabolismo galattosio. L'obiettivo di questo esperimento è stato quello di determinare la concentrazione ottimale di Mg 2 + per questa serie di reagenti. N MgCl 2 era presente nel buffer originale PCR e doveva essere integrato alle concentrazioni indicate con un intervallo testato da 0,0 mm a 5,0 mm. Come mostrato nella figura, un prodotto di PCR della dimensione prevista (2098 bp) appare a partire da un Mg 2 + concentrazione di 2,5 mM (corsia 6) con una concentrazione ottimale di 4,0 mM (corsia 9). La concentrazione raccomandata fornito dal produttore era 1,5 mM, che è la quantità prevista in tipiche buffer PCR. Forse sorprendentemente, la necessaria concentrazione necessaria per la formazione del prodotto in questo esperimento superato questo limite.

Un modello di DNA differenti è stata utilizzata per l'esperimento presentato in Figura 3b. DNA genomico da una Mycobacteriophage è stato utilizzato per amplificare un segmento di DNA conservata 566 bp.Come il precedente esperimento, la concentrazione ottimale di Mg 2 + doveva essere determinato. Come mostrato in figura 3b, l'amplificazione del prodotto desiderato PCR richiede almeno 2,0 mM Mg 2 + (corsia 5). Mentre non vi era più variabilità della quantità di prodotto formato a concentrazioni crescenti di MgCl 2, il prodotto PCR è stata osservata più di 4 mM Mg 2 + (corsia 9), la stessa concentrazione osservato per il gene di lievito GAL3.

Si noti che negli esperimenti presentati nelle figure 3A e 3B, una banda discreta è stata ottenuta utilizzando le condizioni di ciclo ritenuti ottimale sulla base delle temperature di ricottura dei primer. In particolare, la temperatura di denaturazione era 95 ° C con una temperatura di riassociazione di 61 ° C, e l'estensione è stata effettuata per 1 minuto a 72 ° C per 30 cicli. L'estensione finale 5 minuti è stata poi fatta a 72 ° C. Per il terzo esperimento presentata nella figura 3c figura 3c, che era una banda discreto in figura 3a, diventa uno striscio di prodotti non specifici in queste condizioni sub-ottimali ciclismo. Inoltre, con la severità della reazione globale ridotto, una minore quantità di Mg 2 + è richiesto per formare un amplicone.

Tutti e tre gli esperimenti mostrano che, quando le concentrazioni di Mg 2 + sono troppo bassi, non c'è produzione amplicone. Questi risultati dimostrano anche che quando entrambe le condizioni ciclismocorrettamente progettati ed i reagenti sono in concentrazioni ottimali, l'esperimento PCR produce un amplicone discreta corrispondente alla dimensione prevista. I risultati dimostrano l'importanza di eseguire esperimenti di PCR ad una severità sufficientemente elevato (ad esempio, le bande discrete contro uno striscio). Inoltre, gli esperimenti indicano che cambiare un parametro in grado di influenzare un altro parametro, influenzando così il risultato di reazione.

Reagente Concentrazione delle soluzioni madre Volume 13X **
Master Mix
Concentrazione finale
Sterile H 2 O QS a 50 pl QS a 650 pl
PCR Buffer 10X 5 pl 65 microlitri 1X
dNTP 10 mM 1 pl 13 microlitri 200 pM
MgCl 2 25 mM 3 pl 39 microlitri 1,5 mM
Primer forward 20 pM = 20 pmol / pl 1 pl 13 microlitri 20 pmol
Reverse Primer 20 pM = 20 pmol / pl 1 pl 13 microlitri 20 pmol
Modello di DNA Variabile Variabile Variabile ~ 10 5 Molecole
Taq DNA polimerasi 5 Unità / * pl 0,5 pl 6,5 pl 2,5 unità
50 microlitri / Reazione

Tabella 1. Reagenti PCR nell'ordine in cui essi devono essere aggiunti.

* Unità può variare tra i produttori

Aggiungere ** tutti i reagenti al Master Mix escluso qualsiasi necessità di titolazione o che può essere variabile per la reazione. Il Master Mix rappresentato nella precedente tabella viene calcolata per 11 reazioni più 2 reazioni supplementari per accogliere perdita pipetta di trasferimento di assicurare un sufficiente aliquota da ciascun tubo di reazione.

Standard 3-step PCR in bicicletta
Ciclo del passo Temperatura Tempo Numero di cicli
Denaturazione iniziale 94 ° C a 98 ° C 1 minuto 1
Denaturazione
Ricottura
Estensione
94 ° C
5 ° C sotto T m
70 ° C a 80 ° C
10 a 60 secondi
30 secondi
Amplicone DNA polimerasi dipendente
25-35
Estensione finale 70 & deg; C a 80 ° C 5 minuti 1
Tenere * 4 ° C 1

Tabella 2. Standard 3-step PCR in bicicletta.

* La maggior termociclatori termici hanno la capacità di pausa a 4 ° C indefinitamente al termine dei cicli.

70 ° C a 80 ° C
2-step PCR in bicicletta
Ciclo del passo Temperatura Tempo Numero di cicli
Denaturazione iniziale 94 ° C a 98 ° C 1 minuto 1
Denaturazione
Ricottura / Extension
10 a 60 secondi
Amplicone DNA polimerasi dipendente
25-35
Estensione finale 70 ° C a 80 ° C 5 minuti 1

Tabella 3. 2-step bicicletta PCR.

Hot Start PCR in bicicletta
Ciclo del passo Temperatura Tempo Cicli
Denaturazione iniziale 60 ° C a 95 ° C 5 minuti poi aggiungere la DNA polimerasi 1
Denaturazione
Ricottura
Estensione
94 ° C
5 ° C sotto T m
70 ° C a 80 ° C
10 a 60 secondi
30 secondi
Amplicone DNA polimerasi dipendente
25-35
Estensione finale 70 ° C a 80 ° C 5 minuti 1

Tabella 4. Hot Start PCR in bicicletta.

Touchdown PCR Ciclismo
Ciclo del passo Temperatura Tempo Cicli
Denaturazione iniziale 94 ° C a 98 ° C 1
Denaturazione
Ricottura
Estensione
94 ° C
X = 10 ° C sopra T m
70 ° C a 80 ° C
10 a 60 secondi
30 secondi
Amplicone DNA polimerasi dipendente
2
Denaturazione
Ricottura


Estensione
94 ° C
X-1 ° C ridurre 1 ° C ogni due cicli
70 ° C a 80 ° C
10 a 60 secondi
30 secondi
Amplicone e polimerasi dipendenti
28
Denaturazione
Ricottura
Estensione 94 ° C
5 ° C sotto T m
70 ° C a 80 ° C
10 a 60 secondi
30 secondi
Amplicone DNA polimerasi dipendente
20-25
Estensione finale 70 ° C a 80 ° C 5 minuti 1

Tabella 5. Touchdown PCR in bicicletta.

Rallentamento PCR Ciclismo
Ciclo del passo Temperatura Tempo Cicli
Denaturazione iniziale 94 ° C a 98 ° C 1 minuto 1
Denaturazione
Ricottura
Estensione
94 ° C
X ° C = 10 ° C sopra T m
70 ° C a 80 ° C
10 a 60 secondi
30 secondi
Amplicone e polimerasi dipendenti
2
Denaturazione
Ricottura


Estensione
94 ° C
X-1 ° C ridurre 1 ° C ogni due cicli
70 ° C a 80 ° C *
10 a 60 secondi
30 secondi
Amplicon e polimerasi dipendenti
28
Denaturazione
Ricottura
Estensione
94 ° C
5 ° C sotto T m
70 ° C a 80 ° C
10 a 60 secondi
30 secondi
Amplicone e polimerasi dipendenti
20-25
Estensione finale 70 ° C a 80 ° C 5 minuti 1

Tabella 6. Rallentamento PCR in bicicletta.

* Per PCR rallentamento, la velocità di rampa viene abbassata a 2,5 ° C s -1 con una velocità di raffreddamento di 1,5 ° C s -1 per i cicli di ricottura.

Soluzione madre Volume aggiunti a 50 pl di reazione 13 X lievito Master Mix 13 X Phage Master Mix Concentrazione finale
Sterile H 2 O qb a 50 pl = 31 o 30,5 pl qs a 650 microlitri = 396,5 qs a 520 pl = pl 403
PCR Buffer 10X 5 pl 65 microlitri 65 microlitri 1X
10 mM 1 pl 13 microlitri 13 microlitri 200 pM
MgCl 2 Titolazione In aggiunta a ogni reazione In aggiunta a ogni reazione In aggiunta a ogni reazione Variabile vedi titolazione
Primer forward 20 pM = 20 pmol / pl 1 pl 13 microlitri 13 microlitri 20 pmol
Reverse Primer 20 pM = 20 pmol / pl 1 pl 13 microlitri 13 microlitri 20 pmol
Modello di DNA 2 ng / pl fago o 10 ng / pl lievito Phage pl 0,5 o 1 lievito pl 6,5 pl 13 microlitri ~ 10 7 molecole fago o ~ 10 di lievito 5 molecole
Polymerase 0,5 Unità / ** pl 0,5 pl 6,5 pl 6,5 pl 0,5 unità / reazione
40 pl + 10 (titolazione) pl / Reazione TITOLAZIONE
[MgCl 2] 0.00 mm 0,5 mM 1,0 mM 1,5 mm 2,0 mM 2,5 mM 3,0 mM 3,5 mM 4,0 mM 4,5 mM 5,0 mM
MgCl 2 0,00 pl 1,00 pl 2,00 pl 3,0 pl 4,00 pl 5,00 pl 6,00 pl 7,00 pl 8,00 pl 9,00 pl 10,00 pl
H 2 O 10,00 pl 9,00 pl 8,00 pl 7,00 pl 6,00 pl 5,00 pl 4,00 pl 3,00 pl 2,00 pl 1,00 pl 0,00 pl

<strong> Tabella 7. Titolazione di Mg 2 + utilizzato in figura 3.

Figura 1
Figura 1. Problemi comuni che si verificano con primer e 3-step amplificazione PCR del DNA bersaglio. (A) Self-appaiamento dei primer con conseguente formazione della struttura secondaria ad anello tornante. Si noti che i primer non sempre ricottura alle estremità e possono formare strutture ad anello più piccole. (B) Primer ricottura tra loro, piuttosto che il DNA stampo, creando dimeri di primer. Una volta che i primer ricombinarsi reciprocamente essi allungata alle estremità di primer. (C) cicli PCR generare un amplicone specifico. Standard 3-step PCR bicicletta comprendono denaturazione del DNA stampo, appaiamento dei primer, e l'estensione del DNA bersaglio (amplicone) dalla DNA polimerasi.

Figura 2
Figura 2. Secchio ghiaccio con Reaggenitori, pipette, e rack necessari per un PCR. (1.) P-200 pipette, (2.) P-1000 pipette, (3.) P-20 pipette, (4.) P-10 pipetta, (5). Piastra a 96 pozzetti e 0,2 ml di tubi sottili pareti PCR , (6.) Reagenti compreso polimerasi Taq, 10X tampone PCR, MgCl 2, acqua sterile, dNTPs, primer, e DNA stampo, (7.) 1,8 ml provette e cremagliera.

Figura 3
Figura 3. Esempio di titolazioni Mg 2 + utilizzati per ottimizzare un esperimento PCR utilizzando uno standard di 3-passo protocollo PCR. (A) S. Il lievito Saccharomyces DNA genomico è stato utilizzato come modello per amplificare un gene GAL3 2098 bp. In corsia 1 - 6, dove la concentrazione di Mg 2 + è troppo bassa, non possiedono né un prodotto formato (corsie 1-5) del prodotto o molto poco formato (corsia 6). Lanes 7 a 11 rappresentano le concentrazioni ottimali di Mg 2 + per questo esperimento PCR come indicato dalla presenza del prodotto di 2098 bp amplicone. (B) Un uncharacterized genomico modello mycobacteriophage DNA è stato utilizzato per amplificare un amplicone 566 bp. Le corsie 1 - 4, il Mg 2 + concentrazione è troppo basso, come indicato dall'assenza di prodotto. Lanes 5 a 11 rappresentano le concentrazioni ottimali di Mg 2 + per questo PCR come indicato dalla presenza del prodotto di amplicone 566 kb. (C). S. lievito Saccharomyces DNA genomico è stato usato come stampo per amplificare un bp 2098 GAL3 gene indicato come pannello in uno. Tuttavia, la temperatura di ricottura è stata ridotta da 61 ° C a 58 ° C, dando vita ad un non-specifiche bande PCR con lunghezze variabili che producono un effetto di spalmatura sul gel di agarosio. Lanes 1 - 4, dove la concentrazione di Mg 2 + è troppo bassa, non c'è prodotto formato. Lanes 5 - 8 rappresentano le concentrazioni ottimali di Mg 2 + per questo PCR come si vede dalla presenza di uno striscio e la fascia intorno al formato 2098 prodotto amplicone kb. Lanes 9 - 11 sono indicativi di situazioni eccessivamente severe con nessun prodotto formato. (Ac) Lanes 12 è un negative di controllo che non conteneva alcun DNA stampo. Lane, M (marker) è stato caricato con Ladder NEB 1kb.

Figura 4
Figura 4. Provette sterili utilizzati per la PCR. (1.) 1,8 tubo ml (2.) 0,2 ml individuale tubo sottile parete PCR, (3.) 0,2 ml tubi a parete sottile striscia PCR e berretti.

Figura 5
Figura 5. Termociclatore. Chiuso immagine termociclatore sinistra. Immagine di destra contiene 0,2 ml pareti sottili tubi di PCR inseriti nel blocco di riscaldamento di un cycler aperto termico.

Discussion

PCR è diventato uno strumento indispensabile nell'arsenale scienze biologiche. PCR ha alterato il corso della scienza che permette ai biologi di cedere il potere in genomi, e fare i geni ibridi caratterizzati da nuove funzioni, permettendo specifica e accurata sperimentazione clinica, ottenendo informazioni sui genomi e sulle diversità, così come geni semplicemente clonazione per ulteriori analisi biochimiche. Applicazione PCR è limitata solo dalla fantasia dello scienziato che esercita il suo potere. Ci sono molti libri e articoli che descrivono nuovi usi specializzati di PCR, e molti altri saranno sviluppati nel corso della prossima generazione di scienze biologiche. Tuttavia, a prescindere degli approcci previsti, il quadro fondamentale è rimasta la stessa. PCR, in tutta la sua grandezza, è un'applicazione in vitro per generare grandi quantità di uno specifico segmento di DNA.

Progettazione di un esperimento di PCR richiede pensiero e pazienza. I risultati mostrati nella Figura 3 esemplificano una delle principali challenges quando si progetta una strategia di ottimizzazione per la PCR. Cioè, come un parametro di PCR viene modificato, esso può influire altro. Ad esempio, se la prima PCR è stata effettuata a livello sub-ottimale temperatura di annealing (58 ° C) con un ottimale Mg 2 + concentrazione di 2,0 mM, allora il risultato produrrebbe una macchia, come visibile in figura 3c. Un tentativo di risolvere il striscio potrebbe comportare la creazione di condizioni di PCR con reazioni contenenti 2,0 mM MgCl 2 e la regolazione della temperatura di annealing a 61 ° C. Tuttavia, come si vede in figura 3a, ciò non produrrebbe alcun prodotto. Di conseguenza, è consigliabile per titolare reagenti, invece di aggiungere una concentrazione a una singola reazione, quando la risoluzione falsi risultati. Inoltre, le regolazioni più comuni che sono necessarie per ottimizzare un esperimento PCR sono per cambiare la concentrazione di Mg 2 + e di correggere le temperature di ricottura. Tuttavia, se tali modifiche non ridurre o abolire i risultati aberranti, la titolazione di additives e / o modificare i protocolli di ciclismo condizioni descritte nelle tabelle 2-6 può alleviare il problema. Se tutto il resto fallisce, ridisegnare i primer e provare, riprovare.

Disclosures

Non ho nulla da rivelare.

Acknowledgments

Un ringraziamento speciale a Kris Reddi presso la UCLA per la creazione di reagenti e versando gel e Erin Sanders presso la UCLA per l'ispirazione, guida e sostegno e correzione del manoscritto. Vorrei anche ringraziare Giancarlo Costaguta e Gregory S. Payne per l'alimentazione del DNA genomico lievito e primer per amplificare il gene GAL3. Vorrei anche ringraziare Shah Bhairav ​​per scattare le foto delle apparecchiature di laboratorio e reagenti usati per fare figure da 2 a 4. Il finanziamento per questo progetto è stato fornito dal HHMI (HHMI Grant No. 52006944).

Materials

Name Company Catalog Number Comments
Taq Polymeras Sigma-Aldrich D4545-25UN
dNTPs Qiagen 201225
0.2 ml Thin Wall Tubes PCR tubes Bio-Rad 223-9469
0.2 ml Thin Wall Tube caps Bio-Rad 223-9472
EDTA disodium salt dihydrate Sigma-Aldrich E5134
Trizma-HCl Sigma-Aldrich T-3253
Custom Phage Primer Invitrogen 25441F_RL6_Contig2_68k TACTGCAACGCGATGTTGCG
Custom Phage Primer Invitrogen 26007R_RL6_ Contig2_68k TCACCATCAATCGTGGCGGT
Custom Yeast Primer Integrated DNA Technologies SacI-Gal3(-256) ACCTGGAGCTCCTATTT TAACATGTGGATTTCTTGAAAGAATGAAATCG
Custom Yeast Primer Integrated DNA Technologies Gal3(1848)-SacI CGGATGGAGCTCGCGT GAAGGTAATTTTTTTTTATGTCTCCG
Thermal Cycler Bio-Rad 170-9703 My Cycler
Agarose ISC BioExpress E-3120-500
Gel electrophoresis Hoeffer Scientific Instruments Model HE33
1 kb DNA Ladder New England Biolabs N3232S
Bio Rad Power Pack Bio-Rad 164-5050 PowerPac Basic
Gel Doc system Fotodyne Incorporated FOTO/Analyst Investigator FX Workstation

DOWNLOAD MATERIALS LIST

References

  1. Albert, J., Fenyo, E. M. Simple sensitive, and specific detection of human immunodeficiency virus type 1 in clinical specimens by polymerase chain reaction with nested primers. J. Clin. Microbiol. 28, 1560-1564 (1990).
  2. Baskaran, N., et al. Uniform amplification of a mixture of deoxyribonucleic acids with varying GC content. Genome Res. 6, 633-638 (1996).
  3. Blanchard, M. M., Taillon-Miller, P., Nowotny, P., Nowotny, V. PCR buffer optimization with uniform temperature regimen to facilitate automation. PCR Methods Appl. 2, 234-240 (1993).
  4. Borer, P. N., Dengler, B., Tinoco, I. Jr, Uhlenbeck, O. C. Stability of ribonucleic acid double-stranded helices. J. Mol. Biol. 86, 843-853 (1974).
  5. Breslauer, K. J., Frank, R., Blocker, H., Marky, L. A. Predicting DNA duplex stability from the base sequence. Proc. Natl. Acad. Sci. U.S.A. 83, 3746-3750 (1986).
  6. Chou, Q., Russell, M., Birch, D. E., Raymond, J., Bloch, W. Prevention of pre-PCR mis-priming and primer dimerization improves low-copy-number amplifications. Nucleic Acids Res. 20, 1717-1723 (1992).
  7. Coleman, W. B., Tsongalis, G. J. Diagnostics for the clinical laboration. Humana Press. (2005).
  8. D'Aquila, R. T., et al. Maximizing sensitivity and specificity of PCR by pre-amplification heating. Nucleic Acids Res. 19, 3749 (1991).
  9. Dieffenbach, C. W., Lowe, T. M., Dveksler, G. S. General concepts for PCR primer design. PCR Methods Appl. 3, S30-S37 (1993).
  10. Don, R. H., Cox, P. T., Wainwright, B. J., Baker, K., Mattick, J. S. 'Touchdown' PCR to circumvent spurious priming during gene amplification. Nucleic Acids Res. 19, 4008 (1991).
  11. Erlich, H. A., Gelfand, D., Sninsky, J. J. Recent advances in the polymerase chain reaction. Science. 252, 1643-1651 (1991).
  12. Frey, U. H., Bachmann, H. S., Peters, J., Siffert, W. PCR-amplification of GC-rich regions: 'slowdown PCR. Nat. Protoc. 3, 1312-1317 (2008).
  13. Haqqi, T. M., Sarkar, G., David, C. S., Sommer, S. S. Specific amplification with PCR of a refractory segment of genomic DNA. Nucleic Acids Res. 16, 11844 (1988).
  14. Henke, W., Herdel, K., Jung, K., Schnorr, D., Loening, S. A. Betaine improves the PCR amplification of GC-rich DNA sequences. Nucleic Acids Res. 25, 3957-3958 (1997).
  15. Innis, M. A., Gelfand, D. H., Sninsky, J. J., White, T. J. PCR Protocols: A guide to methods and applications. Academic Press, Inc. San Diego. (1990).
  16. King, N. Methods in Molecular Biology. 630, Humana Press. (2010).
  17. Kleppe, K., Ohtsuka, E., Kleppe, R., Molineux, I., Khorana, H. G. Studies on polynucleotides. XCVI. Repair replications of short synthetic DNA's as catalyzed by DNA polymerases. J. Mol. Biol. 56, 341-361 (1971).
  18. Korbie, D. J., Mattick, J. S. Touchdown PCR for increased specificity and sensitivity in PCR amplification. Nat. Protoc. 3, 1452-1456 (2008).
  19. Kramer, M. F., Coen, D. M. Enzymatic amplification of DNA by PCR: standard procedures and optimization. Curr. Protoc. Toxicol. Appendix 3, 1-14 (2001).
  20. Kramer, M. F., Coen, D. M. The polymerase chain reaction. Curr. Protoc. Protein Sci. Appendix 4, Appendix 4J (2002).
  21. Kreader, C. A. Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein. Appl. Environ. Microbiol. 62, 1102-1106 (1996).
  22. Kwok, S., et al. Identification of human immunodeficiency virus sequences by using in vitro enzymatic amplification and oligomer cleavage detection. J. Virol. 61, 1690-1694 (1987).
  23. McConlogue, L., Brow, M. A., Innis, M. A. Structure-independent DNA amplification by PCR using 7-deaza-2'-deoxyguanosine. Nucleic Acids Res. 16, 9869 (1988).
  24. Mullis, K. B. The unusual origin of the polymerase chain reaction. Sci. Am. 262, 56-65 (1990).
  25. Mullis, K. B. Target amplification for DNA analysis by the polymerase chain reaction. Ann. Biol. Clin. (Paris). 48, 579-582 (1990).
  26. Mullis, K. B. The polymerase chain reaction in an anemic mode: how to avoid cold oligodeoxyribonuclear fusion). PCR Methods Appl. 1, 1-4 (1991).
  27. Mullis, K. B., Faloona, F. A. Specific synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymol. 155, 335-350 (1987).
  28. Paabo, S., Gifford, J. A., Wilson, A. C. Mitochondrial DNA sequences from a 7000-year old brain. Nucleic Acids Res. 16, 9775-9787 (1988).
  29. Rees, W. A., Yager, T. D., Korte, J., von Hippel, P. H. Betaine can eliminate the base pair composition dependence of DNA melting. Biochemistry. 32, 137-144 (1993).
  30. Roux, K. H., Hecker, K. H. One-step optimization using touchdown and stepdown PCR. Methods Mol. Biol. 67, 39-45 (1997).
  31. Rychlik, W., Spencer, W. J., Rhoads, R. E. Optimization of the annealing temperature for DNA amplification in vitro. Nucleic Acids Res. 18, 6409-6412 (1990).
  32. Saiki, R. K., et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science. 239, 487-491 (1988).
  33. Saiki, R. K., et al. Enzymatic amplification of beta-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science. 230, 1350-1354 (1985).
  34. Sambrook, J. A. R., David, W. Molecular Cloning A Laboratory Manual. 2, 3, Cold Spring Harbor Laboratory Press. (2001).
  35. Sarkar, G., Kapelner, S., Sommer, S. S. Formamide can dramatically improve the specificity of PCR. Nucleic Acids Res. 18, 7465 (1990).
  36. Smit, V. T., et al. KRAS codon 12 mutations occur very frequently in pancreatic adenocarcinomas. Nucleic Acids Res. 16, 7773-7782 (1988).
  37. Wilson, I. G. Inhibition and facilitation of nucleic acid amplification. Appl. Environ. Microbiol. 63, 3741-3751 (1997).
  38. Wu, R. Methods in Enzymology. 218, Academic Press, Inc. San Diego. (1993).

Comments

1 Comment

  1. Thanks for the great overview of the all-important PCR procedure. I will no doubt reference it often in the future.

    I have a PCR troubleshooting question...what do to about streaking on the gel after a successful amplification? My bands are nice and bright and where they are supposed to be, but there is a heavily-streaked "path" starting at the wells and following until the end where my bands are. Is there something I can do about my PCR conditions, or the thermocycler settings? Any comments would be appreciated.

    Reply
    Posted by: Doug E.
    September 8, 2013 - 1:23 PM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics