Chi è Chi? Metodi non invasivi per Sex autonomamente e Mark altricial Chicks

Biology

GE Global Research must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Questo protocollo fornisce un insieme di metodi conveniente, che consente estremamente veloce, semplice, non invasivo, affidabile ea basso costo, determinazione del sesso molecolare degli uccelli e la loro non-invasivo, rapido, sicuro e facilmente riconoscibile marcatura poco dopo la schiusa. È necessaria solo la gestione limitata dei pulcini. Questo comodo toolbox di metodi del tutto conforme alle RRR linee guida.

Cite this Article

Copy Citation | Download Citations

Adam, I., Scharff, C., Honarmand, M. Who is Who? Non-invasive Methods to Individually Sex and Mark Altricial Chicks. J. Vis. Exp. (87), e51429, doi:10.3791/51429 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Molti esperimenti richiedono la determinazione precoce del sesso della prole, così come anticipato marcatura dei neonati per il riconoscimento individuale. Secondo le linee guida sul benessere degli animali, tecniche non invasive dovrebbero essere preferiti quando applicabili. Nel nostro gruppo, lavoriamo su diverse specie di uccelli canori in laboratorio e in campo, e ci applichiamo con successo metodi non invasivi al sesso e individualmente segnalo pulcini. Questo articolo presenta una tool-box non invasivo completo. Sexing uccelli prima della espressione dei tratti sessuali secondari richiede la raccolta di materiale DNA-cuscinetto per la PCR. Abbiamo stabilito un metodo rapido e semplice per gli uccelli di sesso di ogni età (post schiusa) estraendo il DNA dai tamponi buccali. I risultati possono essere ottenuti entro 3 ore. Per piume singolo pulcino marcatura sono rivestiti in modelli specifici che consentono di identificare rapidamente all'interno dell'ordine schiusa. Questo insieme di metodi è facilmente applicabile in un laboratorio standard dotato e particolarmente adatto per working nel campo come attrezzatura speciale è richiesta per il campionamento e memorizzazione. Manipolazione dei pulcini è ridotto al minimo e le tecniche di marcatura e sessaggio sono non-invasive sostenendo così il RRR-principio di linee guida sul benessere degli animali.

Introduction

Riconoscimento individuale, sessaggio e la genotipizzazione sono requisiti fondamentali in una varietà di studi sperimentali. Ottenere DNA materiale del cuscinetto e marcatura soggetti senza ambiguità (anche in tenera età) dovrebbe avere un impatto minimo sulla fisiologia, il comportamento e la sopravvivenza. Quando possibile, procedure invasive dovrebbero essere evitati secondo il principio RRR 1.

Metodi non invasivi non sono solo benefici per l'animale, ma anche potrebbe migliorare i dati ottenuti da animali risentono meno dei trattamenti.

Negli uccelli, sessaggio del DNA può essere eseguita su una serie di materiali ottenibili non invasivo come escrementi 2, piume 3,4 o tamponi buccali 3,5,9. Indipendentemente dalla condizione ed età tamponi buccali del soggetto sono il metodo di scelta per sessaggio aviaria, perché sono facili da eseguire, raramente sicuro e la gestione è breve.

Finora, il DNA da tamponi buccaliera o estratto con kit disponibili in commercio o 3,6 in termini di tempo protocolli di estrazione del DNA standard di 3,6-8. I kit non solo sono piuttosto costosi, ma i loro protocolli possono imporre sfide per il lavoro sul campo. Alcuni dettagli procedurali, ad esempio l'essiccazione e l'incubazione dei campioni, non sono pratici nel campo. Specialmente in un ambiente dove protocolli sperimentali richiedono sesso trattamento dipende da come presto come pochi minuti dopo la schiusa, c'è sollecitare un metodo rapido, non invasivo, affidabile e facile da ottenere risultati.

Dall'altra parte taxa aviaria una notevole toolbox per gli individui di marcatura è stato sviluppato 10. La vasta gamma di tecniche disponibili rappresenta la varietà degli obiettivi della ricerca, delle specie e dei bilanci. Tuttavia, la marcatura piccoli nidiacei ha affrontato ricercatori con ulteriori sfide. In alcune specie (es. passeriformi) pulcini sono troppo piccoli per applicare le bande gambe e richiedono metodi alternativi, chenon alterare il comportamento del genitore-prole. Come la consapevolezza e l'interesse per migliorare il benessere e le tecniche in studi sul campo e di laboratorio sugli animali è in crescita, l'uso di tecniche non invasive è fortemente incoraggiata e preferiva.

Questo protocollo fornisce un metodo rapido, facilmente riconoscibile e persistente non invasivo per contrassegnare individualmente molto giovani nidiacei prima di applicare fasce gamba è fattibile. Questo metodo di marcatura viene introdotto in uno dei più importanti specie aviarie modello di laboratorio, la Zebra Finch (Taeniopygia guttata) 11-13. Il protocollo soddisfa tutti gli obiettivi precedentemente pubblicati per singole tecniche di marcatura 10 ed è stata già applicata con successo 14,15.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Tutte le procedure sono state eseguite in conformità alla legge tedesca per la protezione degli animali (TierSchG).

1. Preparazione dei reagenti e materiali di consumo

  1. Preparare un 5% (w / w) Chelex-100 soluzione in acqua di grado molecolare. Preparare aliquote di 200 ml in provette da 1,5 ml standard. Come resina Chelex precipita rapidamente dalla sospensione è necessario ri-omogeneizzare la sospensione costantemente durante la preparazione delle aliquote. È consigliabile preparare almeno 50 ml in una partita e mantenere la sospensione omogeneizzata con un agitatore magnetico. La soluzione Chelex può essere conservato per anni in condizioni ambiente.
  2. Tagliare pezzi di carta Whatman con una larghezza inferiore alla larghezza becco dell'uccello da testare. La lunghezza della carta dipende dal metodo di prelevare il campione:
    1. Utilizzando pinze, il pezzo dovrebbe essere abbastanza lungo da permettere la raccolta del campione, senza la pinza essere inseriti nel becco dell'uccello. Comestima approssimativa, per una lunghezza di 0,5 cm becco un pezzo di carta con la lunghezza di 1 cm dovrebbe andare bene.
    2. Se non usando pinze, il pezzo deve essere più lungo, ma la rigidità del pezzo dovrebbe ancora permettere il campionamento delle cellule epiteliali.
  3. Preparare una aliquota della premiscela PCR per ciascun campione da analizzare. Per una PCR in un volume totale di 25 microlitri della miscela contenente 0.18 mM dNTPs, 2 mM MgCl 2, 70 mM Tris-HCl, 17,25 mM di solfato di ammonio, 0,1% Tween-20, 0,32 mM P2 Primer (TCTGCATCGCTAAATCCTTT), 0,32 mM P8 Primer (CTCCCAAGGATGAGRAAYTG) 16 e 2 unità di Taq polimerasi. Casalinga Taq polimerasi 17 può essere utilizzato. Per consentire l'aggiunta della quantità massima di DNA-soluzione, una premiscela 6 microlitri può essere preparato e conservato a -20 ° C per diverse settimane.

2. Raccolta dei campioni

Indossare guanti non è essenziale per la determinazione del sesso aviaria come primer PCR non possono ricombinarsi di DNA umano. Peraltri fini di genotipizzazione che potrebbe essere consigliabile.

  1. Cattura l'uccello di interesse e delicatamente tenerlo in una mano ad esempio con la 'presa di suoneria' 18. Assicurarsi di non spremere l'uccello.
  2. Tenere un pezzo di carta Whatman con una pinza e sfiorare più volte attraverso la parte interna delle guance, la lingua e la choana. Solitamente i campioni sono ottenuti in meno di 30 secondi.
    1. Animali adulti: a seconda della specie potrebbe essere difficile ottenere l'uccello per aprire il becco. Solitamente toccare il lato del becco e applicando una leggera pressione funzionerà.
    2. Nidiacei: Campionamento da larve o nidiacei è particolarmente facile usando questa tecnica, in quanto il loro comportamento accattonaggio offre un facile accesso all'interno del becco. Potrebbe anche essere possibile avere il campione senza gestire loro a tutti, in quanto facilmente pregano per esempio quando il loro nido è aperto.
  3. Immediatamente conservare la carta in un preparato conte tubo di reazionening 200 microlitri del 5% (w / w) Chelex-100 soluzione.

Se si intende inoltre / bisogno di segnare i pulcini, farlo ora come descritto nel capitolo 6.

3. Conservazione dei campioni prima estrazione del DNA

  1. Se lavorano in laboratorio, conservare i campioni a -20 ° C. Se ciò non è possibile o difficile (ad esempio nel campo) conservare i campioni a temperatura ambiente.
  2. I campioni possono essere conservati per più di 3 anni a temperature comprese tra temperatura ambiente a -20 ° C.

Estrazione del DNA 4.

  1. Se il campione è congelato, scongelare a temperatura ambiente.
  2. Assicurarsi che il pezzo di carta è sul fondo del tubo sommerso nella soluzione Chelex-100.
  3. Incubare campioni per 15 min a 56 ° C.
  4. Vortex brevemente e centrifugare il contenuto del tubo.
  5. Incubare i campioni per 8 min a 100 ° C.
  6. Centrifugare i campioni a 15.000 xg per 3 min.
  7. Utilizzare le supernatant per la successiva genotipizzazione.

5. Molecolare Sex Determinazione

  1. Preparare un tubo PCR con 6 ml premiscelato per campione, più due tubi supplementari per il negativo (obbligatorio) e positivo di controllo (facoltativo). Per la determinazione del sesso di routine su un campione dall'ultimo sessaggio successo come controllo positivo.
  2. Aggiungere 19 ml di surnatante dall'estrazione del DNA alla premiscela PCR. Assicurati di pipetta dalla superficie della soluzione per evitare riporto di Chelex perline. Questo è fondamentale, come Chelex è uno scambiatore di cationi e quindi inibisce fortemente tutte le reazioni enzimatiche.
  3. Eseguire il seguente programma PCR: incubazione a 94 ° C per 3 min, 45 cicli ciascuno con una fusione 30 sec fase 94 ° C, seguita da una fase di ricottura 30 sec a 55 ° C, seguita da un allungamento passo 45 sec a 72 ° C. In una fase finale chase off, le reazioni vengono incubate per 5 minuti a 72 ° C.
  4. Preparare un TBE standard di 2% o TAE agaro SE gel per separare i prodotti di PCR.
  5. Eseguire il gel di agarosio con le impostazioni di tensione appropriate.
  6. Visualizza le bande sotto la luce UV e scattare una foto. Assicurarsi che le due bande nei campioni provenienti da femmine sono ben separati.
  7. Distinguere il maschio dalla femmina campioni dalla presenza di uno (maschio) o due bande (femmina).

6. Marcatura Nestlings

  1. Controllare nidi per i pulcini appena nati su un programma appropriato per la specie / studio (ad esempio i controlli giornalieri al mattino sono invitati, come la maggior parte dei pulcini schiudono poi).
  2. Tagliare le piume di ogni pulcino in un nido in una posizione caratteristica diversa. In fringuelli zebra ciuffi di bassi crescono a quattro zone caratteristiche e distinte in tutto il corpo (Figura 4A) della immerso. Per ogni pulcino tagliare una zona (Figura 4B). Se ci sono più di quattro pulcini all'interno di un nido, le uniche quattro 'haircut' possono essere combinati.
ove_content "> Per fringuelli zebra: Applicare bande gamba a dieci giorni dopo la schiusa, quando piume diventano difficili da individuare e dimensioni immerso permette di squillare.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Tamponi orali possono essere utilizzati per ottenere DNA per la determinazione del sesso in una varietà di piccoli uccelli

I campioni sono stati raccolti da diamanti mandarini (Taeniopygia guttata, 99 individui, di età 0 giorni - 5 anni), Canarie (Serinus canaria), bengalesi Fringuelli (Lonchura striata), usignoli (Luscinia megarhynchos), cinciallegre (Parus major) e Merli (Turdus merula) (per tutte le altre specie: dimensione del campione 1-3, età sconosciuti) (Figura 1).

Per i campioni prelevati dai diamanti mandarini, il tasso di successo per le PCR è stata del 100%. Il risultato PCR abbinato sempre al sesso determinato dalla precedente (negli adulti) o successivo (in nidiacei) ispezione fenotipica. L'intensità delle bande non differiva in modo sistematico fra nidiacei o gli adulti che indicano che simili quantità di materiale DNA-cuscinetto sono acquisite da tutte le età.

Figura 1 "fo: content-width =" 6in "fo: src =" / files/ftp_upload/51429/51429fig1highres.jpg "src =" / files/ftp_upload/51429/51429fig1.jpg "/>
Figura 1. Sessaggio molecolare. Esempi di risultati sessaggio dei tamponi buccali ottenuti da varie specie avicole. 2% gel di agarosio colorato con bromuro di etidio. Da sinistra a destra: le dimensioni di servirlo, Zebra Finch maschio, bengalese Finch femminile, Merlo maschio, maschio Cinciallegra, Usignolo di sesso maschile, Canary maschio, controllo dell'acqua, dimensioni marcatore.

È importante prevenire la contaminazione riporto Chelex nelle PCR

Per dimostrare l'effetto della contaminazione resina Chelex in una reazione di PCR, abbiamo incluso una piccola quantità di Chelex perline in una reazione PCR (Figura 2). Come si può vedere in Figura 2A, contaminazione riporto di Chelex perline impedisce l'amplificazione di DNA che viene ulteriormente illustrata dalla mancanza di primer formazione di dimero nel campione contaminato (<strong> Figura 2B). In Figura 2A corsia 2 abbiamo usato lo stesso campione per la PCR senza riporto Chelex. Di solito i campioni contaminati sono facilmente riconoscibili da macchie scure nelle tasche del gel di agarosio (Figura 2B).

Figura 2
Contaminazione Figura 2. Chelex. A) Chelex riporto nella reazione PCR inibisce l'amplificazione del DNA. Da sinistra a destra:. Dimensioni di servirlo, Zebra Finch maschio, femmina Zebra Finch, lo stesso campione con riporto intenzionale di Chelex, controllo dell'acqua, dimensioni marcatore B) Chelex perle sono facilmente visibili come macchie scure nella tasca del gel (sinistra senza Chelex , proprio con Chelex. L'grave inibizione della reazione PCR in presenza di Chelex è anche illustrata dal fondo mancante dformazione imer nel campione contaminato.

I campioni possono essere conservati a temperatura ambiente prima estrazione del DNA per più di tre anni

Per studiare se l'estrazione di successo può ancora essere eseguita dopo la conservazione a lungo, sono stati prelevati campioni ripetutamente dal medesimo uccello e memorizzati in laboratorio a temperatura ambiente per al massimo tre anni. I campioni sono stati conservati vicino ad una finestra con l'esposizione alla luce naturale e calore dal sole. Dopo tre anni DNA è stato estratto e la PCR sessaggio eseguita. Il risultato abbinato quello eseguito tre anni prima (subito dopo il campionamento) e non ha evidenziato alcun effetto di stoccaggio (Figura 3).

Figura 3
Figura 3. Chelex consente la memorizzazione a lungo termine dei campioni before e dopo DNA-estrazione. Campioni di due animali (maschio femmina sinistra, destra) sono stati conservati in condizioni diverse, come indicato in tabella. I segnali sono stati ottenuti con successo da tutti i campioni.

Figura 4
Figura 4. Marcatura dei pulcini. A) Rappresentazione schematica e la nomenclatura delle quattro distinte aree di basso sviluppo piuma zebra nidiacei fringuelli:. Quadri A = testa, B = indietro, C = ali (entrambi), D = fianchi (entrambi) B) Esempio di uccellini che sia ricevuto uno delle rispettive «haircut» (AD) o no 'haircut' (E).

DNA estratto può essere conservato per più di tre anni a 4 ° C

Campioni Zebra fringuello dal primo esperimento sono stati conservati per tre anni in un fri standard di laboratoriodge a 4 ° C e con successo ripetere il test. Tutti i campioni hanno prodotto gli stessi risultati come PCR direttamente dopo l'estrazione del DNA (Figura 3).

I piccoli possono essere contrassegnati da taglio le loro piume per il riconoscimento individuale da cova su

Marcatura singoli pulcini subito dopo la schiusa, tagliando loro le piume li rendeva facilmente riconoscibile (figure 4, 5, 6). Giù le piume hanno un aspetto soffice come le loro barbe non sono uniti insieme per formare una banderuola liscia. Possono ancora essere riconosciuti al giorno posthatch 10 sulle punte delle penne in via di sviluppo, che ormai coprono il corpo (Figura 5). La loro assenza in posizioni distinte rende facile riconoscimento, a volte anche senza la gestione dei nidiacei (Figura 6). L'applicazione di questi cosiddetti `haircut 'è una tecnica elegante, che colma con successo il divario per il tempo dalla schiusa fino a quando la dimensione corporea del adagiato FINC zebrahes rende l'applicazione di bande gamba fattibile.

Figura 5
Figura 5. Contrassegnato Zebra Finch nidiacei al posto di tratteggio giorno 10. Esposizione delle immagini nidiacei o con (forbici) o senza (freccia) marcature. Una freccia indica la posizione di interesse secondo la rispettiva nomenclatura di 'haircut' piuma giù: A = B = testa, schiena, C = ali, D = fianchi.

Figura 6
Figura 6. Riconoscimento dei nidiacei marcati (età media = 10 giorni) all'interno del nido del cielo secondo la nomenclatura.A = la testa, facile da individuare a causa delle sue importanti piume, che mancano solo sulla testa. B = indietro, giù piume visibile in tutte le sedi, ma sul retro. C = ali, ha bisogno di un osservatore attento come entrambe le ali sono mancanti giù le piume, ma di incastonata postura rende le piume dalla testa coprono fascia destra. D = fianchi, possono essere riconosciuti solo dal processo di eliminazione come i suoi fianchi non possono essere viste. Esso può essere attendibilmente riconosciuto come D come dimostra chiaramente la crescita di piume in testa, la schiena e le ali. E = una combinazione di testa 'haircut' (A) e ritorno (B), è facile distinguere come le piume la testa e la schiena sono mancanti. F = una combinazione di un 'haircut' (testa) e D (fianchi), che può essere differenziato solo attraverso l'eliminazione altre opzioni, come la testa di marcatura è evidente e nessun altro immerso identificato presenta una testa di marcatura. G = non hannoricevere eventuali marcature ed è molto più piccolo rispetto ai suoi fratelli come è stato l'ultimo a covare. Inoltre G è un buon esempio per un immerso che non esprime le piume in tutte le sedi.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Sexing da tamponi buccali utilizzando Chelex hanno mostrato un tasso estremamente elevato di successo. Piume di taglio del hatchling abilitati differenziazione tra nidiacei fino gamba banding era possibile.

Estrazione Chelex-DNA dai tamponi buccali ceduto abbastanza DNA per eseguire con successo sessaggio molecolare. Determinazione del sesso è stata del 100% preciso convalidato dal piumaggio dimorfismo sessuale. Il tasso di successo riportato qui è nettamente superiore al tasso riportato da due studi precedenti 7,9. L'estrazione del DNA con Chelex minimizza pipettaggio e precipitazioni passaggi in cui materiale può essere perso. Tuttavia, uno degli studi di convalida nostro protocollo in una specie diversa (Apus apus) ancora raggiunto un basso tasso di successo del 89% 9, anche se questo era già nettamente superiore al 82% registrato nel Arima et al. 7.

Quale potrebbe essere la causa? La parte più importante è quello di seguire con attenzione la protocol, compresa la parte per il modo di prelevare campioni di tessuto (delicatamente sfiorare più volte in bocca) e per prevenire riporto di Chelex perle nella reazione PCR. Come Chelex è uno scambiatore cationico fortemente inibisce la reazione PCR impedendo l'amplificazione in campioni contaminati. Campioni contaminati possono essere facilmente riconosciuti da perle visibili nelle tasche di gel di agarosio e la mancanza di dimeri di primer.

Ragioni meno probabili per il mancato successo campioni sesso potrebbero anche essere dovuto a differenze di specie o l'uso di una tecnologia diversa per rilevare la differenza di banda nei campioni femminili.

Tagliare le piume della hatchling fringuelli zebra è un modo sicuro per marcare individualmente soggetti. Questi "tagli di capelli" erano facili da riconoscere fino nidiacei erano abbastanza grandi per ricevere le bande gamba numerati (ad esempio a 10 giorni in diamanti mandarini). Questa tecnica di marcatura può essere facilmente regolata per soddisfare diverse sperimrichieste bientali, ad esempio per le registrazioni video marcature possono essere limitati alla testa dei pulcini. Combinazioni di tagli in due posizioni possono essere applicati se i nidi sono più grandi di cinque nidiacei. Mantenere una sequenza predefinita nell'applicazione "haircut" (ad esempio il primo hatchling in un nido riceve sempre 'haircut A', il secondo riceve sempre 'haircut B', ecc) permette il riconoscimento veloce all'interno dell'ordine cova tutta la fase immerso. Questo consente una rapida identificazione, che può ridurre o addirittura impedire la manipolazione dei pulcini. In fringuelli zebra, la mancanza di bassi in una delle quattro posizioni può verificarsi a causa di fluttuazioni naturali. Quindi, può non essere sempre possibile seguire una sequenza predefinita di marcatura.

Anche per qualcuno inesperto nella gestione uccellini è un modo rapido per imparare, sicuro e facile tecnica di marcatura per tagliare le piume. Tuttavia, come la risposta a bocca aperta innata di nidiacei comprende movimenti della testa, alcune persone trovano più difficoltà a collocare marre sulla testa. Errore di identificazione del soggetto si basa su marcature precise. E 'di importanza eminente di tagliare completamente l'intero giù piume in un determinato posto, come segni imperfetti / singolo sinistro-out giù piume possono tardi confondere identità.

Questo insieme di metodi permette estremamente veloce, semplice, non invasivo, affidabile ea basso costo, determinazione del sesso degli uccelli e la loro non-invasivo, rapido, sicuro e facilmente riconoscibile marcatura in pochi minuti dopo la schiusa.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla da rivelare.

Acknowledgements

Molte grazie a Silke Kipper, Sarah Kiefer, Michael Weiss, Conny Bartsch e Silke Voigt-Heucke per la raccolta del campione entusiasta nel campo, per Janett Birkenfeld per l'assistenza continua, a Ulla Kobalz per le belle gel e Tobias Krause per il supporto morale.

Materials

Name Company Catalog Number Comments
Whatman 3MM Chromatography paper e.g. Fisher Scientific No.:3030-153
Chelex 100 Resin Biorad #143-2832
Taq polymerase addgene http://www.addgene.org/25712/
leg band (Flexi number rings for birds, diameter 2.5 mm) Horst Stengel Sohn

DOWNLOAD MATERIALS LIST

References

  1. Russell, W. M. S., Burch, R. L. The principles of humane experimental technique. (1959).
  2. Robertson, B. C., et al. Molecular sexing of individual kakapo, Strigops habroptilus Aves, from feces. Mol. Ecol. 8, 1349-1350 (1999).
  3. Yannic, G., et al. Description of microsatellite markers and genotyping performances using feathers and buccal swabs for the Ivory gull (Pagophila eburnea). Mol. Ecol. Resour. 11, 877-889 (2011).
  4. Bello, N., et al. Isolation of genomic DNA from feathers. J. Vet. Diagn. Invest. 13, 162-164 (2001).
  5. Handel, C. M., et al. Use of buccal swabs for sampling DNA from nestling and adult birds. Wildl. Soc. Bull. 34, 1094-1100 (2006).
  6. Brubaker, J. L., et al. A noninvasive, direct real-time PCR method for sex determination in multiple avian species. Mol. Ecol. Resour. 11, 415-417 (2011).
  7. Arima, H., Ohnishi, N. Usefulness of avian buccal cells for molecular sexing. Ornithological Science. 5, 139-143 (2006).
  8. Seki, S. -I. Molecular sexing of individual Ryukyu Robins Erithacus komadori using buccal cells as a non-invasive source of DNA. Ornithological Science. 2, 135-137 (2003).
  9. Wellbrock, A. H. J., et al. Buccal swabs as a reliable source of DNA for sexing young and adult Common Swifts (Apus apus). J. Ornithol. 153, 991-994 (2012).
  10. Marion, W. R., Shamis, J. D. Annotated-Bibliography of Bird Marking Techniques. Bird Banding. 48, 42-61 (1977).
  11. Scharff, C., Adam, I. Neurogenetics of birdsong. Curr. Opin. Neurobiol. (2012).
  12. Griffith, S. C., Buchanan, K. L. The Zebra Finch: the ultimate Australian supermodel. Emu. 110, 5-12 (2010).
  13. Fee, M. S., Scharff, C. The songbird as a model for the generation and learning of complex sequential behaviors. Ilar J. 51, 362-377 (2010).
  14. Honarmand, M., et al. Stressful dieting: nutritional conditions but not compensatory growth elevate corticosterone levels in zebra finch nestlings and fledglings. PLoS On. 5, (1371).
  15. Krause, E. T., et al. Zebra finch nestlings beg more under better nutritional conditions. Behaviour. 148, 1239-1255 (2011).
  16. Griffiths, R., et al. A DNA test to sex most birds. Mol. Ecol. 7, 1071-1075 (1998).
  17. Pluthero, F. G. Rapid purification of high-activity Taq DNA polymerase. Nucleic Acids Res. 21, 4850-4851 (1993).
  18. Joint Working Group on Refinement. Laboratory birds: refinements in husbandry and procedures. Fifth report of BVAAWF/FRAME/RSPCA/UFAW Joint Working Group on Refinement. Lab Anim. 35, 1-163 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics