वातावरण में जलीय हाइड्रोकार्बन रूपांतरण सक्षम टूलकिट

Bioengineering
 

Summary

एक स्थायी तेल प्रदूषण के remediation के लिए जीवाणु प्रणाली को विनियमित ऑटो मानक विनिमेय डीएनए भागों (BioBricks) का उपयोग कर बनाया गया था. एक इंजीनियर

Cite this Article

Copy Citation | Download Citations

Brinkman, E. K., Schipper, K., Bongaerts, N., Voges, M. J., Abate, A., Wahl, S. A. A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments. J. Vis. Exp. (68), e4182, doi:10.3791/4182 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Protocol

1. BioBrick विधानसभा

  1. मानक जैविक भागों की रजिस्ट्री से BioBricks iGEM मुख्यालय द्वारा प्रदान की जाती हैं. मौजूदा BioBricks से एक नया BioBrick का निर्माण, EcoRI और SpeI एंजाइमों के साथ दाता स्वीकर्ता भाग का हिस्सा नीचे की ओर की स्थिति के लिए दाता BioBrick (1.0 ग्राम) डाइजेस्ट. दाता स्वीकर्ता भाग के अपस्ट्रीम हिस्सा स्थिति लिए XbaI और PstI साथ डाइजेस्ट. एक तीसरे उपयुक्त प्रतिबंध एंजाइम कि दाता की रीढ़ की हड्डी में कटौती जोड़ें. उचित बफर के साथ 20-25 मिलीलीटर की कुल मात्रा में digestions आपूर्तिकर्ता (अंतिम एकाग्रता 1x) के अनुसार, प्रदर्शन. प्रतिबंध एंजाइमों के लिए 5 इकाइयों / छ डीएनए का प्रयोग करें.
  2. या तो EcoRI XbaI और या SpeI और PstI साथ स्वीकर्ता BioBrick डाइजेस्ट.
  3. 37 पर (कम से कम) के लिए एक घंटा digestions सेते डिग्री सेल्सियस निष्क्रिय प्रतिबंध गर्मी से endonucleases, 80 पर ऊष्मायन ° सी के लिए 10 मिनट और अपकेंद्रित्र शीघ्र ही.
  4. पचा BioBrick कटी घमनी को बांधना(दाता और स्वीकर्ता) एक साथ भागों. चूंकि XbaI और SpeI संगत डीएनए समाप्त होता है उत्पन्न करने के लिए, एक मिश्रित साइट बनाई गई है कि किसी भी प्रतिबंध के एंजाइम के साथ एक नया 'संयुक्त' BioBrick कि 4 मानक प्रतिबंध साइटों द्वारा flanked में उत्पन्न नहीं काटा जा सकता. Ligation मिश्रण में अंतिम डीएनए एकाग्रता बेहतर है ~ 100 एनजी / μl. 10-15 मिलीलीटर की कुल मात्रा में टी -4 ligation (अंतिम एकाग्रता 1x) बफर और टी -4 ligase (1 यूनिट / छ डीएनए) के साथ प्रतिक्रिया ligation प्रदर्शन.
  5. 16 डिग्री सेल्सियस पर कम से कम 3 घंटे के लिए ligation मिश्रण सेते हैं.
  6. प्रदर्शन ligation मिश्रण के लगभग आधे के साथ परिवर्तन की प्रतिक्रिया.
  7. BioBrick पुष्टि अनुक्रमण के साथ सही हो.
  8. संश्लेषित डीएनए से एक नया BioBrick का निर्माण करने के लिए, ई. में इष्टतम अभिव्यक्ति के लिए संश्लेषण के लिए जीन संशोधित JCat वेबसाइट उपकरण (के माध्यम से http://www.jcat.de/ कोलाई ). बी की आवश्यकताओं के अनुसार आगे संशोधन ioBrick मानक. यह मानकीकरण का तात्पर्य है कि हर BioBrick एक उपसर्ग से पहले और एक प्रत्यय के बाद ब्याज की एक डीएनए अनुक्रम का बना है. उपसर्ग और प्रत्यय दृश्यों कि पूर्वनिर्धारित प्रतिबंध साइटों, कि शेष प्लाज्मिड अनुक्रम में अनुपस्थित रहे हैं शामिल हैं. ये मानक प्रतिबंध साइटों यह संभव विनिमय और BioBrick आवेषण flexibly 9 का विस्तार. उपसर्ग और प्रत्यय निम्नलिखित दृश्य है:
नाम अनुक्रम टिप्पणी
उपसर्ग 5 'GAATTCGCGGCCGCTTCTAG3'
5 'GAATTCGCGGCCGCTTCTAGAG 3' यदि निम्न भाग एक अनुक्रम कोडन या किसी भी हिस्से कि "ATG" के साथ शुरू होता है
प्रत्यय 5 'TACTAGTAGCGGCCGCTGCAG 3'
ove_title "> 2 vivo में. alkane रूपांतरण आराम सेल परख,

इस परख फुजी एट अल (2004) द्वारा वर्णित विधि के आधार पर किया गया था.

  1. संस्कृति ई. कोलाई alkane hydroxylase प्रणाली (व्यक्त कोशिकाओं BBa_K398014 ) और कोशिकाओं को एक खाली सदिश (पेट BBa_J13002 5 मिलीलीटर लेग मध्यम में उचित एंटीबायोटिक दवाओं के साथ रातोंरात).
  2. ताजा पौंड (एंटीबायोटिक) के 50 मिलीलीटर में रातोंरात संस्कृति के 500 μl स्थानांतरण और सेते हैं जब तक सेल turbidity 600 एनएम पर 0.3 के एक आयुध डिपो (ऑप्टिकल घनत्व) पर पहुंच गया.
  3. 4000 आरपीएम पर 10 मिनट के लिए अपकेंद्रित्र और 5 मिलीग्राम 0.1 एम फॉस्फेट बफर (7.4 पीएच) में गोली resuspend.
  4. 4000 आरपीएम पर 10 मिनट के लिए फिर से अपकेंद्रित्र और 5 मिलीग्राम 0.1 एम फॉस्फेट अब E2 लवण और 0.66% ग्लिसरॉल v / v (नाइट्रोजन deficien युक्त बफर में गोली resuspendमध्यम टी).
  5. कोशिका turbidity (600 आयुध डिपो) उपाय.
  6. 6 मिलीलीटर की 25 मिलीलीटर बंद टोपी ग्लास बोतल और कोई सेल नियंत्रण (E2 + लवण 0.66% ग्लिसरॉल v / v) में सेल मिश्रण aliquots तैयार.
  7. प्रत्येक फ्लास्क एल्केन की 100 nmol जोड़ें.
  8. 37 डिग्री सेल्सियस पर 24 घंटा (छोटा जब उच्च दर प्राप्त कर रहे हैं) के लिए मिश्रण सेते हैं.
  9. ऊष्मायन के बाद 600 आयुध डिपो उपाय.
  10. एथिल एसीटेट द्वारा मीडिया संस्कृति में हाइड्रोकार्बन निकालें और गैस क्रोमैटोग्राफी (प्रोटोकॉल 3 देखें) सेल संस्कृति में हाइड्रोकार्बन एकाग्रता का निर्धारण.
  11. एल्केन की कुल राशि प्रत्येक फ्लास्क में कुल बायोमास वर्तमान (सूखी वजन आयुध डिपो 600 परिवर्तित) द्वारा परिवर्तित विभाजन द्वारा बायोमास का प्रति यूनिट गिरावट की गणना. प्रयोगात्मक अवधि से परिणाम Dividing समय प्रति यूनिट प्रति इकाई बायोमास गिरावट गतिविधि पैदावार. औसत व्यक्ति तीन रन से लिया जाता है.

3. Alkane रूपांतरण एंजाइम परख में,इन विट्रो

इस परख अनिवार्य रूप से ली एट अल (2008) द्वारा वर्णित विधि के अनुसार किया गया था.

  1. संस्कृति ई. कोलाई Lada (जीन व्यक्त कोशिकाओं BBa_K398017 ) और एक खाली वेक्टर (कोशिकाओं को ले जाने BBa_J13002 50 मिलीलीटर लेग मध्यम में उचित एंटीबायोटिक दवाओं के साथ) रातोंरात.
  2. ताजा पौंड (एंटीबायोटिक) के 50 मिलीलीटर में रातोंरात संस्कृति के 500 μl स्थानांतरण और सेते हैं जब तक सेल turbidity के ऑप्टिकल घनत्व 600 एनएम पर 0.6 पर पहुंच गया.
  3. 4000 rpm (4 डिग्री सेल्सियस) पर 10 मिनट अपकेंद्रित्र और 50 मिमी Tris बफर के 5 मिलीलीटर में गोली resuspend.
  4. Sonicate (सेल disrupter, ला Biosystems) 4 के एक उत्पादन नियंत्रण के साथ 40% कर्तव्य चक्र कोशिकाओं, बर्फ पर समाधान पूरी अवधि के लिए रखने के लिए.
  5. 4000 आरपीएम पर 5 मिनट के लिए 4 और घ में जिसके परिणामस्वरूप मिश्रण अपकेंद्रित्रजैसे, सी के लिए सेल मलबे को हटा दें. एक ताजा शीशी तैरनेवाला स्थानांतरण.
  6. ब्रैडफोर्ड परख सेल के अर्क के कुल प्रोटीन एकाग्रता का निर्धारण करते हैं. नोट: पृष्ठभूमि की वृद्धि हुई है और / या प्रोटीन की हानि को रोकने के लिए कांच की शीशियों का उपयोग करने के लिए.
  7. एक 100 मिलीलीटर 0.1% वी / वी alkane और 50 मिमी Tris - एचसीएल बफर युक्त मिश्रण तैयार करें.
  8. 100 डिग्री सेल्सियस पर 5 मिनट के लिए मिश्रण गर्मी. नोट: मध्यम उच्च उबलते बिंदु के साथ लंबी श्रृंखला alkanes के लिए ही इस कदम प्रदर्शन. (उदाहरण के लिए C 16: 287 डिग्री सेल्सियस).
  9. एल्केन की एक इष्टतम विलेयता को प्राप्त करने के लिए, जबकि अभी भी गर्म है जब तक एक समरूप, चिपचिपा मिश्रण प्राप्त है 1 मिनट के लिए sonicate.
  10. NADH 1mm, 1 मिमी FMN, 1 मिमी MgSO 4 और 0.01 v / v ट्राइटन X-100 जोड़ें.
  11. 25 मिलीलीटर की बोतल में बंद टोपी 6 मिलीलीटर aliquots तैयार.
  12. सेल निकालने के लिए पर्याप्त मात्रा में (ब्रैडफोर्ड assays, 5 मिलीग्राम / एल प्रोटीन के अंतिम एकाग्रता पर निर्भर करता है) जोड़ें. एक नियंत्रण नहीं प्रोटीन तैयार.
  13. इष्टतम ई के लिए 60 सी ° (सेते24 घंटे के लिए गतिविधि nzymatic).
  14. एथिल एसीटेट द्वारा मीडिया संस्कृति में हाइड्रोकार्बन निकालें और गैस क्रोमैटोग्राफी (प्रोटोकॉल 3 देखें) सेल संस्कृति में हाइड्रोकार्बन एकाग्रता का निर्धारण.
  15. बायोमास के प्रति इकाई गिरावट एल्केन की कुल राशि कुल प्रोटीन से परिवर्तित विभाजित करके प्रत्येक फ्लास्क (ब्रैडफोर्ड अंशांकन वक्र द्वारा) की गणना करने के लिए जोड़ा है. इसके अलावा प्रयोग की अवधि से विभाजित समय प्रति यूनिट सेलुलर प्रोटीन के प्रति यूनिट गिरावट गतिविधि पैदावार. औसत व्यक्ति तीन रन से लिया जाता है.

4. एथिल एसीटेट निकासी हाइड्रोकार्बन और एकाग्रता माप

  1. Alkanes जलीय समाधान से 6 मिलीलीटर प्रयोगात्मक समाधान के लिए 2.5 मिलीलीटर एथिल एसीटेट (ध्रुवहीन solvant) जोड़कर निकाले जाते हैं. एक आंतरिक मानक (v / v) में 0.1% की एकाग्रता पर विलायक करने के लिए जोड़ा है. मानक (जैसे cyclo-decan) ब्याज की चोटियों की उम्मीद सीमा पर निर्भर करता है विविध.
  2. वैकल्पिक जोड़ें ट्राइटनजलीय मिश्रण करने के लिए X-100 और 4000 आरपीएम पर 10 मिनट के लिए नमूने के क्रम में एक उचित प्रणाली द्वि phasic अपकेंद्रित्र.
  3. भंवर अलग दो चरणों तक 5 (1500 आरपीएम) सेकंड और कमरे के तापमान पर सेते के लिए मिश्रण.
  4. कार्बनिक परत (ऊपर) की एक अधिकतम राशि निकालें और विलायक सूखी निर्जल मैग्नीशियम सल्फेट का उपयोग.
  5. MgSO 4 निस्पंदन (0.2 सुक्ष्ममापी) निकालें और मापन के लिए गैस chromatograph शीशियों में छानना, या -20 डिग्री सेल्सियस पर दुकान हस्तांतरण
  6. CP-एसआईएल 5CB स्तंभ (= लंबाई 5 मीटर) का उपयोग गैस क्रोमैटोग्राफी द्वारा एकाग्रता का निर्धारण करते हैं. अलग विधा में नमूने के 10 μl सुई (1:10, 230 डिग्री सेल्सियस). 1 मिलीग्राम / मिनट (हीलियम) स्तंभ गैस प्रवाह सेट. निम्नलिखित ओवन तापमान कार्यक्रम किया जाता है:
    दर तापमान [° सी] समय [मिनट]
    0 50 7.5
    50 90 1.0
    50 110 2.0
    50 130 2.0
    50 145 2.0
    50 160 2.0
    50 170 2.0
    50 185 2.0
    50 210 2.0
    50 250 2.0
    50 320 2.0
  7. चोटियों एकीकृत और आंतरिक मानक के लिए सम्मान के साथ सांद्रता सही.

5. शराब / एल्डिहाइड डिहाइड्रोजनेज गतिविधि परख

इस परख अनिवार्य Kato एट अल द्वारा वर्णित विधि के अनुसार किया गया था.(2010).

  1. संस्कृति ई. कोली (ADH व्यक्त कोशिकाओं BBa_K398018 ) या ALDH ( BBa_K398030 ) जीन और एक खाली वेक्टर (कोशिकाओं को ले जाने BBa_J13002 50 मिलीलीटर लेग मध्यम में उपयुक्त रातोंरात एंटीबायोटिक दवाओं के साथ).
  2. ताजा पौंड (एंटीबायोटिक) के 50 मिलीलीटर में रातोंरात संस्कृति के 500 μl स्थानांतरण और सेते हैं जब तक सेल turbidity के ऑप्टिकल घनत्व 600 एनएम पर 0.6 पर पहुंच गया.
  3. अपकेंद्रित्र 4000 rpm पर 4 डिग्री सेल्सियस पर 10 मिनट और 5 मिलीलीटर में 50 मिमी Tris बफर का गोली resuspend.
  4. 4 के एक उत्पादन नियंत्रण (बर्फ पर sonication के दौरान समाधान रखने के लिए) के साथ 40% कर्तव्य चक्र पर सेल समाधान Sonicate.
  5. 4000 आरपीएम पर 4 में 5 मिनट के लिए जिसके परिणामस्वरूप मिश्रण अपकेंद्रित्र डिग्री सेल्सियस सेल मलबे को हटाने के लिए.
  6. निर्धारित करने के लिए(: एक गिलास शीशी का उपयोग करने के लिए प्रोटीन बाध्यकारी को रोकने के नोट) ब्रैडफोर्ड परख द्वारा सेल के अर्क के ताल प्रोटीन एकाग्रता.
  7. प्रत्येक कुएं में 180 μl 57 मिमी ग्लाइसिन बफर NAD (अंतिम एकाग्रता 1 मिमी, पीएच 9.5) के साथ एक 96 अच्छी तरह से थाली लोड.
  8. (एल्डिहाइड) शराब कुओं का परीक्षण करने के लिए किया जा के 5 μl जोड़ें. नोट: हीट परख के शुरू होने से पहले लंबी श्रृंखला alcohols एक तरल है. के लिए प्रत्येक (एल्डिहाइड) शराब सब्सट्रेट (नकारात्मक नियंत्रण) के बिना एक नियंत्रण जोड़ा जाना चाहिए. इसके अलावा, एक सेल निकालने बिना बफर और सब्सट्रेट के एक मिश्रण युक्त रिक्त तैयार.
  9. पहले से गरम प्लेट पाठक (Tecan मैगलन v7.0) के 37 में 15 मिनट के लिए थाली ° C प्रणाली के संतुलन की अनुमति.
  10. सेल निकालने के लिए पर्याप्त मात्रा में (ब्रैडफोर्ड assays, 5 मिलीग्राम / एल प्रोटीन के अंतिम एकाग्रता पर निर्भर करता है) जोड़ें. एक नियंत्रण नहीं प्रोटीन तैयार.
  11. 340 एनएम के तरंग दैर्ध्य 37 पर हर 2-3 मिनट 1 घंटा के लिए <सेल्सियस पर NADH एक स्पेक्ट्रोफोटोमीटर का उपयोग कर उत्पादन उपाय/ Li>
  12. आयुध डिपो (340 एनएम) के ढलान से NADH उत्पादन दर की गणना. खाते में प्रकाश पथ लंबाई और NADH के 6220 एम -1 -1 सेमी के विलुप्त होने के गुणांक से ले लो. प्रोटीन की कुल राशि से NADH उत्पादन दर विभाजित सेल निकालने में डिहाइड्रोजनेज प्रतिक्रिया (यू / मिलीग्राम पूरे सेल प्रोटीन) की गतिविधि को व्यक्त करने के लिए जोड़ा गया. तीन स्वतंत्र रन से मतलब है और मानक विचलन की गणना.

6. pCaiF विशेषता

  1. संस्कृति ई. कोलाई pCaiF GFP construct (व्यक्त कोशिकाओं BBa_K398331 ) और अकेले प्रमोटर (पेट कोशिकाओं BBa_K398326 ) रातोंरात 5 मिलीलीटर लेग मध्यम में उचित एंटीबायोटिक दवाओं रातोंरात.
  2. 5 मिलीलीटर M9 रातोंरात संस्कृति का 50 μl के साथ 10 ग्लूकोज एल / छ और एंटीबायोटिक दवाओं से युक्त टीका लगाना और रात में हो जाना. उपसंकृति रातोंरात परिणाम के 50 μl ताजा M9 with10 छ / एल और सेते के 5 मिलीलीटर में जब तक सेल turbidity 600 एनएम पर 0.2 की एक ऑप्टिकल घनत्व पर पहुंच गया.
  3. लोड एक 96 ताजा M9 प्रत्येक में अच्छी तरह से परीक्षण के लिए कार्बन स्रोत के वांछित राशि युक्त मध्यम के 100 μl के साथ अच्छी तरह से थाली. सांख्यिकीय मूल्यांकन के लिए तीन प्रतियों प्रयोग करते हैं और संबंधित नकारात्मक नियंत्रण (जंगली प्रकार ई. कोलाई K12) जोड़ने.
  4. मध्यम युक्त कुओं के लिए रातोंरात संस्कृति के 5 μl जोड़ें.
  5. विकास (600 आयुध डिपो) वक्र और GFP प्रतिदीप्ति (485 एनएम उत्तेजना और उत्सर्जन 520) एक प्लेट रीडर का उपयोग कर 37 पर हर 18 घंटे के लिए 10 मिनट ° लगातार झटकों के साथ सी उपाय.
  6. विकास दर और संबंधित माप से विशिष्ट GFP सामग्री की गणना और नियंत्रण करने के लिए तुलना. मतलब है और कम से कम तीन स्वतंत्र प्रयोगों के मानक विचलन की गणना.

7. सहिष्णुता परख

  1. संस्कृतिई. कोलाई PhPFDα और β जीन (व्यक्त BBa_K398406 ) रातोंरात 5 मिलीग्राम लेग मध्यम और उचित एंटीबायोटिक दवाओं में ई.. LADA जीन (व्यक्त कोलाई BBa_K398017 ) नकारात्मक नियंत्रण के रूप में प्रयोग किया जाता है.
  2. Subculture पौंड की ताजा 5 मिलीलीटर (एंटीबायोटिक) और सेते में रातोरात परिणाम की 10 μl तक सेल turbidity 0.4 600 एनएम पर 0.3 की एक ऑप्टिकल घनत्व पर पहुंच गया.
  3. ताजा माध्यम से संस्कृतियों पतला 0.1 की 600 आयुध डिपो तक पहुँच जाता है.
  4. लोड एक 96 180 μl M9 उचित एंटीबायोटिक दवाओं और तीन प्रतियों में विषाक्त यौगिक (0 उदाहरण के लिए, 4, 8, n-hexane के 10%) के उचित अंतिम एकाग्रता युक्त मध्यम के साथ अच्छी तरह से थाली. क्योंकि alkane पानी के मिश्रण को दो चरण सिस्टम के लिए नेतृत्व कर सकते हैं यह जरूरी है कि थाली पर उचित नियंत्रण (जैसे घifferent उपभेदों और संबंधित रिक्त प्रयोगों).
  5. कुओं में संस्कृति (नियंत्रण) के 20 μl जोड़ें.
  6. बायोमास (600 आयुध डिपो) एकाग्रता एक प्लेट पाठक लगातार झटकों के साथ 37 पर हर 24 घंटे के लिए 10 मिनट डिग्री सेल्सियस का उपयोग कर उपाय.
  7. विभिन्न एजेंट सांद्रता के लिए संबंधित माप से विकास दर की गणना और नकारात्मक नियंत्रण के लिए तुलना करें. कम से कम तीन स्वतंत्र रन का मतलब है और मानक विचलन की गणना.

8. Homolog सहभागिता मैपिंग

  1. आवेदन उसे एक PostgreSQL डेटाबेस STRING (शैक्षणिक उपयोग के लिए नि: शुल्क) 20 चल सर्वर पर प्रोटीन प्रश्नों प्रदर्शन करने के लिए विकसित किया गया था. सजात बातचीत मानचित्रण आवेदन मूल मेजबान स्ट्रिंग डेटाबेस का उपयोग जीव में बातचीत प्रोटीन की पहचान है. संबंधित बातचीत जीनों के दृश्यों लक्ष्य जीव में मुताबिक़ जीन को खोजने के लिए एक बम विस्फोट के लिए खोज में इस्तेमाल किया जाता है. 4 Cytoscape https://github.com/jcnossen/InteractionHomologMapping.
  2. एक मानचित्रण प्रदर्शन, (1) BioBrick आईडी दर्ज करें और आवेदन स्वतः मानक जैविक 9 पार्ट्स, या (2) दर्ज करें (पेस्ट) आवेदन में अनुक्रम डेटा की रजिस्ट्री से भाग अनुक्रम डेटा डाउनलोड करेगा.
  3. STRING डाटाबेस वेबसाइट का प्रयोग करने के लिए स्ट्रिंग में प्रवेश किया अमीनो एसिड अनुक्रम के लिए प्रोटीन आईडी मिल.
  4. उच्च समरूपता के साथ एक प्रोटीन विस्फोट का उपयोग कर निर्धारित किया जाता है. मेजबान जीव में homologs (जैसे ई. कोलाई) के लिए स्रोत और जीव खोजों में इसके बाद आवेदन को प्रत्येक ज्ञात बातचीत प्रोटीन को सूची बद्ध करता है.
  5. पाठ या Cytoscape परिणामस्वरूप ख्यात बातचीत सूची में निर्यात करें.

Discussion

BioBrick सिद्धांत alkanes की गिरावट के लिए एक हवाई जहाज़ के पहिये का निर्माण करने के लिए प्रयोग किया जाता है और टूलकिट के एक घटक के लिए सिद्धांत का एक सबूत प्राप्त किया गया था. कई assays के लिए vivo में और alkane अपमानजनक मार्ग एंजाइमों की इन विट्रो गतिविधि को मापने के लिए प्रस्तावित कर रहे हैं. प्रस्तुत काम सफलतापूर्वक तरीकों की एक संख्या दर्शाता है कि एंजाइम मेजबान जीव ई. में अभिव्यक्ति और गतिविधियों का निर्धारण करने के लिए इस्तेमाल किया जा सकता है उपयुक्त BioBricks के कार्यान्वयन के बाद कोली. इसके अलावा, यह दिखाया गया है कि BioBrick सिद्धांत एक जीव है कि alkanes की गिरावट के लिए आवश्यक प्रोटीन व्यक्त डिजाइन करने के लिए इस्तेमाल किया जा सकता है, एक नियामक प्रणाली है कि इन एंजाइमों का उत्पादन प्रदान करता है केवल जब आवश्यक और हाइड्रोकार्बन की उपस्थिति में मेजबान जीव की सहनशीलता augments . एक बार आगे विकसित, इस हवाई जहाज़ के पहिये अवशिष्ट तेल की जैविक गिरावट के लिए इस्तेमाल किया जा सकता है, जैसे तेल पानी पीछा रेत में, या उपचार के लिएतेल उद्योग से अपशिष्ट जल का.

Alkane गिरावट के साथ संबंध है, assays alkane गिरावट का पहला कदम (एएच प्रणाली और Lada) में शामिल एंजाइमों के लक्षण वर्णन के लिए प्रदर्शन किया गया. यह प्रदर्शन किया गया है कि एक ई कोलाई Gordonia सपा एएच प्रणाली ले तनाव. TF6 vivo में ओकटाइन बदलने में सक्षम था यह निष्कर्ष फुजी एट के परिणामों के साथ समझौते में है. अल. 8, जहां n-alkanes biotransformation ई. का उपयोग AH-प्रणाली के न्यूनतम घटक जीन व्यक्त कोलाई हासिल की थी. रूपांतरण गतिविधि एक निश्चित समय के बाद एक तुलनात्मक अध्ययन (wildtype उत्परिवर्ती बनाम) मापा गया था. एक पूर्ण लक्षण वर्णन के लिए, अतिरिक्त अध्ययन के लिए समय और प्रणाली के कैनेटीक्स पर आह प्रणाली की गतिविधि पर प्रदर्शन किया है.

लंबी श्रृंखला (36 सी 15-C) alkanes, Geoba से LADA जीन के रूपांतरण के लिएcillus thermodenitrificans लागू किया गया था. एंजाइम गतिविधि इन विट्रो में परीक्षण किया गया था लंबी श्रृंखला हाइड्रोकार्बन स्रोत के रूप में hexadecane का उपयोग. इस संशोधित ई. कोलाई तनाव नियंत्रण तनाव की तुलना में एक वृद्धि एंजाइम गतिविधि दिखाया, रीकॉम्बीनैंट LADA प्रोटीन प्रदर्शन ई. द्वारा hexadecane की रूपांतरण के लिए सक्षम बनाता है परिवर्तित alkanes की संपत्ति के अलावा alkanols, ई. कोलाई. कोलाई उपभेदों और alcohols aldehydes ADH और ALDH जीन क्रमशः कार्यान्वयन के लिए एक बेहतर प्रक्रिया गिरावट के साथ विकसित किए गए. सेल के अर्क में एंजाइम गतिविधि में इन विट्रो NAD + से NADH के उत्पादन को मापने के द्वारा परीक्षण किया गया था. ई. कोलाई तनाव ADH व्यक्त एक दो गुना शराब डिहाइड्रोजनेज गतिविधि में जंगली प्रकार गतिविधि की तुलना में वृद्धि देखी गई. नियंत्रण तनाव की तुलना में, ALDH प्रोटीन की अभिव्यक्ति ई. में dodecanal डिहाइड्रोजनेज गतिविधि बढ़ा कोलाई celमैं तीन गुना निकालता है. चूंकि ये स्पष्ट रूप से दिखा assays एंजाइम गतिविधि इन विट्रो में वृद्धि हुई है, यह अनुमान लगाया जा सकता है कि बदल ई. कोलाई उपभेदों के रूप में अच्छी तरह से vivo में गतिविधि का ऊंचा स्तर है.

मेजबान प्रेरित अभिव्यक्ति (उदाहरण के लिए: गैर शामिल रसायनों और विकास के दौरान कम बोझ पर निर्भरता) की संभावना का पता लगाने के लिए, गिरावट मार्ग pCaiF प्रमोटर के नियंत्रण में व्यक्त की गई थी. इस प्रमोटर जीन की अभिव्यक्ति सक्रिय जब ग्लूकोज का स्तर कम कर रहे हैं, जैसे. एक बैच विकास के चरण के अंत में. सिद्धांत का एक सबूत के रूप में, इस प्रमोटर अंतर शर्करा की सरकारों के अधीन GFP के उत्पादन के माध्यम से परीक्षण किया गया था. यह प्रदर्शन किया गया कि pCaiF GFP ई. तब्दील कोलाई घातीय चरण (उच्च ग्लूकोज का स्तर) की तुलना में स्थिर चरण (ग्लूकोज सीमित) के दौरान और अधिक GFP का उत्पादन किया. एक माध्यमिक कार्बन स्रोत की उपस्थिति में (जैसे lauric एसिड), GFP उत्पादन दर एजी की कमी हुईमाध्यमिक कार्बन स्रोत की अपचय के कारण ऐन.

प्रयोग से पता चला है कि इस प्रमोटर प्रभावी ढंग से करने के लिए नए गिरावट रास्ते को ग्लूकोज से catabolic बदलाव को सक्षम करने के लिए उपयोग किया जा सकता है. यह करने के लिए तेजी से अमीर मध्यम में जीवों की एक विशाल राशि बढ़ने से पहले गिरावट मार्ग सक्रिय होता है करने के लिए सक्षम बनाता है. हम pCaiF प्रमोटर नदी के ऊपर AlkS transcriptional नियामक का उपयोग करने का प्रस्ताव है. Pseudomonas putida, AlkS effectors के रूप में 5 10 C n-alkanes सी पहचानता है. बाद में उच्च स्तर AlkS - alkane जटिल PalkB alkBFGHJKL operon एन्कोडिंग n-alkanes 19 फैटी एसिड के लिए रूपांतरण में शामिल प्रोटीन की अभिव्यक्ति में जिसके परिणामस्वरूप प्रमोटर को सक्रिय करें.

सेंसिंग और हाइड्रोकार्बन के रूपांतरण के लिए सेल के लिए व्यवहार्य हो पर्याप्त नहीं है. वातावरण में बढ़ती हाइड्रोकार्बन स्तर पर, जंगली प्रकार ई. के विकास कोलाई पनबिजली की उपस्थिति के माध्यम से हिचकते हैझिल्ली और सेल में कार्बन, जो प्रोटीन misfolding पैदा कर सकता है. पी. horikoshii prefoldin alkanes 17 की उपस्थिति में प्रोटीन की सही तह सहायता निगरानी है. उसे उपयोग करना, यह भविष्यवाणी की थी कि इस प्रोटीन Homolog ई. के साथ सूचना का आदान प्रदान कोलाई निगरानी प्रोटीन, ई. में prefoldin की कि overexpression सुझाव कोलाई विलायक सहिष्णुता में सुधार कर सकते हैं. साथ BioBrick BBa_K398406 (phPFDα और phPFDβ जीनों से मिलकर), ई. के survivability alkanes की उपस्थिति में कोली को 50% करने के लिए सुधार किया गया था. उसे एक उपयुक्त उपकरण लिए संभावित कार्यात्मक homologs का चयन है.

एक पूरे के रूप में toolbox को ध्यान में रखते हुए, यह निष्कर्ष निकाला जा सकता है कि यह जलीय वातावरण में हाइड्रोकार्बन की bioremediation के लिए एक हवाई जहाज़ के पहिये के निर्माण में एक पहला कदम प्रदान कर सकते हैं. यह प्रतिनिधित्व करता है एक छोटे से, स्वायत्त, आत्म नकल और आरelatively सस्ती विधि. परिणाम मुख्य रूप से एंजाइम assays के माध्यम से हासिल किया गया और फ्लैश संस्कृतियों हिला और इस तरह एक बड़े पैमाने पर मान्य होना चाहिए. इसके अलावा, इस प्रणाली पर अनुसंधान विभिन्न एंजाइमों, जो यहाँ दिखाया गया है के लिए व्यक्तिगत रूप से काम करने में हाइड्रोकार्बन प्रणाली की गिरावट के लिए कल्पना उत्पन्न युग्मन पर ध्यान केंद्रित करना चाहिए. इसके अलावा, अन्य प्रदूषण की गिरावट के लिए वैकल्पिक मार्ग के अलावा के रूप में अच्छी तरह से हाइड्रोकार्बन की bioremediation परे इस हवाई जहाज़ के पहिये के उपयोग का विस्तार कर सकता अकेले प्रदूषण का एक व्यापक गुंजाइश है, और संभवतः उत्पाद रास्ते के कार्यान्वयन के उत्पादन के लिए इस प्रणाली का उपयोग कर सकते हैं मूल्यवान रसायनों. हमारे परिणाम सिंथेटिक जीव विज्ञान में BioBricks विधानसभा रणनीति की उपयुक्तता पर जोर नए जीवों कि तेल प्रदूषण के साथ सौदा कर सकते हैं और इसके अलावा अन्य अनुप्रयोगों की एक विस्तृत विविधता के विकास के लिए उपयोगी हो सकता है का निर्माण.

Disclosures

ब्याज की कोई संघर्ष की घोषणा की.

Acknowledgments

इस वीडियो लेख में प्रदर्शन प्रयोगों अंतरराष्ट्रीय आनुवंशिक रूप से इंजीनियर मशीन 9 प्रतियोगिता के लिए विकसित किए गए लेखकों iGEM टीम के सदस्यों के लिए ल्यूक Bergwerff, पीटर टीएम वैन Boheemen, Jelmer Cnossen, ह्यूगो एफ Cueto रोजास और Ramon वैन der Valk का शुक्रिया अदा करना चाहते हैं अनुसंधान में सहायता. हम उपयोगी विचार - विमर्श और इस शोध की मेजबानी के लिए हान डी winde, Stefan De Kok और Esengül Yildirim धन्यवाद. यह काम टीयू डेल्फ़्ट विश्वविद्यालय जैव प्रौद्योगिकी विभाग, डेल्फ़्ट बायोइनफॉरमैटिक्स प्रयोगशाला, टीयू डेल्फ़्ट Bionanoscience के विभाग, तेल रेत नेतृत्व पहल (OSLI), स्टड studentenuitzendbureau, नीदरलैंड जीनोमिक्स पहल, Kluyver केंद्र, Nederlandse Biotechnologische Vereniging (Stichting बायोटैक्नोलॉजी Nederland) द्वारा समर्थित किया गया , DSM, Geneart, Greiner जैव एक और Genencor.

Materials

Name Company Catalog Number Comments
E. coli K12 New England Biolabs C2523H
Octane Fluka 74822
Hexadecane Fluka 52209
octanol-1 Fluka 95446
dodecanol-1 Sigma-Aldrich 126799
Hexane Sigma-Aldrich 296090
NADH Sigma-Aldrich N4505
FMN Sigma-Aldrich F2253
MgSO4 J.T. Baker Casno 7487 889
Triton X-100 Sigma-Aldrich T8787
T4 ligase New England Biolabs M0202L
Gas chromatograph
Cell disrupter LA Biosystems CD-019
Spectrophotometer Amersham pharmacia spec 2000
Plate reader Tecan Group Ltd. Magellan v7.0
Incubator Innova, 44
BioBrickTM K398014: BBa_J23100-BBa_J61100-alkB2-BBa_J61100-rubA3-BBa_J61100-rubA4- BBa_J61100-rubB Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398014 Alkane Hydroxylase System
Resistance: Chloramphenicol
BioBrickTM K398027: BBa_R0040-BBa_B0034-ladA Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398027 ladA Protein Generator
Resistance: Chloramphenicol
BioBrickTM K398018: BBa_J23100-BBa_J61101-ADH Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398018 ADH generator
Resistance: Chloramphenicol
BioBrickTM K398030: BBa_R0040-BBa_B0034-ALDH Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398030 ALDH generator
Resistance: Chloramphenicol
BioBrickTM K398326: pCaiF Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398326 pCaiF promoter
Resistance: Chloramphenicol
BioBrickTM K398331: pCaiF-BBa_B0032-BBa_I13401 Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398331 pCaiF measurement device
Resistance: Chloramphenicol
BioBrickTM K398406: BBa_J23002-BBa_J61107-phPFDα-BBa_J61107- Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398406 Solvent tolerance cluster
Resistance: Chloramphenicol

DOWNLOAD MATERIALS LIST

References

  1. Allen, E. W. Process water treatment in Canada's oil sands industry: I: Target pollutants and treatment objectives. J. Environ. Eng. Sci. 7, 123-138 (2008).
  2. Alon, U. An Introduction to Systems Biology: Design Principles of Biological Circuits. CRC Press. (2007).
  3. Center, O. P. Understanding Oil Spills and Oil Spill Response. (1999).
  4. Cytoscape. An Open Source Platform for Complex Network Analysis and Visualization [Internet]. Available from: http://www.cytoscape.org (2012).
  5. Non-Invasive Biomass Monitor with Wide Linear Range [Internet]. Available from: http://www.buglab.com/docs/OnLineODMeasurement.pdf (2012).
  6. Eichler, K., Buchet, A., Lemke, R., Kleber, H. P., Mandrand-Berthelot, M. A. Identification and characterization of the caiF gene encoding a potential transcriptional activator of carnitine metabolism in Escherichia coli. J. Bacteriol. 178, 1248-1257 (1995).
  7. Feng, L., Wang, W., Cheng, J., Ren, Y., Zhao, G., Gao, C., Tang, Y., Liu, X., Han, W., Peng, X., et al. Genome and proteome of long-chain alkane degrading Geobacillus thermodenitrificans NG80-2 isolated from a deep-subsurface oil reservoir. Proc. Natl. Acad. Sci. U.S.A. 104, (13), 5602-5607 (2007).
  8. Fujii, T., Narikawa, T., Takeda, K., Kato, J. Biotransformation of various alkanes using the Escherichia coli expressing an alkane hydroxylase system from Gordonia sp. TF6. Biosci. Biotechnol. Biochem. 68, (10), 2171-2177 (2004).
  9. iGEM. Registry of Standard Biological Parts [Internet]. Available from: http://partsregistry.org/Main_Page (2012).
  10. Kato, T., Miyanaga, A., Haruki, M., Imanaka, T., Morikawa, M., Gene Kanaya, S. cloning of an alcohol dehydrogenase from thermophilic alkane-degrading Bacillus thermoleovorans B23. J. Biosci. Bioeng. 91, (1), 100-102 (2001).
  11. Kato, T., Miyanaga, A., Kanaya, S., Morikawa, M. Gene cloning and characterization of an aldehyde dehydrogenase from long-chain alkane-degrading Geobacillus thermoleovorans B23. Extremophiles. 14, 33-39 (2010).
  12. Kieboom, J., De Bont, J. aM. Bacterial Stress Responses. ASM Press. Washington, D.C. (2000).
  13. Kotte, O., Zaugg, J. B., Heinemann, M. Bacterial adaptation through distributed sensing of metabolic fluxes. Mol Syst Biol. 6, 355 (2010).
  14. Kremling, A., Bettenbrock, K., Gilles, E. D. Analysis of global control of Escherichia coli carbohydrate uptake. BMC Syst. Biol. 1, (2007).
  15. Li, L., Liu, X., Yang, W., Xu, F., Wang, W., Feng, L., Bartlam, M., Wang, L., Rao, Z. Crystal structure of long-chain alkane monooxygenase (LadA) in complex with coenzyme FMN: unveiling the long-chain alkane hydroxylase. J. Mol. Biol. 376, (2), 453-465 (2008).
  16. Lin, H. Y., Mathiszik, B., Xu, B., Enfors, S. O., Neubauer, P. Determination of the maximum specific uptake capacities for glucose and oxygen in glucose-limited fed-batch cultivations of Escherichia coli. Biotechnol. Bioeng. 73, (5), 347-357 (2001).
  17. Okochi, M., Kanie, K., Kurimoto, M., Yohda, M., Honda, H. Overexpression of prefoldin from the hyperthermophilic archaeum Pyrococcus horikoshii OT3 endowed Escherichia coli with organic solvent tolerance. Appl. Microbiol. Biotechnol. 79, (3), 443-449 (2008).
  18. Rehm, H. J., Reiff, I. Mechanisms and occurrence of microbial oxidation of long-chain alkanes. Adv. Biochem. Eng. / Biotechnol. 19, 175-215 (1981).
  19. Rojo, F. Degradation of alkanes by bacteria. Environ. Microbiol. 11, (10), 2477-2490 (2009).
  20. STRING 9.0 Known and Predicted Protein-Protein Interactions [Internet]. Available from: http://string-db.org/newstring_cgi/show_download_page.pl (2012).
  21. Van Beilen, J. B., Panke, S., Lucchini, S., Franchini, A. G., Rothlisberger, M., Witholt, B. Analysis of Pseudomonas putida alkane-degradation gene clusters and flanking insertion sequences: evolution and regulation of the alk genes. Microbiology. 147, 1621-1630 (2001).
  22. Wang, L., Tang, Y., Wang, S., Liu, R. L., Liu, M. Z., Zhang, Y., Liang, F. L., Feng, L. Isolation and characterization of a novel thermophilic Bacillus strain degrading long-chain n-alkanes. Extremophiles. 10, (4), 347-356 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics