विकास तंत्रिका और खुली किताब की तैयारी में इंजेक्शन DiI phenotypes का आकलन ट्यूब में miRNA आधारित प्लास्मिड के ओवो electroporation

Neuroscience

Your institution must subscribe to JoVE's Neuroscience section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

एक विधि है जिसके द्वारा न्यूरल ट्यूब में जीन की अभिव्यक्ति downregulated एक सेल प्रकार विशिष्ट, traceable तरीके से किया जा सकता है वर्णित है. हम का प्रदर्शन

Cite this Article

Copy Citation | Download Citations

Wilson, N. H., Stoeckli, E. T. In ovo Electroporation of miRNA-based Plasmids in the Developing Neural Tube and Assessment of Phenotypes by DiI Injection in Open-book Preparations. J. Vis. Exp. (68), e4384, doi:10.3791/4384 (2012).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Protocol

1. आरएनएआई प्लास्मिड डीएनए के सेल प्रकार विशिष्ट जीन मुंह बंद करने के लिए तैयार

प्लास्मिड (1 चित्रा) मानक आणविक क्लोनिंग तकनीक का उपयोग करते हुए, के रूप में पहले 3,4 विस्तार में वर्णित संश्लेषित कर रहे हैं.

वैक्टर में 1.1 क्लोनिंग: oligonucelotide डिजाइन

  1. हम एक ही सार्वभौमिक oligonucleotides और क्लोनिंग प्रोटोकॉल है कि उत्पाद pRFPRNAiC वेक्टर 4 (सन्दूक जीनोमिक्स) के साथ उपलब्ध कराई गई जानकारी में वर्णित हैं का उपयोग करें.
    1. पहले सड़क के ढालवाँ साइट में क्लोनिंग के लिए:
      5 'HP1 प्राइमर:
      5'-GGCGGGGCTAGCTGGAGAAGATGCCTTCCGGAGAGGTGCTGCTGAGCG
      3 'HP1 प्राइमर:
      5'-GGGTGGACGCGTAAGAGGGGAAGAAAGCTTCTAACCCCGCTATTCACCACCACTAGGCA
    2. 2 सड़क के ढालवाँ साइट में क्लोनिंग के लिए:
      5 'प्राइमर HP2:
      5'-GGCGGGACGCGTGCTGTGAAGATCCGAAGATGCCTTGCGCTGGTTCCTCCGTGAGCG
      3 'HP2 प्राइमर:
    3. 5'-CGCCGCGCATGCACCAAGCAGAGCAGCCTGAAGACCAGTAGGCA
  2. : हम Genscript siRNA लक्ष्य जीन विशिष्ट लक्ष्य दृश्यों का चयन खोजक https://www.genscript.com/ssl-bin/app/rnai का उपयोग करें .
  3. पहले सड़क के ढालवाँ साइट में एक जीन विशेष miRNA क्लोनिंग के लिए प्राइमर्स:

मुंह बंद GFP के लिए एक उदाहरण नीचे दिखाया गया है.
लक्ष्य (22nt) अनुक्रम 5'-GGCACAAGCTGGAGTACAACTA
GFP HP1 फॉरवर्ड = 59mer
1 अनुक्रम
GFP HP1 रिवर्स = 58mer
2 अनुक्रम
वहाँ इन oligos में आम दृश्यों है कि miRNA flanking (चिकन विशिष्ट) दृश्यों, और आम पाश / स्टेम दृश्यों (मानव से miRNA30) के हिस्से के रूप में कर रहे हैं. जीन विशिष्ट लक्ष्य दृश्यों रेखांकित कर रहे हैं. ध्यान दें कि वहाँ हूँइस स्थिति में miRNA30 में प्राकृतिक बेमेल नकल करने के लिए, आगे किनारा (G → इस उदाहरण में एक बोल्ड में दिखाया गया है) के 5 'के आधार पर ismatch.

  1. 2 सड़क के ढालवाँ साइट में एक जीन विशेष miRNA क्लोनिंग के लिए प्राइमर्स:

मुंह बंद lacZ के लिए एक उदाहरण नीचे दिखाया गया है.
लक्ष्य (22nt) अनुक्रम 5'-CGCGCTGTATCGCTGGATCAAA
LacZ फॉरवर्ड HP2:
3 अनुक्रम
LacZ रिवर्स HP2:
4 अनुक्रम
ध्यान दें कि फिर आगे कतरा में लक्ष्य अनुक्रम के 5 आधार बदल दिया गया है (बोल्ड में दिखाया, सी → इस उदाहरण में) ताकि antisense अनुक्रम बेमेल, miRNA30 नकल उतार.

1.2 पीसीआर प्रतिक्रिया और Subcloning

  1. जीन विशेष oligos हम कर रहे हैंmiRNA30 तरह चिकन के साथ सड़क के ढालवाँ उत्पन्न एक पीसीआर प्रतिक्रिया में सार्वभौमिक oligos के साथ साथ एड flanking दृश्यों miRNA.
पहले सड़क के ढालवाँ साइट में क्लोनिंग:
1 μl 10 एनजी GFP फॉरवर्ड HP1 प्राइमर
1 μl - 100 एनजी 5 'HP1 प्राइमर
1 μl - 100 एनजी '3 प्राइमर HP1
1 μl dNTPs (10 मिमी)
5 μl 10x pfu प्रतिक्रिया बफर
1 μl pfu डीएनए पोलीमरेज़ (PROMEGA)
39 μl पीसीआर ग्रेड पानी
या 2 सड़क के ढालवाँ साइट में क्लोनिंग:
1 μl 10 एनजी lacZ फॉरवर्ड HP2 प्राइमर
1 μl - 100 एनजी 5 'HP2 प्राइमर
1 μl 100 एनजी '3 HP2 प्राइमर
1 μl dNTPs (10 मिमी)
5 μl 10x pfu प्रतिक्रिया बफर
1 μl pfu डीएनए पोलीमरेज़ (PROMEGA)
39 μl पीसीआर ग्रेड पानी

चक्र:

94 डिग्री सेल्सियस 94 डिग्री सेल्सियस 55 डिग्री सेल्सियस 72 डिग्री सेल्सियस 72 डिग्री सेल्सियस 4 डिग्री सेल्सियस
1 मिनट 30 सेकंड 30 सेकंड 1 मिनट 9 मिनट पकड़
30 चक्र
  1. पीसीआर उत्पाद शुद्ध, वेक्टर में प्रतिबंध और एंजाइमों subclone साथ को पचाने में:
    1. पहले सड़क के ढालवाँ साइट: उपयोग NheI और MluI
    2. दूसरा सड़क के ढालवाँ साइट: उपयोग MluI और SphI
  2. सक्षम बैक्टीरियल कोशिकाओं के परिवर्तन के लिए मानक तकनीक का पालन करें. लेग (एम्पीसिलीन युक्त) और फसल डीएनए प्लाज्मिड midipreparation (जैसे Nucleobond Xtra Midi किट, Machery के Nagel) द्वारा अगर प्लेट कोशिकाओं.
  3. केंद्रित प्लास्मिड डीएनए निलंबितबाँझ DDH 2 0, और -20 डिग्री सेल्सियस स्पेक्ट्रोफोटोमेट्री दुकान द्वारा उपाय एकाग्रता में

1.3 अनुक्रमण miRNA plasmids

मानक शर्तों के तहत अनुक्रमण प्रतिक्रिया अक्सर hairpins के मजबूत माध्यमिक संरचना के कारण विफल रहता है. इस में सुधार करने के लिए 7:

  1. पानी के बजाय 0.01 मिमी EDTA (8.0 पीएच) के साथ 10 मिमी Tris सीएल में अनुक्रमण प्रतिक्रिया प्रदर्शन. यह ssDNA, जो अधिक अनुक्रमण करने के लिए उत्तरदायी है supercoiled डीएनए के रूपांतरण बढ़ जाती है.
  2. एक गर्मी विकृतीकरण कदम जोड़ें (98 डिग्री सेल्सियस, 5 मिनट) अनुक्रमण करने के लिए पहले. इस ssDNA supercoiled प्लास्मिड डीएनए धर्मान्तरित.

2. Electroporation

2.1 Egg से निपटने

  1. एक मशीन सेट में 38.5 डिग्री सेल्सियस और ~ 45% आर्द्रता अंडे रखें.
  2. अंडे सेते हैं जब तक भ्रूण विकास के वांछित चरण में पहुंच गया है. अक्षतंतु मार्गदर्शन जोड़ संबंधी न्यूरॉन्स की अध्ययन करने के लिए, हम typically भ्रूण electroporate जब वे हैम्बर्गर और हैमिल्टन (एच एच) 17-18 चरण (ऊष्मायन के लगभग 3 दिनों के बाद) 8 तक पहुँच चुके हैं. हालांकि, इंजेक्शन और electroporation लिए किया जाना चाहिए ब्याज की प्रोटीन से पहले जमा किया है, पछाड़ना कुशल बनाना.
  3. इनक्यूबेटर से अंडे निकालें और उन्हें 20 मिनट के लिए एक स्थिर क्षैतिज स्थिति, अंडे के ऊपरी ओर जर्दी के शीर्ष पर भ्रूण reposition में डाल दिया. इनक्यूबेटर में इस अवधि के दौरान अंडे लौटें.

अभिकर्मकों और उपकरणों के 2.2 तैयारी

  1. फॉस्फेट तैयार करें खारा (पीबीएस) buffered और वाष्पदावी विसंक्रण या समाधान के माध्यम से गुजर रहा एक 0.2 फिल्टर सुक्ष्ममापी बाँझ बनाना.
  2. Capillaries खींच कर गिलास micropipettes बनाओ (विश्व प्रेसिजन उपकरण 1B120F-4, 1.2 / 0.68 / ओवर ड्राफ्ट आईडी (मिमी)) एक उपयुक्त खींच डिवाइस में (eg. पीसी-10 Narishige). बंद एक micropipette की नोक तोड़ ~ 5 सुक्ष्ममापी की एक टिप व्यास प्राप्त और टयूबिंग की एक टुकड़ा के साथ कनेक्टउपयुक्त व्यास.
  3. हाथ से आयोजित एक फ्रेम में मजबूती प्लैटिनम इलेक्ट्रोड (0.5 सेमी लंबे) 0.5 सेमी की दूरी के साथ अंतर इलेक्ट्रोड, माउंट. एक वर्ग तरंग पल्स जनरेटर (BTX 830 ईसीएम) इलेक्ट्रोड कनेक्ट.
  4. निम्नलिखित मानकों के साथ पल्स जनरेटर सेट:
    1. एकतरफा electroporation के लिए: वोल्टेज: 25 वी, दालों की संख्या: 5, नाड़ी की लंबाई: 50 मिसे, interpulse अंतराल: 1 सेकंड
    2. वोल्टेज: 18 वी, नाड़ी की दालों की संख्या: 5, लंबाई: 50 मिसे, interpulse अंतराल: 1 सेकंड द्विपक्षीय electroporation
  5. 18 जी सुई, स्केलपेल, 70% इथेनॉल और टेप की एक spritz बोतल के साथ एक सिरिंज तैयार.
  6. 80 डिग्री सेल्सियस पर एक गर्म थाली पर एक बीकर में पैराफिन मोम पिगलो

2.3 Windowing

  1. एक ऊतक का उपयोग कर 70% इथेनॉल में भिगो अंडे साफ कर लें.
  2. अंडे की लंबी अक्ष के साथ टेप की एक स्ट्रिप रखें.
  3. एक, एक स्केलपेल का उपयोग eggshell में दो छोटे छेद बनाओऔर विंडोड जा क्षेत्र के कोने में अंडे दूसरे के कुंद अंत.
  4. एक सिरिंज का उपयोग लगभग हटा दें. 45 डिग्री के कोण पर अंडे की कुंद अंत में छेद में सुई डालने से 3 प्रत्येक अंडे से अंडे की सफ़ेदी मिलीलीटर. ध्यान जर्दी हानिकारक से बचने के.
  5. छोटे कैंची, क्षैतिज आयोजित भ्रूण को नुकसान पहुँचाए से बचने का उपयोग eggshell में एक खिड़की काटो. यदि आवश्यक हो, भ्रूण की स्थिति और सत्यापित किया जा सकता है अंडे की कुंद अंत के खिलाफ एक मजबूत प्रकाश पकड़े द्वारा एक पेंसिल के साथ चिह्नित. 1.5 से 2 सेमी वर्ग के एक खिड़की सबसे अनुप्रयोगों के लिए उपयोगी है.
  6. अंडे की कुंद अंत में छेद और पिघल पैराफिन मोम के साथ eggshell में कोई दरार, एक ब्रश के साथ लागू सील.
  7. पारदर्शी टेप (जैसे स्कॉच जादू) का उपयोग कर खिड़की सील.
  8. इनक्यूबेटर में अंडा लौटें.

2.4 electroporation

  1. बाँझ उपकरणों के लिए तैयार है और 70% इथेनॉल के साथ कार्य क्षेत्र पोंछ.
  2. मैं तैयारnjection समाधान. उचित डीएनए एकाग्रता उपयोगकर्ता द्वारा निर्धारित किया जाना चाहिए और बढ़ाने / अभिव्यक्ति ड्राइव करने के लिए प्रयोग किया जाता प्रमोटर के अनुसार अलग अलग होंगे. एक गाइड के रूप में, हम आम तौर पर 0.2-2.0 ग्राम / μl (चर्चा देखने के लिए) का उपयोग करें. 20 μl के एक कुल, इंजेक्शन मिश्रण शामिल करना चाहिए:
आरएनएआई प्लास्मिड डीएनए (0 2 एच में) Μl एक्स
20x पीबीएस 1 μl
0.4% trypan नीले 2 μl
बाँझ DDH 0 2 की एक अंतिम मात्रा, 20 μl

कोमल चूषण का उपयोग करने के लिए कांच microcapillary टयूबिंग जुड़ी डीएनए में मिश्रण लोड.

  1. विंडोड अंडे से टेप निकालें और हैम्बर्गर और 8 हैमिल्टन के अनुसार भ्रूण मंच.
  2. संदंश और वसंत कैंची का उपयोग करने के लिए ध्यान extrae हटानेभ्रूण की दुम का आधे से mbryonic झिल्ली. झिल्ली आसानी भ्रूण से किया जा सकता है दूर क्षेत्र में जहां प्रमुख सही और बाएँ पीतक नसों ट्रंक में प्रवेश उठाया. धीरे आंसू या झिल्ली में कटौती और उन्हें पूंछ की ओर खींच. यदि आवश्यक हो, भ्रूण भारत या भ्रूण डिस्क और अंडे की जर्दी के बीच फास्ट ग्रीन स्याही की एक समाधान इंजेक्शन के रूप में और 9 Boulland उनके सहयोगियों ने एक वीडियो में दिखाया गया बेहतर कल्पना कर सकते हैं.
  3. न्यूरल ट्यूब के मध्य नहर में बस के ऊपर hindlimbs डीएनए समाधान इंजेक्षन. मुँह से इंजेक्शन की मात्रा पर नियंत्रण रखो. नीले रंग विकासशील मस्तिष्क के निलय पूंछ की नोक से फैल चाहिए.
  4. भ्रूण के शीर्ष पर बाँझ पीबीएस की कुछ बूँदें जोड़ें.
  5. भ्रूण के अक्ष पूर्वकाल पीछे समानांतर इलेक्ट्रोड रखें. भ्रूण या रक्त वाहिकाओं को छूने से बचें.
  6. इलेक्ट्रोड स्थिर पकड़ो, और electroporate.
  7. ध्यान इलेक्ट्रोड हटाने और उन्हें से कुल्लाबाँझ पानी अंडे का सफेद से विकृत प्रोटीन को हटाने के लिए.
    1. द्विपक्षीय electroporation इलेक्ट्रोड के polarity स्विच, भ्रूण के समानांतर इलेक्ट्रोड reposition और electroporation को दोहराएँ. बाँझ पानी में इलेक्ट्रोड कुल्ला.
  8. भ्रूण पर कुछ अधिक बाँझ पीबीएस गिरा. टेप के साथ अंडा reseal और इसे इनक्यूबेटर पर लौटने के लिए जब तक वांछित विकास मंच तक पहुँच जाता है. उचित सील भ्रूण के निर्जलीकरण से बचने के लिए महत्वपूर्ण है.

3. स्पाइनल कॉर्ड की तैयारी

भ्रूण के 3.1 विच्छेदन

  1. HH25 26 (ऊष्मायन 5 दिन), संदंश या एक छोटा चम्मच का उपयोग करते हुए अंडे से भ्रूण को हटा दें. एक पेट्री डिश में सिलिकॉन (Sylgard elastomer) के साथ लेपित पीबीएस में रखें.
  2. Extraembryonic झिल्ली निकालें और अपनी पीठ पर भ्रूण रखना. यह थाली पर यह गर्दन और पूंछ (0.20 मिमी कीट पिन का उपयोग) के माध्यम से लगाए कोमल एस के साथ स्थिर,tretching.
    1. साबुत भ्रूण (बाद में सेक्शनिंग के लिए) यहाँ पीबीएस को 4% paraformaldehyde (पीएफए) के साथ जगह और कमरे के तापमान पर 1 घंटे के लिए incubating द्वारा तय किया जा सकता है. खुली किताब की तैयारी कर, unfixed ऊतक के साथ प्रोटोकॉल के रूप में नीचे वर्णित जारी है.

भ्रूण से 3.2 रीढ़ की हड्डी डोरियों का अलगाव

  1. पिन अंग है, यह सुनिश्चित करना है कि पिन एक भ्रूण से दूर कोण पर डाला जाता है इतना है कि वे विच्छेदन के साथ हस्तक्षेप नहीं. भ्रूण नीचे निम्न चरणों में ऊतक घनत्व माना सक्षम से प्रकाशित किया जाना चाहिए.
  2. दिल और वसंत कैंची का उपयोग करते हुए आंतरिक अंगों निकालें और धीरे संदंश के साथ scraping. खंडों कशेरुक और रीढ़ की हड्डी दिखाई हो सकता है अगर सभी अंगों को पूरी तरह से हटा दिया गया है चाहिए.
  3. वसंत कैंची का प्रयोग, गर्दन पर रीढ़ की हड्डी overlying कशेरुकाओं के माध्यम से एक उथले कटौती कर सकते हैं. भ्रूण 180 ° घुमाएगी और दो छोटेरीढ़ की हड्डी के दोनों तरफ कशेरुकाओं के माध्यम से पूंछ की ओर गर्दन से अनुदैर्ध्य कटौती. संदंश का प्रयोग करने के लिए रीढ़ की हड्डी से दूर और पूंछ की ओर एक पट्टी में ऊतक (सभी कशेरुकाओं युक्त) छील कशेरुकाओं के प्रालंब उठा.
  4. धीरे खिंचाव और फिर से पिन पूंछ और अंगों के माध्यम से भ्रूण.
  5. एक ठीक microsurgical (जैसे Grieshaber 68101) स्केलपेल या एक टंगस्टन सुई का उपयोग करने के लिए दूर रीढ़ की हड्डी overlying meninges में कटौती. न्यूरल ट्यूब और पृष्ठीय रूट ganglia के बीच ऊतक के एक काले, घने लाइन के लिए देखो. रोशनी कोण समायोजित करें, यदि आवश्यक है. धीरे से रीढ़ की हड्डी के प्रत्येक पक्ष पर इस रेखा के साथ longitudinally गर्दन से पूंछ, कट. meninges टिकी भ्रूण की खींच कोमल कारण रीढ़ की हड्डी की हड्डी से अलग होना चाहिए.
  6. विंग कली और अंग कली लांगुलिय के स्तर पर रीढ़ की हड्डी के माध्यम से काटें, और पूरी रीढ़ की हड्डी एक लांगुलिय चिकनी व्याख्यान चबूतरे वाला भ्रूण की लिफ्ट से बाहर गति, संदंश का उपयोग कर. पृथक रीढ़ की हड्डी में इस कदम के दौरान रखा जाना चाहिए पीबीएस में डूबे. पकवान की नहीं उठा इसे बाहर.

खुले पुस्तकों के 3.3 फिक्सेशन

  1. एक रंग पर पृथक रीढ़ की हड्डी में बिखरा हुआ है और एक नए सिलिकॉन लाइन पेट्री डिश के लिए पीबीएस में 4% paraformaldehyde युक्त हस्तांतरण.
  2. ध्यान से छह की स्थिति में रीढ़ की हड्डी (rostrally, मध्यवर्ती और दुमदारी से प्रत्येक पक्ष पर, 0.10 मिमी कीट पिन का उपयोग करते हुए) लगाए द्वारा फ्लैट माउंट तैयारी निर्माण. हम एक छोटे से 'झंडा' है कि न केवल भ्रूण की पहचान के द्वारा प्रत्येक तैयारी लेबल लेकिन यह भी खुली किताब की तैयारी के पूर्वकाल अंत का संकेत है.
  3. कमरे के तापमान पर 30 मिनट के लिए 1 घंटे के लिए सेते हैं. ओपन पुस्तकें नहीं के रूप में इस DiI प्रसार 10 की क्षमता कम कर देता है और पृष्ठभूमि बढ़ जाती है - तय करना चाहिए.
  4. सावधानी से 4% पीएफए ​​डालना और यह पीबीएस के साथ बदलें. 4 डिग्री सेल्सियस तक लिए DiI या माउंट के साथ इंजेक्षन करने के लिए तैयार बर्तन रखें.
e_step "> 3.4 समामिल संबंधी न्यूरॉन्स में DiI इंजेक्शन

  1. प्रतिदीप्ति miscroscopy तहत खुली किताब को ध्यान से देखें और के लिए DiI साथ इंजेक्षन खुली किताब के उचित पक्ष का चयन करें.
  2. फास्ट DiI (इथेनॉल में 5 मिलीग्राम / मिलीलीटर) तैयार है और एक गिलास प्लास्टिक टयूबिंग जुड़ी micropipette में समाधान आकर्षित. Micropipette के अंत के रूप में संभव के रूप में पतले तोड़ने के लिए एक बहुत छोटे व्यास टिप प्राप्त. सुई पीबीएस के एक डिश में डालें और जाँच लें कि DiI सुई से लीक नहीं करता है. यदि DiI लीक, सुई व्यास बहुत बड़ी है. उस मामले में, एक नई सुई तैयार.
  3. नीचे से खुली किताब तैयारी रोशन. ऊतक के एक denser अनुदैर्ध्य पट्टी, तैयारी के पार्श्व किनारे से एक hemibook की चौड़ाई के लगभग 1/5 स्थित के लिए देखो. इस जोड़ संबंधी न्यूरॉन्स, जो सिर्फ छत प्लेट उदर पाए जाते हैं के सेल शरीर के लिए मेल खाती है. किताब खुला एक अंत में शुरू, कांच ऊतक में सुई डालने और, मैं सुई के रूप मेंएस वापस ले लिया, एक मुँह विंदुक का उपयोग DiI की एक छोटी राशि में कश.
  4. जल्दी से काम करते हैं, लगभग 0.5 मिमी के नियमित अंतराल पर खुली किताब की लंबाई के साथ कई इंजेक्शन बनाने. यदि सुई भरा हो जाता है, संदंश के साथ सावधानी से यह स्पष्ट है. यदि टिप भी बड़ा (और DiI लीक) हो जाता है, सुई की जगह.
  5. जब आप एक किताब खुला पूरा कर लिया है, एक हस्तांतरण विंदुक का उपयोग करने के लिए दूर चूसना और किसी भी अतिरिक्त त्यागें, DiI लीक. यह करने में विफलता उच्च पृष्ठभूमि में परिणाम देगा.
  6. 4 में लगभग तीन दिनों के लिए तैयारी छोड़ो ° C axons साथ फैल DiI सक्षम.

इमेजिंग के लिए 3.5 बढ़ते

  1. एक 18 जी सुई के साथ एक सिरिंज का प्रयोग करने के लिए एक 24 x 24 मिमी कांच coverslip मिमी के किनारों के आसपास एक पतली, वैक्यूम तेल की निर्बाध सीमा (जैसे डॉव Corning # 976V) का प्रसार. अच्छी तरह से बाँझ पीबीएस की कई बूँदें जोड़ें. ध्यान दें कि बढ़ते n-propyl gallate साथ ग्लिसरॉल युक्त मध्यम सह नहीं किया जा सकता11 DiI साथ mpatible. इसी तरह, कम चिपचिपापन वैक्यूम तेल पीबीएस और उच्च पृष्ठभूमि में परिणाम के साथ मिश्रण कर सकते हैं.
  2. पुस्तक खुले पिन निकालें और यह पीबीएस छोटी बूंद में स्थानांतरित. पुस्तक खुले विसर्जित कर दिया और इसे अच्छी तरह से बीच में स्थिति.
  3. धीरे से एक और 24 मिमी x 24 मिमी coverslip शीर्ष पर जगह है, यह सुनिश्चित करते हुए किताब खुला खुला रहता है. यदि आवश्यक हो, तो coverslip हटाया जा सकता है और किताब खुला repositioned. तेल की एक पूरी मुहर बनाने की तैयारी के किनारों के आसपास धीरे दबाएं. अतिरिक्त पीबीएस इस कदम के दौरान बाहर निचोड़ा जाएगा. हवाई बुलबुले से बचें.
  4. 4 डिग्री सेल्सियस पर और फ्लोरोसेंट माइक्रोस्कोपी द्वारा निरीक्षण प्रलेखन के लिए तक तैयार अंधेरे में तैयारी रखें. यह शीघ्रता से किया जाना चाहिए (एक सप्ताह के भीतर), यह सुनिश्चित करने के लिए कि तैयारी बाहर सूखी नहीं है.

4. प्रतिनिधि परिणाम

Electroporation plasmids के अभिव्यक्ति

नीचेऊपर वर्णित शर्तों, फ्लोरोसेंट प्रोटीन उपयुक्त कोशिका प्रकार में स्पष्ट रूप से detectable एंटीबॉडी लेबलिंग द्वारा संकेत के अतिरिक्त प्रवर्धन के लिए आवश्यकता के बिना होना चाहिए. फ्लोरोसेंट प्रोटीन केवल वांछित सेल प्रकार / s में detectable होना चाहिए. खुली किताब की तैयारियाँ और विभिन्न plasmids साथ electroporated भ्रूण के पार वर्गों के प्रतिनिधि उदाहरण चित्रा 2 में दिखाया जाता है.

कृत्रिम miRNAs की क्षमता

ब्याज की एक उपन्यास जीन के खिलाफ कृत्रिम miRNAs पहले उनके पछाड़ना प्रभाव की दक्षता और विशिष्टता के लिए जांच की जाना चाहिए. हम पाते हैं कि β-actin प्रमोटर संचालित constructs, 0.25 ग्राम / μl electroporated, इस 3 के लिए उपयुक्त हैं. Vivo में पछाड़ना immunohistochemistry द्वारा या स्वस्थानी संकरण में परीक्षण किया जा सकता है.

DiI लेबलिंग

उचित wildtype भ्रूण में DiI इंजेक्शन लक्षितआदर्श, ठेठ 3 trajectories के साथ इंजेक्शन साइटों की 80% से अधिक उपज चाहिए, के रूप में 3 चित्र में दिखाया. जानवर परिवर्तनशीलता पशु कम किया जाना चाहिए.

चित्रा 1
चित्रा 1 miRNA व्यक्त प्लाज्मिड वैक्टर की सामान्यीकृत योजनाबद्ध. अलग आरएनए पोलीमरेज़ द्वितीय प्रमोटरों / enhancers के उपयोग सेल प्रकार विशिष्ट अभिव्यक्ति के लिए सक्षम बनाता है. ट्रांसफ़ेक्ट कोशिकाओं एक फ्लोरोसेंट पत्रकार है कि एक या दो कृत्रिम miRNAs, जो नीचे जीन अभिव्यक्ति दस्तक से जुड़ा हुआ है (एक एकल प्रतिलेख भीतर) की अभिव्यक्ति से पहचाने जा सकते हैं. बोल्ड पाठ lacZ के खिलाफ एक कृत्रिम miRNA की भावना किनारा इंगित करता है, के रूप में पाठ में वर्णित है.

चित्रा 2
चित्रा 2 प्रतिनिधि उदाहरण ओ.च फ्लोरोसेंट प्रोटीन अभिव्यक्ति पैटर्न संकेत प्लाज्मिड वैक्टर की electroporation के बाद प्राप्त की. पार वर्गों और HH25-26 चिकन भ्रूण कि HH18 में electroporated गया से खुली किताब हैं. β-actin प्रमोटर सर्वव्यापी अभिव्यक्ति ड्राइव Math1 बढ़ाने, dI1 न्यूरॉन्स में अभिव्यक्ति ड्राइव और Hoxa1 बढ़ाने अभिव्यक्ति फर्श थाली में विशेष रूप से ड्राइव. CN, जोड़ संबंधी न्यूरॉन, एफपी, मंजिल थाली.

चित्रा 3
चित्रा 3 आवेदन और DiI खुली किताब की तैयारी में इंजेक्शन साइटों के विश्लेषण. DiI एक कबरा पैटर्न में इंजेक्ट किया जाना चाहिए, खुली किताब के पार्श्व मार्जिन करीब electroporated पक्ष (फ्लोरोसेंट प्रोटीन अभिव्यक्ति द्वारा की पहचान) पर. प्रसार के 3 दिनों के बाद, जोड़ संबंधी अक्षतंतु trajectories फ्लोरोसेंट माइक्रोस्कोपी के तहत देखे जा करने में सक्षम होना चाहिए. सामान्य अक्षतंतु trajectories मंजिल पी की दिशा में विकसित होगादेर से, मंजिल प्लेट पार और फिर बारी और rostrally विकसित. असामान्य जीन नीचे दस्तक से उत्पन्न होने वाले phenotypes इस ठेठ प्रक्षेपवक्र के लिए तुलना की जा सकती है. उदाहरण में, मंजिल की थाली में कुछ axons स्टाल या contralateral तरफ निर्णय गलत मोड़.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

यह सरल, वेक्टर आधारित कृत्रिम miRNA अभिव्यक्ति रणनीति चिकन न्यूरल ट्यूब में पछाड़ना अंतर्जात जीन अभिव्यक्ति के लिए इस्तेमाल किया जा सकता है. इन कार्यात्मक उपकरण एकाधिक जीन मुंह बंद, अस्थायी नियंत्रण और सेल प्रकार विशिष्टता प्रदान करते हैं, जटिल विकास के रास्ते की व्याख्या की सुविधा. विशेष रूप से, हम जोड़ संबंधी अक्षतंतु मार्गदर्शन में इन plasmids की उपयोगिता का प्रदर्शन किया है, के बाद से plasmids जोड़ संबंधी न्यूरॉन्स में या उनके मध्यवर्ती लक्ष्य, 3 floorplate में पछाड़ना विशिष्ट जीनों के लिए इस्तेमाल किया जा सकता है.

और फ्लोरोसेंट प्रोटीन miRNA व्यक्त plasmids (और इसलिए, खामोश कोशिकाओं) से उत्पन्न अभिव्यक्ति की तीव्रता स्थान निम्नलिखित मानकों पर निर्भर करेगा:

  1. बढ़ाने का प्रयोग किया है:
    1. β-actin प्रमोटर सर्वत्र सक्रिय है
    2. Math1 बढ़ाने dI1 12 न्यूरॉन्स में ही सक्रिय है
    3. 13 थाली में ही सक्रिय है
  2. प्लाज्मिड की एकाग्रता.
    यदि प्लाज्मिड एकाग्रता बहुत अधिक है, यह बढ़ाने गतिविधि और अवांछित कोशिकाओं में बाद में अभिव्यक्ति की leakiness 'कारण है, जबकि बहुत कम प्लाज्मिड फ्लोरोसेंट प्रोटीन की अभिव्यक्ति को कम करने के लिए और traceable किया जा रहा से electroporated कोशिकाओं को रोकने के कर सकते हैं कर सकते हैं. आरएनएआई plasmids के उच्च सांद्रता भी बंद लक्ष्य प्रभाव को कम करने और गैर विशिष्ट अंतर्जात miRNA biogenesis मार्ग की संतृप्ति से उत्पन्न होने वाली विषाक्तता का मौका कम से कम करने के लिए बचा जाना चाहिए. हम का उपयोग करें:
    1. β-actin प्रमोटर: 0.25 ग्राम / μl
    2. 0.7 ग्राम / μl: Math1 बढ़ाने
    3. 0.5-1.0 ग्राम / μl: Hoxa1 बढ़ाने III
  3. Electroporation की सटीकता.
    ओवो में चिकन भ्रूण मैनुअल कौशल है कि प्रशिक्षण के माध्यम से हासिल किया जाना चाहिए से निपटने की आवश्यकता है. हम और दूसरोंपहले इस प्रक्रिया के लिए 14,15 समस्या निवारण युक्तियों प्रकाशित.

कई miRNAs करने के लिए परीक्षण की आवश्यकता से पहले एक उपयुक्त उम्मीदवार पाया जाता है हो सकता है. इस प्रक्रिया को कई स्वतंत्र miRNAs की पहचान शामिल करने के लिए मनाया phenotype, नकारात्मक (तले हुए और / या असंबंधित miRNAs) नियंत्रण और बचाव 16 constructs की पुष्टि करनी चाहिए.

खुली किताब की तैयारियाँ बेहतर तय किया जाना चाहिए और DiI इंजेक्शन के साथ उपयुक्त स्थान में क्रम में करने के लिए जोड़ संबंधी न्यूरॉन्स की axonal अनुमानों के संरचनात्मक विवरण कल्पना. उच्च पृष्ठभूमि खुली किताब या DiI की spillage के लंबे समय तक निर्धारण के कारण हो सकता है. DiI भी पृष्ठीय स्थित कोशिकाओं में इंजेक्शन आमतौर पर मंजिल थाली की ओर लेबल axonal अनुमानों के अभाव में परिणाम देगा. पर midline भी औदरीयता स्थित कोशिकाओं कई ipsilateral और contralateral अनुमानों है, और इस प्रकार से बचा जाना चाहिए. Beginne लिएरुपये, हम खुली किताब wildtype भ्रूण से लिया सही, DiI की प्रतिलिपि प्रस्तुत करने योग्य स्थिति सुनिश्चित करने पर अभ्यास करने की सलाह देते हैं.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

ब्याज की कोई संघर्ष की घोषणा की.

Acknowledgements

ES की प्रयोगशाला में काम स्विस राष्ट्रीय विज्ञान फाउंडेशन द्वारा समर्थित है. हम फिल्माने के साथ सहायता के लिए डॉ. मारो Kunz धन्यवाद देना चाहूंगा.

Materials

Name Company Catalog Number Comments
0.5 mm glass capillaries World Precision Instruments 1B120F-4
Glass needle puller Narishige PC-10
Electroporator BTX ECM 830
Sylgard silicone elastomer World Precision Instruments SYLG184
Tungsten wire, 0.075 mm World Precision Instruments TGW0325
Insect pins, 0.20 mm Fine Science Tools 26002-20
Insect pins, 0.10 mm Fine Science Tools 26002-10
Spring scissors Fine Science Tools 15003-08
Dumont #5 forceps Fine Science Tools 11252-20
Dumont #55 forceps Fine Science Tools 11255-20
Fast DiI Molecular Probes D-7756
Fluorescent microscopes Olympus SZX12, BX51

DOWNLOAD MATERIALS LIST

References

  1. Chédotal, A. Further tales of the midline. Current Opinion in Neurobiology. 21, 68-75 (2011).
  2. Avraham, O., Hadas, Y., Vald, L., Zisman, S., Schejter, A., Visel, A., Klar, A. Transcriptional control of axonal guidance and sorting in dorsal interneurons by the Lim-HD proteins Lhx9 and Lhx1. Neural Development. 4, 21 (2009).
  3. Wilson, N. H., Stoeckli, E. T. Cell type specific, traceable gene silencing for functional gene analysis during vertebrate neural development. Nucleic Acids Research. 39, e133 (2011).
  4. Das, R. M., van Hateren, N. J., Howell, G. R., Farrell, E. R., Bangs, F. K., Porteous, V. C. A robust system for RNA interference in the chicken using a modified microRNA operon. Developmental Biology. 294, 554-563 (2006).
  5. Perrin, F. E., Stoeckli, E. T. Use of lipophilic dyes in studies of axonal pathfinding in vivo. Microscopy Research and Technique. 48, 25-31 (2000).
  6. Timmer, J., Johnson, J., Niswander, L. The use of in ovo electroporation for the rapid analysis of neural-specific murine enhancers. Genesis. 29, 123-132 (2001).
  7. Kieleczawa, J. Simple modifications of the standard DNA sequencing protocol allow for sequencing through siRNA hairpins and other repeats. Journal of Biomolecular Techniques. 16, 220-223 (2005).
  8. Hamburger, V., Hamilton, H. L. A series of normal stages in the development of the chick embryo. Journal of Morphology. 88, 49-92 (1951).
  9. Boulland, J., Halasi, G., Kasumacic, N., Glover, J. C. Xenotransplantation of Human Stem Cells into the Chicken Embryo. J. Vis. Exp. (41), e2071 (2010).
  10. Kim, B. G., Dai, H. -N., McAtee, M., Vicini, S., Bregman, B. S. Labeling of dendritic spines with the carbocyanine dye DiI for confocal microscopic imaging in lightly fixed cortical slices. Journal of Neuroscience Methods. 162, 237-243 (2007).
  11. Murphy, M. C., Fox, E. A. Anterograde tracing method using DiI to label vagal innervation of the embryonic and early postnatal mouse gastrointestinal tract. Journal of Neuroscience Methods. 163, 213-225 (2007).
  12. Helms, A. W., Abney, A. L., Ben-Arie, N., Zoghbi, H. Y., Johnson, J. E. Autoregulation and multiple enhancers control Math1 expression in the developing nervous system. Development. 127, 1185-1196 (2000).
  13. Li, X., Lufkin, T. Cre recombinase expression in the floorplate, notochord and gut epithelium in transgenic embryos driven by the Hoxa-1 enhancer III. Genesis. 26, 121-122 (2000).
  14. Mauti, O., Baeriswyl, T., Stoeckli, E. T. G. ene Silencing by Injection and Electroporation of dsRNA in Avian Embryos. Cold Spring Harbor Protocols. (2008).
  15. Krull, C. E. A primer on using in ovo electroporation to analyze gene function. Developmental Dynamics. 229, 433-439 (2004).
  16. Cullen, B. R. Enhancing and confirming the specificity of RNAi experiments. Nature Methods. 3, 677-681 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics