Toolkit כדי לאפשר גיור פחמימן בסביבות מימיות

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

אוטומטי קיימא ויסות מערכת חיידקים לטיפול של זיהומי נפט תוכנן באמצעות חלקי DNA החלפה סטנדרטיים (BioBricks). מהונדס

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Brinkman, E. K., Schipper, K., Bongaerts, N., Voges, M. J., Abate, A., Wahl, S. A. A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments. J. Vis. Exp. (68), e4182, doi:10.3791/4182 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

עבודה זו מעבירה קדימה ערכת כלים המאפשרת את ההמרה של אלקאנים ידי חיידקי Escherichia ומציג הוכחה לעיקרון תחולתו. ערכת הכלים מורכבים ממספר חלקים סטנדרטיים להחלפה (BioBricks) 9 העוסקים בהמרות של אלקאנים, הוויסות של ביטוי גנים וההישרדות בסביבה רעילה פחמימנים עשירות.

מסלול בן שלושת שלבים לפירוק alkane יושם בE. coli כדי לאפשר המרה של טווח הבינוניים וארוך שרשרת אלקאנים לalkanols בהתאמה, alkanals וחומצות alkanoic-סופו של דבר. האחרון היו מפורק דרך מסלול יליד β-חמצון. כדי להקל את החמצון של אלקאנים בינוני שרשרת (C5-C13) וcycloalkanes (C5-C8), ארבעה גנים (alkB2, rubA3, rubA4 וrubB) של מערכת hydroxylase alkane מגורדוניה SP. TF6 8,21 נהפכו E. coli. להמרה שלאלקאנים ארוכי שרשרת (C15-C36), גן LADA מthermodenitrificans Geobacillus יושמו. לצעדים הנוספים הנדרשים בתהליך ההידרדרות, ADH וALDH (שמקורם thermodenitrificans ג') הוכנסו 10,11. הפעילות נמדדה על ידי מבחני תא מנוחה. לכל שלב חמצונים, פעילות אנזים נצפתה.

כדי לייעל את יעילות התהליך, הביטוי היה מושרה רק בתנאי הגלוקוז נמוכים: אמרגן מצע מוסדר, pCaiF, היה בשימוש. pCaiF נוכח בE. coli K12 ומסדיר את הביטוי של הגנים הקשורים בפירוק של מקורות הפחם שאינה גלוקוז.

חלקיו האחרונים של ערכת הכלים - מיקוד הישרדות - יושם באמצעות גני ממס סובלנות, PhPFDα וβ, שני מ furiosus horikoshii הארכת זמן 3. ממסים אורגניים יכולים לגרום למתח תא וירידה בשרידות על ידי שלילי affectinקיפול חלבונים גרם. כמלווים, PhPFDα וβ לשפר את התהליך למשל החלבון מתקפל תחת הנוכחות של אלקאנים. הביטוי של גנים אלה הובילו לסובלנות פחמימנים משופרות שמוצגת על ידי עלייה בשיעור צמיחה (עד 50%) בנוכחות של 10% n-הקסאן במדיום התרבות נצפה.

בסיכום, התוצאות מצביעות על כך שארגז הכלים מאפשר E. coli כדי להמיר ולסבול פחמימנים בסביבות מימיות. ככזה, הוא מהווה צעד ראשון לקראת פתרון בר קיימא ל- משיקום שמן בעזרת גישת ביולוגיה סינטתית.

Protocol

1. BioBrick עצרת

  1. BioBricks מהרישום של חלקים ביולוגיים סטנדרטיים מסופקים על ידי מטה iGEM. לבנות BioBrick חדש מBioBricks הקיים, לעכל את תורם BioBrick (עד 1.0 מיקרוגרם) עם אנזימי EcoRI וSpeI למיצוב במורד החלק התורם של חלק acceptor. תקציר עם XbaI וPstI למיצוב חלק התורם במעלה הזרם של חלק acceptor. הוסף אנזים הגבלה מתאימה 3 שחותך בעמוד השדרה של התורם. בצע את digestions בהיקף כולל של 20-25 מ"ל עם החיץ המתאים, על פי הספק (ריכוז סופי 1x). השתמש / 5 יחידות DNA מיקרוגרם לאנזימי ההגבלה.
  2. לעכל BioBrick acceptor עם או EcoRI וXbaI או SpeI וPstI.
  3. דגירת digestions ל( לפחות) אחד בשעה 37 ° C. לנטרל את הגבלת endonucleases על ידי חום, דגירה על 80 מעלות צלזיוס למשך 10 דקות וצנטריפוגה זמן קצר.
  4. לקשור BioBrick מתעכלחלקים (תורם וacceptor) יחד. מאז XbaI וSpeI לייצר קצות DNA תואמים, אתר מעורב נוצר שלא ניתן לחתוך בכל אנזים הגבלה וכתוצאה מBioBrick חדש והמאוחדת "שניצב בין 4 אתרי ההגבלה הסטנדרטי. בתערובת קשירת ריכוז הדנ"א הסופי הוא עדיף ~ 100 ng / μl. בצע את תגובת הקשירה בהיקף כולל של 10-15 מ"ל עם חיץ T4 קשירה (ריכוז סופי 1x) וligase T4 (יחידת דנ"א 1 / מיקרוגרם).
  5. דגירה את תערובת הקשירה ב 16 מעלות צלזיוס במשך לפחות 3 שעות.
  6. לבצע שינוי תגובה עם חצי בערך מתמהיל הקשירה.
  7. אשר BioBrick להיות נכון עם הסידור.
  8. לבנות BioBrick חדש מ-DNA המסונתז, לשנות את הגנים לסינתזה לביטוי אופטימלי בE. coli באמצעות כלי האתר JCat (http://www.jcat.de/). לבצע שינויים נוספים בהתאם לדרישות של B ioBrick סטנדרטי. סטנדרטיזציה זה מרמז שכל BioBrick מורכב מרצף ה-DNA של עניין קדם קידומת ואחריו סיומת. הקידומת והסיומת הם רצפים המכילים אתרי הגבלה מוגדרים מראש, שנעדרו ברצף פלסמיד שנותר. אתרי הגבלה סטנדרטיות אלו מאפשרים להחליף ולהרחיב מחדירה BioBrick גמישות 9. הקידומת והסיומת יש את הרצפים הבאים:
שם רצף הערה
קידומת 5 'GAATTCGCGGCCGCTTCTAG3'
5 'GAATTCGCGGCCGCTTCTAGAG 3' אם החלק הבא הוא רצף קידוד או כל חלק שמתחיל עם "ATG"
סיומת 5 'TACTAGTAGCGGCCGCTGCAG 3'
ove_title "> 2. Assay Alkane מרת מנוחת תא, In Vivo

בדיקה זו מתבצעת על בסיס השיטה שתוארה על ידי פוג'י et al. (2004).

  1. תרבות ה תאי coli המבטאים את מערכת Alkane hydroxylase (BBa_K398014) ותאי נשיאת וקטור ריק (BBa_J13002) במדיום 5 מ"ל LB עם אנטיביוטיקה מתאימה בן הלילה.
  2. העברת 500 μl של תרבות הלילה ל50 מ"ל של LB הטרי (עם אנטיביוטיקה) ולדגור עד עכירות התא הגיעה OD (צפיפות אופטית) של 0.3 ב 600 ננומטר.
  3. צנטריפוגה למשך 10 דקות ב4000 סל"ד ו resuspend גלול ב 5 מיליליטר חיץ 0.1 מ 'פוספט (pH 7.4).
  4. צנטריפוגה שוב למשך 10 דקות ב4000 סל"ד ו resuspend גלול ב 5 מיליליטר חיץ 0.1 מ 'פוספט המכיל מלחים עכשיו E2 ו0.66% גליצרול v / v (החנקן deficienלא בינוני).
  5. מדוד את עכירות התא (OD 600).
  6. הכן aliquots תא תערובת של 6 מ"ל ב25 מיליליטר צלוחיות סגור כובע זכוכית ובקרות לא תאים (מלחים E2 + 0.66% גליצרול v / v).
  7. הוסף 100 nmol של alkane לכל בקבוק.
  8. דגירת התערובות על 37 מעלות צלזיוס למשך 24 שעות (לקצר כאשר שיעורים גבוהים יותר מתקבלים).
  9. מדוד את OD 600 לאחר דגירה.
  10. חלץ את פחמימנים בתקשורת התרבות של אתיל יצטט ולקבוע ריכוז פחמימנים בתרבית תאים על ידי גז כרומטוגרפיה (ראה פרוטוקול 3).
  11. חישוב השפלה ליחידה של ביומסה על ידי חלוקת הסכום הכולל של alkane מומר על ידי נוכחים ביומסה הסך הכילו בכל בקבוק (OD להמיר 600 למשקל יבש). חלוקת התוצאה בתקופת הניסוי מניבה פעילות ההשפלה לביומסה יחידה ליחידת זמן. הממוצע נלקח מתוך שלוש ריצות בודדות.

3. Assay Alkane המרת אנזים, במבחנה

בדיקה זו בוצעה למעשה על פי השיטה שתוארה על ידי לי אח'. (2008).

  1. תרבות ה תאי coli מבטאים LADA הגן (BBa_K398017 ותאים שנשאו וקטור ריק () BBa_J13002) במדיום LB מ"ל 50 עם טיפול אנטיביוטי מתאים. הלילה
  2. העברת 500 μl של תרבות הלילה ל50 מ"ל של LB הטרי (עם אנטיביוטיקה) ולדגור עד עכירות התא הגיעה צפיפות אופטית של 0.6 ב 600 ננומטר.
  3. צנטריפוגה 10 דקות ב 4000 סל"ד (4 ° C) וresuspend גלול ב 5 מ"ל של חיץ 50 mM טריס.
  4. Sonicate (תא המשבש, לוס אנג'לס Biosystems) את התאים ב40% מחזור פעולה עם שליטת תפוקה של 4, לשמור את הפתרון על קרח לכל התקופה.
  5. צנטריפוגה את התערובת וכתוצאה למשך 5 דקות ב4000 סל"ד ב 4 & דלדוגמה: C כדי להסיר את הפסולת של התאים. העברת supernatant לבקבוקון טרי.
  6. לקבוע את ריכוז החלבון הכולל של התמציות הסלולריות על ידי assay ברדפורד. הערה: השתמש בבקבוקוני זכוכית כדי למנוע עלייה של רקע ו ​​/ או אובדן של חלבון.
  7. הכן תערובת המכילה 100 מ"ל 0.1% v / v alkane וחיץ 50 מ"מימ טריס-HCl.
  8. מחמם את התערובת ב 100 מעלות צלזיוס למשך 5 דקות. שימו לב: בצע צעד זה רק לאלקאנים שרשרת בינוני ארוכים עם נקודת רתיחה גבוהה. (לדוגמה: C 16: 287 מעלות צלזיוס).
  9. כדי להשיג מסיסות אופטימלית של alkane, sonicate ל1 דקות ועדיין חם עד לקבלת תערובת הומוגנית, צמיג מתקבלת.
  10. הוסף 1mm של NADH, 1 המ"מ FMN, 1 4 המ"מ MgSO ו0.01 V / v טריטון X-100.
  11. הכן 6 aliquots מ"ל ב 25 מיליליטר צלוחיות של פקקים סגורים.
  12. הוסף כמות מספקת של תמצית תאים (תלוי במבחנים ברדפורד, ריכוז סופי של 5 מ"ג חלבון / ליטר). הכן את שליטה ללא חלבון.
  13. לדגור על 60 ° C (לדואר אופטימליnzymatic פעילות) עבור 24 שעות.
  14. חלץ את פחמימנים בתקשורת התרבות של אתיל יצטט ולקבוע ריכוז פחמימנים בתרבית תאים על ידי גז כרומטוגרפיה (ראה פרוטוקול 3).
  15. חישוב השפלה ליחידה של ביומסה על ידי חלוקת הסכום הכולל של alkane מומר על ידי חלבון מוסף לכל בקבוק (על ידי עקומת כיול ברדפורד). נוספת על ידי חלוקת משך ניסוי מניבה פעילות השפלה ליחידת חלבון תאי ליחידת זמן. הממוצע נלקח מתוך שלוש ריצות בודדות.

4. הפקת אתיל יצטט פחמימנים מדידות ריכוז

  1. אלקאנים מופקים מהתמיסה המימית על ידי הוספה יצטט אתיל מ"ל 2.5 (solvant apolar) לפתרון ניסיוני 6 מ"ל. תקן פנימי נוסף לממס בריכוז של 0.1% (נ / ה). סטנדרטי (למשל סקל-decan) מגוון בהתאם הטווח הצפוי של הפסגות של עניין.
  2. אופציונלי: הוסף טריטוןX-100 לתערובת המימית וחובצה את הדגימות למשך 10 דקות ב4000 סל"ד כדי לקבל מערכת ראויה דו phasic.
  3. מערבולת את התערובת במשך 5 שניות (1,500 סל"ד) ו דגירה בטמפרטורת חדר עד שני השלבים נפרדים.
  4. הסר סכום מקסימאלי של השכבה האורגנית (למעלה) וייבש את הממס באמצעות מגנזיום סולפט נטול מים.
  5. הסר MgSO 4 על ידי סינון (0.2 מיקרומטר) ולהעביר את התסנין לבקבוקוני גז כרומטוגרף למדידות, או בחנות ב -20 ° C.
  6. לקבוע את הריכוז על ידי גז כרומטוגרפיה באמצעות עמודת 5CB CP-SIL (= אורך 5 מ '). הזרק 10 μl של מדגם במצב פיצול (1:10, 230 מעלות צלזיוס). הגדר את זרימת הגז לעמודת 1 מ"ל / דקה (הליום). תכנית טמפרטורת התנור הבאה משמשת:
    קצב טמפרטורה [° C] זמן [דקות]
    0 50 7.5
    50 90 1.0
    50 110 2.0
    50 130 2.0
    50 145 2.0
    50 160 2.0
    50 170 2.0
    50 185 2.0
    50 210 2.0
    50 250 2.0
    50 320 2.0
  7. שלב את הפסגות ולתקן את הריכוזים ביחס לסטנדרט הפנימי.

5. אלכוהול / Assay הפעילות dehydrogenase אלדהיד

בדיקה זו בוצעה למעשה על פי השיטה שתוארה על ידי קאטו et al.(2010).

  1. תרבות ה תאי coli מבטאים ADH (BBa_K398018) או ALDH (BBa_K398030 גן) ותאים שנשאו וקטור ריק (BBa_J13002) במדיום LB מ"ל 50 עם אנטיביוטיקת הלילה מתאימה.
  2. העברת 500 μl של תרבות הלילה ל50 מ"ל של LB הטרי (עם אנטיביוטיקה) ולדגור עד עכירות התא הגיעה צפיפות אופטית של 0.6 ב 600 ננומטר.
  3. צנטריפוגה 10 דקות ב 4000 סל"ד ב 4 ° C וresuspend גלול ב 5 מ"ל של חיץ 50 mM טריס.
  4. Sonicate פתרון התא ב 40% מחזור פעולה עם שליטת תפוקה של 4 (לשמור על הפתרון בקרח במהלך sonication).
  5. צנטריפוגה את התערובת וכתוצאה למשך 5 דקות ב4000 סל"ד ב 4 ° C כדי להסיר שאריות של תאים.
  6. קבע לריכוז חלבון טל של תמציות תא על ידי ברדפורד assay (הערה: להשתמש בבקבוקון זכוכית כדי למנוע חלבון מחייב).
  7. טען צלחת גם 96 עם 180 μl 57 מ"מ גליצין החיץ המכיל NAD (ריכוז סופי 1 מ"מ, pH 9.5) בכל אחד גם.
  8. הוסף 5 μl של האלכוהול (אלדהיד) להיבדק לבארות. הערה: כהלי חום שרשרת ארוכים לפני תחילת הבדיקה יש לנוזל. עבור כל אלכוהול (אלדהיד) שליטה ללא מצע יש להוסיף (שליטה שלילית). בנוסף, להכין ריק המכיל תערובת של חיץ והמצע בלי תמצית תא.
  9. מחממי צלחת צלחת הקורא (טקאן מגלה v7.0) במשך 15 דקות ב 37 ° C על מנת לאפשר איזון של המערכת.
  10. הוסף כמות מספקת של תמצית תאים (תלוי במבחנים ברדפורד, ריכוז סופי של 5 מ"ג חלבון / ליטר). הכן את שליטה ללא חלבון.
  11. מדוד את ייצור NADH באמצעות ספקטרופוטומטר באורך גל של 340 ננומטר כל 2-3 דקות במשך שעות 1 ב 37 ° C. </ Li>
  12. לחשב את קצב ייצור NADH משיפוע OD (340 ננומטר). קח בחשבון את אורך נתיב האור ומקדם ההכחדה של NADH של 6220 -1 סנטימטר M -1. מחלק את קצב ייצור NADH על ידי הסכום הכולל של חלבון הוסיף להביע את הפעילות של תגובת דהידרוגנז בתמצית התא (חלבוני תא שלמים U / מ"ג). חשבתי את הממוצע וסטיית התקן משלוש ריצות עצמאיות.

6. אפיון pCaiF

  1. תרבות ה תאי coli מבטאים pCaiF-GFP המבנה (BBa_K398331 ותאים שנשאו את האמרגן לבד () BBa_K398326) בלילה במדיום LB מ"ל 5 לילה את האנטיביוטיקה המתאימה.
  2. לחסן 5 המ"ל M9 המכיל גלוקוז 10 גרם / ליטר ואנטיביוטיקה עם 50 μl של תרבות הלילה ולגדול בין הלילה. 50 μl תת של תולדת הלילה ל5 מ"ל של M9 טרי with10 ג'/ ליטר ולדגור עד עכירות התא הגיע צפיפות אופטית של 0.2 ב 600 ננומטר.
  3. טען צלחת גם 96 עם 100 μl של מדיום M9 טרי המכיל את הכמות הרצויה של מקור פחמן לבדיקה בכל אחד גם. לבצע ניסויי שלושה עותקים להערכות סטטיסטיות ולהוסיף בקרות השליליות בהתאמה (E. coli פראי מסוג K12).
  4. הוסף 5 μl של תרבות הלילה לבארות המכילות הבינוניות.
  5. מדוד את עקומת הגדילה (OD 600) וGFP פלואורסצנטי (485 ננומטר עירור ופליטה 520) באמצעות קורא צלחת כל 10 דקות במשך 18 שעות ב 37 ° C עם רעד בגוף קבוע.
  6. לחשב את שיעור הצמיחה ואת התוכן הספציפי GFP מהמידות המתאימות והשווה לשליטה. חשבתי את הממוצע וסטיית ההתקן של לפחות שלושה ניסויים עצמאיים.

7. Assay סובלנות

  1. תרבותחיידק מבטא גן PhPFDα וβ (BBa_K398406) בלילה במדיום 5 מ"ל LB והאנטיביוטיקה המתאימה. א coli מבטא LADA גן (BBa_K398017) משמש כבקרה שלילית.
  2. 10 μl תת של תולדת הלילה ל5 מ"ל הטרי של LB (עם אנטיביוטיקה) ולדגור עד עכירות התא הגיע צפיפות אופטית של 0.3-0.4 ב 600 ננומטר.
  3. לדלל את התרבויות עם מדיום טרי עד 600 OD של 0.1 הוא הגיע.
  4. טען צלחת גם 96 עם מדיום M9 μl 180 המכיל את האנטיביוטיקה המתאימה ואת הריכוז הסופי התקין של המתחם רעיל (למשל 0, 4, 8, 10% של n-הקסאן) בשלושה עותקים. משום תערובות alkane-מים עלולות להוביל למערכות שני שלבים הוא הכרחי יש בקרה נאותה על הצלחת (למשל דזני ifferent והניסויים הריקים בהתאמה).
  5. הוסף 20 μl של התרבות (שליטה) לבארות.
  6. למדוד את הריכוז ביומסה (OD 600) באמצעות קורא צלחת כל 10 דקות במשך 24 שעות ב 37 ° C עם רעד בגוף קבוע.
  7. לחשב את שיעורי הצמיחה ממידות בהתאמה לריכוזי הסוכן השונים ולהשוות לשליטה השלילית. חשבתי את הממוצע וסטיית התקן של לפחות שלוש ריצות עצמאיות.

8. מיפוי אינטראקצית homolog

  1. בקשתו הייתה שפותחה כדי לבצע שאילתות בחלבון בשרת מסד נתוני PostgreSQL פועל STRING (חינם לשימוש אקדמי) 20. יישום מיפוי אינטראקצית homologue מזהה חלבונים באינטראקציה באורגניזם המארח המקורי באמצעות מסד נתוני STRING. הרצפים של גני אינטראקצית בהתאמה משמשים בחיפוש יפציץ למצוא הומולוגי גנים באורגניזם היעד. Cytoscape 4 https://github.com/jcnossen/InteractionHomologMapping.
  2. כדי לבצע מיפוי, (1) להזין את זיהוי BioBrick והיישום באופן אוטומטי להוריד את נתוני רצף חלק מהרישום של חלקים סטנדרטיים ביולוגיים 9, או (2) להיכנס (דבק) את נתוני הרצף ביישום.
  3. השתמש באתר האינטרנט של מאגר STRING כדי למצוא את זהות חלבון STRING לרצף החומצות האמיניות שהוזן.
  4. חלבון עם הומולוגיה גבוהה נקבע באמצעות פיצוץ. בהמשך היישום מפרט כל חלבון אינטראקציה ידועה באורגניזם המקור ומחפש homologs באורגניזם המארח (חיידק E. למשל).
  5. יצוא רשימת אינטראקציה משוערת תוצאה לטקסט או Cytoscape.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

עיקרון BioBrick משמש לבניית מארז להשפלה של אלקאנים והוכחת עיקרון של הרכיבים הבודדים של ערכת הכלים הושגה. כמה מבחנים מוצעים למדידת in vivo ו במבחנת פעילות של אנזימי מסלול משפיל alkane. העבודה הוצגה מדגימה מספר השיטות שיכולים לשמש כדי לקבוע פעילויות וביטוי אנזים באורגניזם המארח E. בהצלחה coli לאחר יישום BioBricks המתאים. יתר על כן, הוא הראה כי עיקרון BioBrick יכול לשמש כדי לתכנן האורגניזם שמבטא חלבונים דרושים לפירוק של אלקאנים, מספק מערכת רגולציה שמייצרת אנזימים אלה רק בעת צורך ומגביר את עמידותו של האורגניזם המארח בנוכחות פחמימנים . לאחר פיתוח נוסף, המארז הזה יכול לשמש לפירוק הביולוגי של מזוט, למשל בחולות נפט עיקוב מים, או לטיפולשפכים מתעשיית הנפט.

בכל קשור לפירוק alkane, מבחנים שבוצעו לאפיון של האנזימים המעורבים בשלב הראשון של שפלת alkane (AH-המערכת ואדה). הוא הוכיח כי א coli להתאמץ ביצוע AH-המערכת של גורדוניה SP. TF6 היה מסוגלת להמיר יוקטן in vivo. ממצא זה הוא בהסכם עם התוצאות של פוג'י et. אל. 8, בי biotransformation של n-אלקאנים באמצעות E. coli המבטא את הגנים המרכיבים המינימאליים של AH-המערכת הושג. פעילות ההמרה נמדדה על ידי מחקר השוואתי (wildtype לעומת מוטציה) לאחר זמן נתון. לאפיון מלא, מחקרים נוספים צריכות להתבצע על הפעילות של AH-המערכת לאורך זמן וקינטיקה של המערכת.

להמרה של אלקאנים ארוכי שרשרת (C 15-C 36), גני LADA מGeobathermodenitrificans cillus יושם. פעילות האנזים נבדקה במבחנה באמצעות hexadecane כמקור פחמימנים ארוך שרשרת. זה שונה E. זן חיידק הראה פעילות אנזים מוגברת בהשוואה לזן השליטה, מפגין את חלבון רקומביננטי LADA מאפשר המרה של hexadecane ידי א coli. בנוסף למאפיין של אלקאנים המרה לalkanols, א ' זני coli פותחו עם תהליך השפלה משופרת לכהלים ואלדהידים על ידי היישום של גני ALDH ADH ובהתאמה. פעילות האנזים בתאי תמציות נבחנה במבחנה על ידי מדידת ייצור NADH מNAD +. ה זן חיידק מבטא ADH הראה עלייה כפולה בפעילות דהידרוגנז אלכוהול בהשוואה לפעילות מהסוג הברה. בהשוואה לזן השליטה, הביטוי של חלבון ALDH גדל פעילות דהידרוגנז dodecanal בE. cel coliאני שולף שלוש. מאז מבחנים אלה עולים בבירור גדלו פעילות אנזים במבחנה, ניתן העריך כי ה הפכה זני coli יש רמות גבוהות של פעילות in vivo גם כן.

כדי לבחון את האפשרות של ביטוי מארח מושרה (למשל: אי - תלות בכימיקלי אינדוקציה ומעמסה נמוכה במהלך צמיחה), מסלול השפלה בא לידי הביטוי בשליטה של ​​אמרגן pCaiF. אמרגן זה מפעיל ביטוי גנים, כאשר הרמות הגלוקוז הן נמוכים, למשל. בסוף שלב צמיחה יצווה. כהוכחה של עיקרון, האמרגן הזה נבדק דרך הייצור של ה-GFP תחת משטרי הגלוקוז הבדל. הוא הוכיח כי pCaiF-GFP הפך E. coli פיק יותר GFP בשלב נייח (גלוקוז המוגבל) מאשר בשלב המעריכים (רמות סוכר גבוהים). בנוכחותו של מקור פחמן משני (למשל. חומצת lauric), קצב הפקת ירד GFP AGעין עקב קטבוליזם של פחמן מקור משני.

הניסוי הראה כי האמרגן הזה ניתן להשתמש ביעילות כדי לאפשר משמרות קטבולים מגלוקוז למסלולים שפלים חדשים. זה מאפשר לגדול במהירות כמות עצומה של יצורים במדיום עשיר לפני מסלול ההתדרדרות מופעל. אנו מציעים להשתמש pCaiF אמרגן זרם רגולטור תעתיק AlkS. בPseudomonas putida, AlkS מכיר C 10 5-C-n אלקאנים כמפעילים. כתוצאה מכך רמות גבוהות של קומפלקס AlkS-alkane להפעיל את אמרגן PalkB כתוצאה מהביטוי של חלבוני קידוד אופרון alkBFGHJKL המעורב בהמרה של n-אלקאנים לחומצות שומן 19.

החישה וההמרה של פחמימנים לא מספיק לתא כדי להיות בת קיימא. ברמות פחמימנים גוברים בסביבה, את הצמיחה של הסוג א 'הפראי coli מעוכב באמצעות הנוכחות של הידרוהפחמנים בקרום ובתאים, אשר יכול לגרום misfolding חלבון. P. horikoshii prefoldin הוא מלווה סיוע לקיפול הנכון של חלבון בנוכחות של 17 אלקאנים. משתמש בו, זה היה צפוי שזה חלבון אינטראקציה עם homolog E. חלבוני מלווה coli, והציע שביטוי יתר של prefoldin בE. חיידק יכול לשפר את סובלנות ממס. עם BioBrick BBa_K398406 (מורכב של הגנים וphPFDα phPFDβ), שרידות של E. coli בנוכחות אלקאנים היה שיפור של עד 50%. לו הוא כלי מתאים כדי לבחור homologs הפונקציונלי פוטנציאלי.

בהתחשב בארגז הכלים בכללותו, ניתן להסיק שהיא מספקת צעד ראשון בבניית שלדה לbioremediation של פחמימנים בסביבה מימית. זה מייצג קטן ואוטונומי, המשכפל את עוצמה וrelatively שיטה זולה. התוצאות נרכשו בעיקר באמצעות מבחני אנזים ולנער תרבויות בזק וכך צריך להיות מאומתים בקנה מידה גדול יותר. מחקר נוסף על מערכת זו צריך להתמקד בצימוד של אנזימים השונים, אשר הוכחו כאן כדי לעבוד באופן פרטני על מנת ליצור המערכת שחזתה לפירוק פחמימנים. יתר על כן, בנוסף למסלולים חלופיים לפירוק של מזהמים אחרים יכול גם להרחיב את השימוש במארז זה מעבר bioremediation של פחמימנים לבד להיקף רחב יותר של מזהמים, ואולי היישום של מסלולי מוצר אפילו יכול לנצל את המערכת לייצור כימיקלים יקרים ערך. התוצאות שלנו מדגישות את התאמת אסטרטגית הרכבת BioBricks בביולוגיה סינטתית לבניית אורגניזמים חדשים שיכול להתמודד עם זיהום נפט, ובנוסף עשוי להיות שימושיים לפיתוח המגוון רחב של יישומים אחרים.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

אין ניגודי האינטרסים הכריזו.

Acknowledgments

הניסויים שבוצעו בוידאו מאמר זה פותחו לתחרות המהונדסת גנטי המכונית הבינלאומית 9. המחברים מבקשים להודות לחברי צוות iGEM לוק Bergwerff, פיטר ואן TM Boheemen, Jelmer Cnossen, הוגו פ Cueto רוחאס ורמון ואן דר וולק ל הסיוע במחקר. אנו מודים האן דה Winde, סטפן דה קוק וEsengül ילדרים לדיונים מועילים ואירוח מחקר זה. עבודה זו נתמכה על ידי TU Delft אוניברסיטת המחלקה לביוטכנולוגיה, ביואינפורמטיקה דלפט המעבדה, TU Delft מחלקת Bionanoscience, שמן חולות מנהיגות היוזמה (OSLI), Stud studentenuitzendbureau, יוזמת ג'נומיקס הולנד, Kluyver המרכז, Nederlandse Biotechnologische Vereniging (Stichting ביוטכנולוגיה Nederland) , ה-DSM, Geneart, גריינר ביו האחד וGenencor.

Materials

Name Company Catalog Number Comments
E. coli K12 New England Biolabs C2523H
Octane Fluka 74822
Hexadecane Fluka 52209
octanol-1 Fluka 95446
dodecanol-1 Sigma-Aldrich 126799
Hexane Sigma-Aldrich 296090
NADH Sigma-Aldrich N4505
FMN Sigma-Aldrich F2253
MgSO4 J.T. Baker Casno 7487 889
Triton X-100 Sigma-Aldrich T8787
T4 ligase New England Biolabs M0202L
Gas chromatograph
Cell disrupter LA Biosystems CD-019
Spectrophotometer Amersham pharmacia spec 2000
Plate reader Tecan Group Ltd. Magellan v7.0
Incubator Innova, 44
BioBrickTM K398014: BBa_J23100-BBa_J61100-alkB2-BBa_J61100-rubA3-BBa_J61100-rubA4- BBa_J61100-rubB Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398014 Alkane Hydroxylase System
Resistance: Chloramphenicol
BioBrickTM K398027: BBa_R0040-BBa_B0034-ladA Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398027 ladA Protein Generator
Resistance: Chloramphenicol
BioBrickTM K398018: BBa_J23100-BBa_J61101-ADH Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398018 ADH generator
Resistance: Chloramphenicol
BioBrickTM K398030: BBa_R0040-BBa_B0034-ALDH Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398030 ALDH generator
Resistance: Chloramphenicol
BioBrickTM K398326: pCaiF Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398326 pCaiF promoter
Resistance: Chloramphenicol
BioBrickTM K398331: pCaiF-BBa_B0032-BBa_I13401 Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398331 pCaiF measurement device
Resistance: Chloramphenicol
BioBrickTM K398406: BBa_J23002-BBa_J61107-phPFDα-BBa_J61107- Delft University of Technology at the department of Biotechnology or Registry of Standard Biological Parts BBa_K398406 Solvent tolerance cluster
Resistance: Chloramphenicol

DOWNLOAD MATERIALS LIST

References

  1. Allen, E. W. Process water treatment in Canada's oil sands industry: I: Target pollutants and treatment objectives. J. Environ. Eng. Sci. 7, 123-138 (2008).
  2. Alon, U. An Introduction to Systems Biology: Design Principles of Biological Circuits. CRC Press. (2007).
  3. Center, O. P. Understanding Oil Spills and Oil Spill Response. (1999).
  4. Cytoscape. An Open Source Platform for Complex Network Analysis and Visualization [Internet]. Available from: http://www.cytoscape.org (2012).
  5. Non-Invasive Biomass Monitor with Wide Linear Range [Internet]. Available from: http://www.buglab.com/docs/OnLineODMeasurement.pdf (2012).
  6. Eichler, K., Buchet, A., Lemke, R., Kleber, H. P., Mandrand-Berthelot, M. A. Identification and characterization of the caiF gene encoding a potential transcriptional activator of carnitine metabolism in Escherichia coli. J. Bacteriol. 178, 1248-1257 (1995).
  7. Feng, L., Wang, W., Cheng, J., Ren, Y., Zhao, G., Gao, C., Tang, Y., Liu, X., Han, W., Peng, X., et al. Genome and proteome of long-chain alkane degrading Geobacillus thermodenitrificans NG80-2 isolated from a deep-subsurface oil reservoir. Proc. Natl. Acad. Sci. U.S.A. 104, (13), 5602-5607 (2007).
  8. Fujii, T., Narikawa, T., Takeda, K., Kato, J. Biotransformation of various alkanes using the Escherichia coli expressing an alkane hydroxylase system from Gordonia sp. TF6. Biosci. Biotechnol. Biochem. 68, (10), 2171-2177 (2004).
  9. iGEM. Registry of Standard Biological Parts [Internet]. Available from: http://partsregistry.org/Main_Page (2012).
  10. Kato, T., Miyanaga, A., Haruki, M., Imanaka, T., Morikawa, M., Gene Kanaya, S. cloning of an alcohol dehydrogenase from thermophilic alkane-degrading Bacillus thermoleovorans B23. J. Biosci. Bioeng. 91, (1), 100-102 (2001).
  11. Kato, T., Miyanaga, A., Kanaya, S., Morikawa, M. Gene cloning and characterization of an aldehyde dehydrogenase from long-chain alkane-degrading Geobacillus thermoleovorans B23. Extremophiles. 14, 33-39 (2010).
  12. Kieboom, J., De Bont, J. aM. Bacterial Stress Responses. ASM Press. Washington, D.C. (2000).
  13. Kotte, O., Zaugg, J. B., Heinemann, M. Bacterial adaptation through distributed sensing of metabolic fluxes. Mol Syst Biol. 6, 355 (2010).
  14. Kremling, A., Bettenbrock, K., Gilles, E. D. Analysis of global control of Escherichia coli carbohydrate uptake. BMC Syst. Biol. 1, (2007).
  15. Li, L., Liu, X., Yang, W., Xu, F., Wang, W., Feng, L., Bartlam, M., Wang, L., Rao, Z. Crystal structure of long-chain alkane monooxygenase (LadA) in complex with coenzyme FMN: unveiling the long-chain alkane hydroxylase. J. Mol. Biol. 376, (2), 453-465 (2008).
  16. Lin, H. Y., Mathiszik, B., Xu, B., Enfors, S. O., Neubauer, P. Determination of the maximum specific uptake capacities for glucose and oxygen in glucose-limited fed-batch cultivations of Escherichia coli. Biotechnol. Bioeng. 73, (5), 347-357 (2001).
  17. Okochi, M., Kanie, K., Kurimoto, M., Yohda, M., Honda, H. Overexpression of prefoldin from the hyperthermophilic archaeum Pyrococcus horikoshii OT3 endowed Escherichia coli with organic solvent tolerance. Appl. Microbiol. Biotechnol. 79, (3), 443-449 (2008).
  18. Rehm, H. J., Reiff, I. Mechanisms and occurrence of microbial oxidation of long-chain alkanes. Adv. Biochem. Eng. / Biotechnol. 19, 175-215 (1981).
  19. Rojo, F. Degradation of alkanes by bacteria. Environ. Microbiol. 11, (10), 2477-2490 (2009).
  20. STRING 9.0 Known and Predicted Protein-Protein Interactions [Internet]. Available from: http://string-db.org/newstring_cgi/show_download_page.pl (2012).
  21. Van Beilen, J. B., Panke, S., Lucchini, S., Franchini, A. G., Rothlisberger, M., Witholt, B. Analysis of Pseudomonas putida alkane-degradation gene clusters and flanking insertion sequences: evolution and regulation of the alk genes. Microbiology. 147, 1621-1630 (2001).
  22. Wang, L., Tang, Y., Wang, S., Liu, R. L., Liu, M. Z., Zhang, Y., Liang, F. L., Feng, L. Isolation and characterization of a novel thermophilic Bacillus strain degrading long-chain n-alkanes. Extremophiles. 10, (4), 347-356 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics