Улучшенная Северная Клякса обнаружения малых РНК видов в

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Целью данной публикации является визуализация и обсудить оперативные шаги для улучшенного протокола Северная пятно на РНК, выделенной из Дрозофилы эмбрионов, клетки и ткани. Этот протокол является особенно полезным для эффективного обнаружения мелких видов РНК.

Cite this Article

Copy Citation | Download Citations

Laneve, P., Giangrande, A. Enhanced Northern Blot Detection of Small RNA Species in Drosophila Melanogaster. J. Vis. Exp. (90), e51814, doi:10.3791/51814 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

В последние десятилетия мы стали свидетелями взрыва научного интереса вокруг механизмов контроля экспрессии генов на уровне РНК. Эта отрасль молекулярной биологии была значительно подпитывается открытием некодирующих РНК в качестве основных игроков в пост-транскрипционной регуляции. Такая революционная перспектива сопровождается и вызвано развитием мощных технологий для профилирования короткий выражение РНК, как на уровне высокой пропускной (генома идентификации) или как одного кандидата анализа (стационарного накопления конкретных видов). Хотя несколько состояние дел в области стратегии в настоящее время доступны для дозирования или визуализации таких бегущих молекулы, Северная Клякса анализ остается право подход в молекулярной биологии для немедленного и точного вычисления выражения РНК. Она представляет первый шаг к применению более сложных, дорогостоящих технологий и, во многих случаях, остается льготный способ легко получить представлениев РНК биологии. Здесь мы обзору эффективный протокол (Enhanced Северная Клякса) для обнаружения слабо выраженные микроРНК (или других мелких нормативные вид РНК) из Дрозофилы целые эмбрионы, вручную расчлененный личинок / взрослых тканей или в пробирке культивируемых клетках. Очень ограниченное количество РНК не требуется, и использование материала, из проточной цитометрии-изолированные клетки могут быть также предусмотрены.

Introduction

РНК биохимия пережил захватывающие прогрессирует в последние годы 1. Наша осмысление РНК потенциала в контроле экспрессии генов был лопнуть от идентификации мощных некодирующих рибо- регуляторов 2, в связи с открытием новых РНК на основе регуляторных механизмов 3,4 и более глубоким характеристик уже известных посттранскрипционных событий 5. Все вместе эти исследования позволили РНК биологии резко сделать сцену, став основным предметом исследования в современной научной ландшафта. В частности, за последние годы мы получаем ощущение всепроникающей влияния "мира РНК" на молекулярном нейробиологии 6, один из наиболее динамично развивающихся областей исследований в современной науке о жизни. В последнее десятилетие прошлого века, научная сценарий был революцию в связи с открытием в РНК-интерференция 7,8 и малых регуляторных РНК 9,10обращая особое внимание на микроРНК 11, эндогенно выразил небольшие некодирующих РНК участвует в контроле практически всех клеточных функций, как плейотропных и комбинаторных регуляторов экспрессии генов.

Почти через 10 лет после микроРНК первоначального открытия в Caenorhabditis Элеганс по Ambros и лабораторий Ruvkun в, повышенное внимание было обращено к области, когда большое число микроРНК были выявлены у дрозофилы и в клетках человека, а 12-15. С тех пор, благодаря универсальным трансгенных подходов, Дрозофилы выдалась как ценный биологическом контексте для углубляясь в микроРНК биосинтеза и деятельности. Drosophila микроРНК выявили различные функции в насекомых-специфических или эволюционно консервативных процессов, охватывающих от старения для метаболизма, сигнальных путей , поведение и, конечно, нейрогенез. Наряду этом направлении, мы недавно представила новый ссылку 16 в интригующей сотрудничестваrrelation происходит между мастер гена г см / скольжения и РНК пути. Коэффициент муха транскрипции GCM / Glide 17-19 представляет собой уникальный пример клеточной судьбы определителя, который диктует глиальных против нейронов выбор судьбы в мультипотентных летать нейронных предшественников 20. Двадцать год исследования по этой теме явно подчеркнул возникновение многочисленных и дублирующих друг друга входам регуляции экспрессии генов сходящийся над ГКМ / скользить 21-28 установить пороговые уровни, необходимые для балансировки нежную соотношение между нейронными и глиальных коллегами во время развития нервной системы.

Мы обнаружили, что регулирование с помощью DMEL-miR279 таргетинга представляет собой иной уровень управления, способствующий посттранскрипционных тонкой настройки гсм / скользить выражение 16. Во всем мире, эти направления исследований требуют от конкретные методологические усовершенствования: наряду лет, несколько технологий, первоначально разработанный для анализа традицitional РНК были преобразованы для количественного небольшие удобства РНК, кодирующие, вроде как анализов на защиту от РНКазы, кДНК массивов 29-31, ПЦР в реальном времени методов 32-35 и секвенирования 36,37. С другой стороны, калибровка технических подходов способствовала непрерывные прогрессирует в области.

Нозерн-блот анализ (NB, или РНК гель-блот-анализ) представляет репрезентативную экземпляр: она в значительной степени используется для профилирования накопление РНК, так как он обеспечивает как уровень экспрессии количественного а также определение размера. Тем не менее, внутренняя бедных чувствительность метода ограничивает, когда он должен быть применен к низкой обильных экспрессии генов тонких тюнеров, как коротких РНК. Вредным следствием является требование больших количеств суммарной РНК, которая затрудняет его применение в конкретных биологических образцах. По этим причинам, конкретных вариантов NB для малого обнаружения РНК были разработаны 38-40: мы воспользовались улучшенным NB прокedure 41 (ENB, Enhanced Северная Клякса), в то время как выяснения вышеуказанное взаимодействие между DMEL-miR279 и г см / скольжения.

Этот метод основан на шаге химической сшивки на основе активности производного карбодиимида [1-этил-3- (3-диметиламинопропил) карбодиимид, EDC], чтобы зафиксировать нуклеиновой кислоты на твердых подложках. Карбодиимида является универсальным сшивани, как известно, катализируют образование амидных связей между активированными карбоксильными или фосфатных групп и аминогрупп 42. Это свойство может быть использовано для ковалентно пару малых РНК с помощью их моно-фосфорилируются 5'-гидроксильной группы до аминогрупп на поверхности нейлоновые мембраны. Полученную конфигурации крепления повышает доступность иммобилизованным нуклеиновой кислоты и, в свою очередь, эффективность гибридизации зонд-мишень, что приводит к повышению замечательной обнаружения 43.

Методика предполагает особое relevancе в Drosophila молекулярных исследований, с помощью которых возникновение новых и отличительных классов малых РНК некодирующих становится 44. Среди них, rasiRNAs 45,46 составляют особую подтип Piwi взаимодействующих РНК (пиРНК 47), участвующих в последовательности конкретных молчания генов. Оперативные Детали этого метода полностью описаны и визуализировали далее, по отношению к анализу микроРНК DMEL-miR279 и DMEL-miR286 и, в первый раз, одного rasiRNA, rasi4. Мы толкнул до крайности этот метод, который позволил нам выявить плохо выраженные цели с минимальным количеством РНК (менее 1 мкг).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1 Сбор образцов

  1. Снять 2 клетки полу-приверженцем Шнайдера, (1-5 х 10 6 клеток в среднем), с помощью пипетки и собирать их с помощью центрифугирования (100 мкг в течение 1 мин). В случае, культивированных в пробирке адгезивных клеток, Trypsinize их в стандартных условиях или непосредственно собирают их из пластин в удобном количестве РНК извлечения реагента, по помощью клеточным скребком.
  2. Для получения эмбрионов, растут линии дрозофил в лету клетках и пусть эмбрионы накапливаются на откладки яиц пластин. Протрите эмбрионов прочь кистью в дистиллированной воде (DH 2 O), отбросить мусор ситовым фильтрации, промыть и восстановить эмбрионов в пробирке 48.
  3. В качестве альтернативного метода, вручную рассекают ткани / органы. Изолировать яички (преимущественное системы для анализа Пирны) из Drosophila живота в фосфатно-солевом буфере (PBS) при помощи стереомикроскопа (20-кратным увеличением), с помощью иглы или рассечение пинцет, как по отношениюualized в Sullivan и соавт 49.
  4. Пестик гомогенизации образцы по наркомании 0,5 объемов добычи РНК реагента.

2 Экстракция РНК / Анализ

  1. Перечень поручений по итогам производителей выполнить изоляцию РНК через коммерческие реагентов. ВНИМАНИЕ! Выделения РНК агенты, как правило, токсичны и каустической. В качестве альтернативы, применить протеиназы К на основе протокола для изоляции 50 РНК, а именно:
    1. Развести образцы в 400 мкл стоп-Микс и инкубируют при комнатной температуре в течение 15 мин.
    2. Восстановление водорастворимые компоненты от стандартной фенол: хлороформ: изоамиловый спирт и хлороформом и этанолом (этанола) осадков / мытья. Воздух сухой образцы и ресуспендируйте в диэтилпирокарбонатом (DEPC) -обработанной дважды дистиллированной (дд) H 2 O.
  2. Оценка концентрации РНК УФ спектрофотометрическим измерением. Также убедитесь, чистота РНК высока, близко к 2,0, басред на A 260/280 чтение.
  3. Проверка препарат РНК на денатурирующих агарозном геле следующим образом:
    1. В чистом стакане, растворить 1,2 г агарозы в 82 мл DEPC-DDh 2 O, при непрерывном перемешивании. Варить до полного растворения.
    2. Разрешить решение гель остыть; когда температура достигает 60 ° C добавляют 10 мл 10Х 4-morpholinepropanesulfonic кислоты (МОПС) буфер для 1X конечной концентрации (ФК), и 8 мл 37% формальдегида в 3% FC. ВНИМАНИЕ! Формальдегид является канцерогеном.
    3. Налейте гель в горизонтальном электрофореза ячейки. Разрешить гель для отверждения под колпаком в течение по крайней мере 1 часа. После затвердевания, погрузите гель в MOPS 1X.
    4. Алиготе 2 мкг образца РНК и 1 мкг Лествичник (использовать РНК маркер, когда правильная оценка желательно). Добавить 3 тома агарозном красителем (ALD) на РНК и лестницы. Нагревают при 70 ° С в течение 5 мин и сразу же охладили на льду. CAUTION! Содержание ALD (этидийбромид и формамидные см Материалы) являются мутагенным и коррозию, соответственно.
    5. Загрузите образцы и запустить гель при 50 В в течение приблизительно 1 часа, периодически утилизации буфера. Проверьте РНК фракционирования шаблон УФ-визуализации или изображений гель. Признать дискретные полосы, соответствующие 28S и 18S рРНК и тРНК (рисунок 1).
  4. Перейдите к Северной Пробирной или магазина РНК при -80 ° С.

3 денатурирующих гель акриламида Подготовка

  1. Используйте маленькую вертикальную электрофоретическую аппарат для этого фракционирования стадии (размер пластины около 8 см х 9 см, гребень Толщина 0,75 мм).
  2. Сборка чистые стаканы вместе в литейной рамы.
  3. Подготовьте 10 мл 10% акриламида / бис-акриламида (19: 1) решение в MOPS 1X, 7 М мочевину. Сразу перед заливкой, добавить 100 мкл 10% персульфата аммония и 10 мкл TEMED и быстро перемешать раствор. ВНИМАНИЕ! Акриламид нейротоксичен и канцерогеном.
  4. Вылейте гель между стеклянными пластинами и вставьте расческу также тщательно, чтобы избежать пузырей. Пусть гель полимеризации при комнатной температуре в течение по крайней мере 45 мин перед использованием. Кроме того, хранить гель O / N, завернутый в насыщенных водой фильтровальной бумаги и запечатаны в Саран обертывание.

4 Подготовка образцов

  1. Аликвоты 0,5-20 мкг общей РНК для каждого образца. Если объем превышает 3-4 мкл, вакуумная высушить образец.
  2. Для определения размера, запускать аликвоту (20-30 сП) меченого низкого диапазона лестницы параллельно с образцами, в качестве маркера (смотри раздел 4.3 и 4.4 для подготовки). Treat его параллельно с образцами, как описано на стадии 4.5.
  3. Лестница: настроить фосфата прямой реакции, используя 0,1 мкг на 10 б.п.-стремянки. Инкубируют при 37 ° С в течение 30 мин, а остановить реакцию, добавив этилендиаминтетрауксусную кислоту (ЭДТА) в 20 мМ FC.
  4. Очищают этанола осадков / мытья, сухой воздух иресуспендируйте в DDh 2 O (около 100 мкл). ВНИМАНИЕ! 32 P является радиоактивный источник.
  5. Для каждого образца добавляют равный объем акриламида синего красителя (ABD). Денатурируют нагреванием при 80 ° С в течение 5 мин и охладили на льду до погрузки. ОСТОРОЖНО! Формамид (содержание в ABD) вызывает коррозию.

5 Электрофоретическое Фракционирование

  1. Снимите стеклянные пластины из литья поддержки и правильно собрать их в электрофореза ячейки. Заполните как внутреннюю и внешнюю камеру с достаточной рабочим буфером (РБ).
  2. Аккуратно удалите гребень и предварительно запустить гель при 200 V в течение 10 мин. Перед загрузки образцов, смыть отложения мочевины из колодцев, впрыскивая некоторое RB через шприц.
  3. Используйте плоские советы, чтобы тщательно стратифицировать образцы шагом 4,5 в нижней части каждой скважины. Проверьте анодных и катодных соединения, чтобы избежать перевернутую работает. После того, как образцы проникать в гель при 100 V в течение 5 мин, яncrease напряжение до 200 В.
  4. При длине фракционирования от около 7 см, 45 мин долгосрочной перспективе является достаточным. Избегайте бромфеноловый синий (отслеживание пигмента в ABD) переполнять гель.
  5. Представьте на-гель фракционированных длинные РНК от этидийбромидом (EtBr) окрашивания, в качестве дополнительного шага:
    1. Обрежьте 2 см от верхней части геля и кратко промыть фрагмент в DDH 2 O.
    2. Инкубируйте срез геля при комнатной температуре в течение 15 мин при осторожном shacking в РБ, EtBr 0,5 мкг / мл FC.
    3. Destain геля в течение 15 мин в РБ, визуализировать длинные рРНК от УФ-облучения или изображений гель. Проверьте РНК погрузки и качества (см рис 1, панели 7). ВНИМАНИЕ! Бромид этиди является мутагенным.
  6. В то же время приступить блоттинга нижнюю часть геля, содержащего мелких видов РНК.

6 блоттинга

  1. Вырезать 6 кусков промокашки, чтобы соответствовать область блоттинга и эквивалентную часть unchargeд нейлоновую мембрану. Смочите листов бумаги, мембраны и 2 блоттинга колодки в РБ. Убедитесь, что полностью впитаться колодки, несколько раз сжимая их в РБ.
  2. Удалить гель из аппарата и открыть стаканы на среднем помощью шпателя. Используйте чистую резак для удаления скважин. Поместите лист мокрой ватмане на геле и осторожно поднимите его.
  3. Поместите нейлоновую мембрану на свободной поверхности геля. Отметить угол ориентировать фильтр в соответствии с нагружения образца. Заполните «сэндвич» (3 бумажные кусочки с каждой стороны). Рулон пластиковый стержень на поверхности блот, чтобы удалить любые возможные пузырьки воздуха.
  4. Поместите кляксу между двумя блоттинга колодки и затем в фильтровальную кассету. Соберите кассету в промокательной модуля, заполнить камеру с РБ и проверить правильность ориентации (нейлоновую мембрану должны остаться между гелем и положительного конца).
  5. Перевести на 20 V в течение 20 мин. Примечание: для обеспечения однородных условий, через 10 мин открыть промокательной модуль и гotate бутерброд на 180 ° до передачи.

7 Мембрана Сшивание

  1. Подготовьте 6 мл свежей сшивания решения (XLS). Пропитайте 10 см х 10 см (больше, чем нейлоновую мембрану) кусок промокательной бумаги с XLS. ВНИМАНИЕ! HCl (компонент XLS) отличается высокой агрессивностью.
  2. Разберите кляксу и поместите мембрану на мокром 3 мм фильтровальной бумаги. Примечание: РНК, не должен быть в непосредственном контакте с насыщенным бумаги. Поместите фильтр и бумагу между двумя стеклянными пластинами и завернуть в Саран пленку.
  3. Нагреть мембраны при 60 ° С в течение 2 ч, а затем в DDH 2 O стирки. Хранить при температуре -20 ° C или перейти к гибридизации.

8 Мембрана Предгибридизацию

  1. Если РНК погрузка была проверена (необязательный шаг 5.5), непосредственно перейти к гибридизации. Или же, срезать 1 см от до верхней части нейлоновый фильтр, чтобы избежать перекрестного зонда hybridizatioнс до фракционированных длинных РНК.
  2. Разогреть 10 мл раствора гибридизации (HS) при 37 ° С. Денатурируют 1 мг спермы лосося при 95 ° С в течение 5 мин, охлаждают на льду и добавить к HS.
  3. Инкубируйте фильтр в HS при 37oC в течение по крайней мере 1 ч, при вращении в гибридизации печи. Убедитесь, что РНК-часть фильтра обращена HS.

9 Probe Синтез

  1. Настройка прямой реакции фосфата на 10 пмоль антисмыслового олигонуклеотида определенной, как описано в 4.3.
  2. Добавить 5 объемов Трис-ЭДТА-NaCl (десять) буфер для реакции и очистки меченого праймера от некорпорированных нуклеотидов с помощью гель-эксклюзионной хроматографии на колонках G-25 Sephadex (или также EtOH осадков). Зонд деятельность может быть оценена с помощью жидкостного сцинтилляционного счетчика.

10. Мембрана Гибридизация

  1. Замените исчерпаны УГ со свежим 10 мл аликвоты (полученного и дополняется, как описано выше). Нагрейте датчик на95 ° С в течение 10 мин, охлаждают на льду и добавить к новым HS. Выдержите фильтр на 37 ° C ON.

11. Мембрана Стиральная

  1. Восстановление растворе для гибридизации и хранить его при температуре -20 ° С в радиоактивности-экранирования коробки.
  2. Промойте фильтр в промывочным буфером (ВБ) и промойте его тщательно в течение 10 мин при комнатной температуре.
  3. Используйте Гейгера Мюллера детектор для проверки остаточной радиоактивности в углах фильтров. Когда фон излучения составляет около 5 гц, приступить к мембранным экспозицию.

12. обнаружения сигнала

  1. Expose фильтр на авторадиографии фильмов или на молекулярном на экране тепловизора. Выявить сигналы от фотографической обработки или цифрового преобразования.
  2. Анализ интенсивности полосы специального программного обеспечения количественного (ImageJ или OptiQuant).

13. Мембрана для зачистки

  1. Чтобы удалить первичные сигналы, погрузить мембраны в 500 мл кипящей десорбирующего раствора, А затем инкубируют при комнатной температуре в течение 1 мин. Перейдите к новой (предварительно) гибридизации и не храните фильтр при -20 ° С.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Следуя общую процедуру, описанную в тексте, а схематически представлено на рисунке 1, мы оценивали экспрессию малых РНК из сложных образцов РНК различного происхождения. В эксперименте, представленной на рисунке 1, РНК выделяли из 2 клеток дрозофилы Шнайдера по добыче протеиназы К, проверяется на целостность (необязательной стадии: денатурирующих агарозном геле фракционирования) и загружается в два раза. Одна половина геля нанесены на нейтральной мембраны и химически сшитый с помощью EDC; Вторая половина была переведена на положительно заряженной нейлоновый фильтр, то УФ сшитый (1,2 х 10 5 мкДж / см 2). Эндогенная экспрессия двух микроРНК, принадлежащих к семейству DMEL-miR279 (сам DMEL-miR279 и DMEL-miR286 15) была проверена в обоих условиях. Улучшенная процедура (ENB) обеспечивает более высокую уважение чувствительности к стандартной (СНБ).

рисунках 2 и 3. Экспериментальное обоснование такой же, как указано выше: здесь мы приводим представительный результат Нозерн-блот авторадиографического обнаружения rasi4 Пирны вдоль титрованием общей РНК, выделенной из взрослого летать яички. ENB уже позволяет обнаруживать конкретную группу, когда 0,5 мкг РНК загружен. Количественное сторону показывает, как сигнал пропорционально возрастает с увеличением количества РНК фракционированных, указывающий, что отношение доза / ответ лежит в линейном диапазоне обнаружения. Панель ниже ратифицирует улучшенную чувствительность этого метода по сравнению с SNB. В этом случае, обнаружить сигнал получается при электрофоретических фракционирования 10 мкг РНК, по крайней мере для СНБ.

Аналогичные результаты получены с различных видов некодирующая РНК, например, 5S рРНК, как сообщил на рисунке 3 </ STRONG>.

Рисунок 1
Рисунок 1. Схематическое изображение общей процедуры Северная Клякса. Основные этапы процедуры перечислены и постепенно пронумерованы. Результаты сравниваются между Enhanced Северной блот (ENB) и Standard Северной блот (СНБ), выполненной в тех же условиях: Выделение РНК из 2 клеток дрозофилы Шнайдера (панель 1), электрофореза (Панель 2), передачи (панели 3) и гибридизации ( Панель 5). ENB относится к улучшенной процедурой, описанной в настоящем докладе, который требует нейтральный фильтр (Панель 3, левая половина мембраны) и EDC основе сшивания (Панель 4), который устанавливает ковалентную связь между РНК-мишени 5'-конце и мембраны ( розовые точки в панели 4). В СНБ, РНК сшивания получается УФ лечения (Panel 4) на положительно заряженный Nyloн мембраны (Панель 3, правая половина мембраны). 5S РНК конкретных сигнал не калибратора в сравнительных условиях, потому что он также реагирует на разницу между СНБ и процедуры ENB. Таким образом, количество (что соответствует 10 гц) из 5'-меченого (см баллов 4,3 и 4,4 протокола), 50 нуклеотидов яичница олигонуклеотид был добавлен в каждом образце до электрофореза, чтобы функционировать в качестве "всплеска" ссылки ( Панель 7). Загрузка может быть также оценена по на-гель EtBr окрашивания длинных рРНК (см пункт 5.5 протокола). L = Лестница. FV = Фронтальная вид, LV = Боковой вид, HV = Горизонтальный. Пожалуйста, нажмите здесь, чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 2
Рисунок 2 Comparтельный Северная Клякса анализ rasi4 выражения. эндогенные уровни яичка конкретных PIRNA rasi4 выявлены повышенной (ENB) или стандартного (СНБ) Северной блот, выполнены на все большее количество общей РНК (указанной выше каждой дорожке), извлеченной из взрослых Drosophila яичек , или из цельных животы (Абд). Для каждой методологии, гистограмм в сторону сообщить относительных количеств rasi4 относительно того же количества «шип в" контроля загрузки. Количественными от двух методов объединяются в заключительной графе, расположенной под гелей. Пожалуйста, нажмите здесь, чтобы посмотреть увеличенную версию этой фигуры.

Рисунок 3
Рисунок 3 Сравнительный Нозерн-блот анализ 5s RРНК выражение. В качестве положительного контроля и экспериментальной калибровки, предыдущий анализ был продлен до 5S рРНК. Детали, как на рисунке 2. Пожалуйста, нажмите здесь, чтобы посмотреть увеличенную версию этой фигуры.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Хотя наша оценка из усложняем сплетающего через который РНК регулирует нейрогенез постоянно растет, механистические последствия РНК на основе электрических схем, затрагивающих нервную биологию стволовых клеток, дифференцировку нейронов / функциональной интеграции, развитие нервных патологий и рака остаются неисследованными. Поддержание таких сетей через царств делает потенциал генетических систем, как дрозофилы важную разгадать неисследованные клеточных путей, в котором короткие некодирующие РНК и факторы транскрипции которые рассматриваются в качестве основных молекулярных игроков. С этой точки зрения, профилирование кандидатов малых уровней экспрессии РНК пропедевтика в точных функциональных анализов: пример из нашей недавней демонстрации, что DMEL-miR279 модулирует GCM / скольжения судьба определитель в естественных условиях, проделанной через улучшенной версии Северная блоттинга анализа как инструмент для анализа экспрессии.

51, NB стала рассматриваться в качестве опорного метода для анализа РНК. Несмотря на некоторые внутренние ограничения этого анализа, как на сложную преобразования для мультиплексирования формата или возможные ошибки с сигнала количественного, последние достижения в области молекулярной биологии РНК открыли вновь этот общепринятой методике в качестве "быстрого и чистого" системы будут анализироваться эндогенной экспрессии небольшой рибонуклеиновой кислоты или для проверки эффективности амплитудно или с потерей функции подходов. Как парадигматической Например, Северная анализ лежит в основе первоначального открытия микроРНК, в то время как подход остается на переднем крае для ее актуальности в характеристике все новых и новых свойств регуляторных РНК 52.

Вариант описано здесь, основан на повышенной чувствительности за счет химической сшивки РНК. Мы believethe метод до сих пор плохо работают у дрозофилы, бут, когда эксплуатируются привели к значительным открытиям 52, так как это делает возможным выражение профилирование РНК из небольших образцов (менее 1 мкг), со средним 10-30 кратное улучшение РНК обнаружения цели 41,43, как мы получили в наших условиях (Рисунки 2 и 3).

Целостность РНК является важнейшей задачей для получения последовательных и воспроизводимых результатов. РНК манипуляции требуют точности и быстроты ограничить возможное ухудшение образца, происходящих между добычей и погрузки. На этой цели, все решения должны быть diethylpyrocarbonate- (DEPC) обрабатывают перед использованием (2 ч инкубации в присутствии 0,1% DEPC при 37 ° С, а затем в автоклаве), чтобы обойти РНКазы активность. Решение лечения гарантирует лучшие результаты уважение к помощи DEPC воды в качестве растворителя. Все оборудование будет одинаково промыть в DEPC ddH20, после очистки от РНКазы-удельная поверхность дезинфицирующим.

(например, rasi4, Figure2) или когда очистки РНК не выполняется на свежих образцах (например, сохраняется в хранилище ткани реагенты). Из опыта, для выделения РНК из образцов стабилизированного привело значительно жестче и требуется более жесткие условия добычи. В стандартных условиях, описанный способ протеиназы К основе гарантирует хорошего качества препаратов, а, (показательный пример представлена ​​на рисунке 1), но это не является оптимальным выбором для образцов сохранившихся в реагентов хранения.

Наконец, так как эта процедура направлена ​​на небольшой РНК-специфической детекции, очистки на основе наборов посвящен столбцов могут быть использованы для прямого небольшой выделения РНК, несмотря на то, гоесть делает труднее для проверки целостности РНК. В альтернатива классическому процедуры гель на основе для контроля целостности РНК, описанной выше, качество РНК может быть оценена с помощью инструментов на кристалле миниатюрных моделей анализа нуклеиновых кислот.

Буфер Выбор: MOPS-NaOH (рН 7) был предложен в качестве преимущественного буфера для расширенного как электрофореза гель и Северной блоттинга. Мы также удовлетворительно использоваться Трис-борат-ЭДТА (КЭ) буфер в наших экспериментах. В этом случае, так как наличие нуклеофильных аминогрупп трис (гидроксиметил) аминометан бы гидролиза и инактивации DEPC во время лечения себя, рекомендуется растворять в Трис DEPC-обработанной воды вместо очистки буфера TBE уже подготовленной.

Электрофоретическое Run и Blotting: Pre-работает гель имеет важное значение для удаления избытка персульфата и ликвидации hyperfocusing. Параметры предварительного опытов должны поддерживаться также во время фракционирования, избегая слишком быстро electrophoМейснера выполнения. Перед загрузкой убедитесь, что для удаления возможных отложений мочевины из колодцев, впрыскивая буфер внутри. Это ограничит пример перетекания и гарантии точной РНК стратификации, производстве решены авторадиографические полосы во время обнаружения сигналов. Любой нейтральное нейлоновую мембрану можно использовать в качестве опоры для передачи нуклеиновой кислоты. Не промокните РНК для более 20-30 мин при определенных условиях.

Сшивание: EDC на основе химического сшивания представляет собой критический прорыв в методологии этого расширения Северной версии блот. Возможность для сшивания коротких РНК в нейтральное положение видов поверхностей ковалентными пределах между РНК 5'mono-фосфатной группы и нейлона первичных аминов выходит большинство баз, доступной для гибридизации. Это повышает чувствительность по 10-20xrespect к традиционной сшивания. Это имеет решающее значение для подготовки свежий количество сшивания решения для каждого блоттинга, в достаточном количестве для правильного насыщения мембраны.

Гибридизация и Стиральная: Зонды предпочтительно должны быть свеже помечены. Зонд удельную активность (в зависимости от конкретной деятельности, и количество включенного меченного нуклеотида, а также от количества зонда, доступной для гибридизации) определяет чувствительность обнаружения цели. Когда [γ- 32 Р] АТФ с удельной активностью 3000 Ки / ммоль используется, 10 6 имп / пмоль на 100% маркировки на 5'-концах, как ожидается.

Решение гибридизации могут быть восстановлены и использованы повторно, если учесть, что, в связи с 32 Р-распад, половинки датчик активности в примерно 14 дней.

В связи с мембранной нейтральности, низкий фоновый шум, как ожидается, при гибридизации. Если требуются более строгие условия промывки, постепенно сокращать промывочного буферного ионной силы (до 0,2 x SSPE) или добавить большее количество ионных детергентов (до 0,5% SDS) или поднять температуру стирки до 37 ° С.

Нозерн-блот анализ имеет важное значение, когда требуется измерение размера РНК. Даже при том, что этот анализ может не хватать точности флуоресценции основе КПЦР подходы для оценки крошечных РНК, преимущество получает от использования денатурирующих фракционирования / промокательной и зонд-зависимой гибридизации в качестве уникальных шагов до обнаружения целевых РНК. Следовательно, выявление специфических сигналов от образца является прямым и не требует дополнительной стадии ферментативной обработки / преобразования / усиления, что предполагает использование посвященных коммерческих наборов. Уровни РНК может быть количественно и по сравнению между несколькими образцов на отдельных мембран. Таким образом Northeр-н пятном обычно используется в качестве строгого проверки для данных КПЦР. Вдохновленные конкретных экспериментальных требований, метод был даже улучшилось в последние годы, как на уровне чувствительности и разрешения, так что ограниченное количество РНК (см рис 2 и 3) необходимы для успешного анализа.

Протокол мы представили могут быть адаптированы к широкому кругу приложений, особенно там, где материал доступен в ограниченных количествах. Биологическая источником образцов РНК может быть неоднородным: насколько обеспокоен Drosophila, эмбрионы или другие стадии развития подходят, но и вручную расчлененный тканей или органов, отдельных клеток сортировки изолированный cytotypes или клеточные культуры.

Кроме того, даже при том, что микроРНК являются наиболее распространенными класс коротких регуляторных РНК в клетке и крупного предмета исследования в области контроля экспрессии генов РНК-опосредованного, они не противбедственном единственный семейство сотовых некодирующих РНК. Многие кластеры крошечных РНК функционировать через царств (например, эндогенных интерферирующих РНК, пиРНК, snoRNAs, завод tasiRNAs) и большинство из них характеризуются от свободного 5'-конца (неизмененном), как правило, вытекающие из эндо-ribonucleolytic обработки молекул предшественников. Эта функция представляет собой уникальную структурную предпосылку строго необходимого для применения конкретного улучшенную методику, основанную на химической сшивки, даже при том, что размер РНК должны быть рассмотрены, а также, когда больше РНК анализировали. На рисунке 2 мы приводим анализ Северная Клякса сравнительно обнаружения уровни rasi4 54 членов одного класса зародышевой линии конкретных малых РНК (Piwi взаимодействующих РНК или пиРНК.) В ​​условиях плохой и конкретных уровней экспрессии, повышенная чувствительность этого метода может санкционировать успешные результаты, особенно если учесть, что сообщили протокол может быть дополнительно улучшена путем гребеньтка его с другими практической реализации уже описанных в литературе 55,56.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

Эта работа была поддержана Национальным институтом де ла Здоровье и де ла Recherche MEDICALE, Национальный центр де ла Recherche Scientifique, Университет Страсбурга, Hôpital де Страсбург, Ассоциация по ла Recherche сюр ле Рак, Национальный институт дю Рак, Agence Nationale-де-ла Recherche и региона Эльзас.

Пьетро LaNeve была поддержана Fondation Pour La Recherche MEDICALE. В настоящее время он является получателем Istituto Italiano Tecnologia (ИИТ) общения. Расходы на публикации поддерживаются сети Neurex (TriNeuron - Программа Interreg IV Рейн Верхний)

Materials

Name Company Catalog Number Comments
FINAL COMPOSITION/NAME COMPANY CATALOGUE (Stock) COMMENTS
GENERAL REQUIREMENT
Centrifuge, 5418 Eppendorf 5418 000.017
Decontaminant, RNase Away Sigma-Aldrich 83931 Apply on glass/plasticware, wipe and rinse
RNase inhibitor, DEPC Sigma-Aldrich D5758 Hazardous //// 1609-47-8
SAMPLE PREPARATION
Stereo Microscope, M60 Leica 
1X PBS Buffer
137 mM NaCl Sigma-Aldrich S3014 7647-14-5  
2.7 mM KCl Sigma-Aldrich P9541 7447-40-7 
10 mM Na2HPO4 Sigma-Aldrich S3264 7558-79-4 
1.8 mM KH2PO4 Sigma-Aldrich P9791 7778-77-0 
RNA EXTRACTION/ANALYSIS
UV-Vis Spectrophotometer Thermo Scientific Nanodrop 2000
Gel Imager, ChemiDoc XRS+ Biorad 170-8265
Horizontal Electrophoresys, Mini-Sub Cell GT BioRad 170-4487EDU
RNA extraction reagent, TRIzol Reagent Life Technologies 15596026 Hazardous
PCA (25:24:1), 1:1 for extraction Sigma-Aldrich 77617 136112-00-0
Chlorophorm, 1:1 for extraction Sigma-Aldrich C2432 67-66-3  
EtOH, 2.5 vol. for precipitation, 70% for washing Sigma-Aldrich 59844 64-17-5 
Gene Ruler 1Kb DNA Ladder Thermo Scientific SM0311
Stop Mix
300 mM NaOAc, pH 5.5 Sigma-Aldrich S2889 127-09-3
1x RSB Solution
2% sodium dodecyl sulfate (SDS) Sigma-Aldrich 71736 Never cool down SDS to avoid  precipitation //// 151-21-3
2 mg/ml Proteinase K Roche Applied Science 0-3115828001 EC 3.4.21.64 9
10X Reticulocyte Standard Buffer (RSB)
100 mM Tris-Cl, pH 7.4 Sigma-Aldrich T5941 1185-53-1  
100 mM NaCl Sigma-Aldrich S3014 7647-14-5  
30 mM MgCl2 Sigma-Aldrich M8266 7786-30-3
Denaturing Agarose Gel
1.2% Agarose Sigma-Aldrich A9539 Let the gel solidify for at least 1 hr //// 9012-36-2
10X MOPS Buffer
0.2 M MOPS sodium salt, pH 7 Sigma-Aldrich M9381 Do not confuse MOPS sodium salt with MOPS //// 71119-22-7
Agarose Loading Dye
1x MOPS Buffer
3% formaldehyde Sigma-Aldrich F8775 Hazardous //// 50-00-0
50% formamide Sigma-Aldrich 47670 Hazardous //// 75-12-7
Ethidium bromide (EtBr) 30 μg/ml Sigma-Aldrich E1510 Hazardous //// 1239-45-8
Bromophenol blue  Sigma-Aldrich B0126 115-39-9 
SMALL RNA FRACTIONATION
Flat gel loading tips Life Technologies LC1002
Savant SpeedVac Concentrator Thermo Scientific  DNA120
Vertical Electrophoresis, Mini-PROTEAN Tetra Cell  Biorad 165-8000
Denaturing Acrylamide Gel
10% acrylamide/bis-acrylamide (19:1) Sigma-Aldrich A3449 Hazardous. Let the gel polymerize for 45 min before use
1x TBE Buffer (or 1x MOPS Buffer)
7 M urea Sigma-Aldrich U6504 57-13-6
0.1% ammonium persulfate Sigma-Aldrich 215589 7727-54-0 
0.1% TEMED Sigma-Aldrich T9281 110-18-9
Gene Ruler Ultra Low Range DNA Ladder (10 bp-step) Thermo Scientific SM1211 Label 0.1 μg, as described in the "probe labeling" reaction
Acrylamide Blue Dye 
50% formamide Sigma-Aldrich 47670 Hazardous //// 75-12-7
Bromophenol blue Sigma-Aldrich B0126 115-39-9 
Running Buffer (RB)
1x MOPS Buffer 
Alternative RB: 1x TBE Buffer
1x TBE Buffer
5X TBE
445 mM Tris-base Sigma-Aldrich T1503 77-86-1 
445 mM boric acid Sigma-Aldrich B7901 10043-35-3
20 mM EDTA Sigma-Aldrich EDS 60-00-4  
Gel Staining Solution
Ethidium bromide 0.5 μg/ml Sigma-Aldrich E1510 Hazardous //// 1239-45-8
1x RB Stain for 15 min with EtBr, destain for 15 min w/o EtBr
BLOTTING
3MM Whatman paper Sigma-Aldrich Z270849
Neutral Nylon Membrane, Hybond NX GE Healthcare Life Science RPN203T Photosensitive
CROSSLINKING
Crosslinking Solution (XLS)
1% 1-methylimidazole (v/v) Sigma-Aldrich 336092 Always prepare a fresh aliquot of XLS //// 616-47-7
12.5 mM HCl Sigma-Aldrich H1758 Hazardous //// 7647-01-0
3.1% EDC (w/v) Sigma-Aldrich 3450 25952-53-8  
(PRE)-HYBRIDIZATION
Liquid Scintillation Counter  Beckmann LS 6500
Sheared Salmon Sperm, 0.1 mg/ml  Life Technologies AM9680
rasi4 anti-sense probe 5' CGGUGUUCGACAGUUCCUCGGG -3'
5s-rRNA anti-sense probe 5'-CAACACGCGGTGTTCCCAAGCCG-3'
Dmel-miR279 anti-sense probe 5'-TTAATGAGTGTGGATCTAGTCA-3'
Dmel-miR286 anti-sense probe 5'-AGCACGAGTGTTCGGTCTAGTCA-3'
Purification Kit, Illustra MicroSpin G-25 Columns GE Healthcare Life Science 27-5325-01
(Pre)-Hybridization Solution (HS)
0.5% SDS Sigma-Aldrich 71736 151-21-3 
5x Denhardt's Solution
20X SSPE
3.6 M NaCl Sigma-Aldrich S3014 7647-14-5  
0.2 M sodium phosphate Sigma-Aldrich 342483 7601-54-9  
20 mM EDTA (pH 8.0) Sigma-Aldrich EDS  60-00-4  
50x Denhardt's Solution
1% Ficoll 400 (w/v) Sigma-Aldrich F2637 26873-85-8
1% Polyvinylpyrrolidone Sigma-Aldrich PVP40 9003-39-8
1% BSA Sigma-Aldrich A7906 9048-46-8  
1X TEN Buffer
10 mM Tris-Cl (pH 8.0) Sigma-Aldrich T1503 77-86-1 
100 mM NaCl Sigma-Aldrich S3014 7647-14-5  
1 mM EDTA (pH 8.0) Sigma-Aldrich EDS 60-00-4  
Probe Labelling
0.4 μM oligonucleotide
1.5 μl Ci/μl [γ-32P] ATP Perkin Elmer NEG002A Hazardous //// 51963-61-2
1x T4 Polynucleotide Kinase Buffer Biolabs B0201
T4 Polynucleotide Kinase 0.5 units/μl Biolabs M0201 EC 2.7.1.78
WASHING
Geiger Mueller Detectors Canberra Industries MCB2/CPS – EM77021
Washing Buffer (WB), 2x SSPE
Stringent Washing Buffers
0.2x SSPE
2x SSPE, 0.5% SDS
0.2x SSPE, 0.5% SDS
SIGNAL DETECTION
PharosFX Plus System Biorad 170-9460
Image J Freely available
Quantity One Biorad
X-ray films , BioMax XAR Sigma-Aldrich F5888 Photosensitive
Developer for X-ray films Sigma-Aldrich P7042
Fixer for X-ray films Sigma-Aldrich P7167
STRIPPING
Stripping Solution
10 mM Tris-HCl pH 8.8 Sigma-Aldrich T1503 77-86-1 
5 mM EDTA Sigma-Aldrich EDS 60-00-4  
0.1% SDS Sigma-Aldrich 71736 Add SDS after boiling to avoid foaming //// 151-21-3

DOWNLOAD MATERIALS LIST

References

  1. The RNA World. Gesteland, R. F., Cech, T. R., Atkins, J. F. 3rd, Cold Spring Harbor Laboratory Press. (2006).
  2. Mercer, T. R., Dinger, M. E., Mattick, J. S. Long non-coding RNAs: insights into functions. Nat Rev Genet. 10, 155-159 (2009).
  3. Salmena, L., Poliseno, L., Tay, Y., Kats, L., Pandolfi, P. P. A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell. 146, 353-358 (2011).
  4. Cesana, M., et al. A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA. Cell. 147, 358-369 (2011).
  5. Orphanides, G., Reinberg, D. A unified theory of gene expression. Cell. 108, 439-451 (2002).
  6. Mehler, M. F., Mattick, J. S. Noncoding RNAs and RNA editing in brain development, functional diversification, and neurological disease. Physiol Rev. 87, 799-823 (2007).
  7. Fire, A., Xu, S., Montgomery, M., Kostas, S., Driver, S., Mello, C. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391, 806-811 (1998).
  8. Hamilton, A., Baulcombe, D. A species of small antisense RNA in posttranscriptional gene silencing in plants. Science. 286, 950-952 (1999).
  9. Lee, R. C., Feinbaum, R. L., Ambros, V. The C. Elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 75, (1993).
  10. Wightman, B., Ha, I., Ruvkun, G. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell. 75, 855-862 (1993).
  11. Fabian, M. R., Sonenberg, N., Filipowicz, W. Regulation of mRNA translation and stability by microRNAs. Annu Rev Biochem. 79, 351-379 (2010).
  12. Pasquinelli, A. E., et al. Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature. 408, 86-89 (2000).
  13. Lagos-Quintana, M., Rauhut, R., Lendeckel, W., Tuschl, T. Identification of novel genes coding for small expressed RNAs. Science. 294, 853-858 (2001).
  14. Lau, N. C., Lim, L. P., Weinstein, E. G., Bartel, D. P. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science. 294, 858-862 (2001).
  15. Lee, R. C., Ambros, V. An extensive class of small RNAs in Caenorhabditis elegans. Science. 294, 862-864 (2001).
  16. Laneve, P., et al. The Gcm/Glide molecular and cellular pathway: new actors and new lineages. Dev Biol. 375, 65-78 (2013).
  17. Hosoya, T., Takizawa, K., Nitta, K., Hotta, Y. Glial cells missing: a binary switch between neuronal and glial determination in Drosophila. Cell. 82, 1025-1036 (1995).
  18. Jones, B. W., Fetter, R. D., Tear, G., Goodman, C. S. Glial cells missing: a genetic switch that controls glial versus neuronal fate. Cell. 82, 1013-1023 (1995).
  19. Vincent, S., Vonesch, J. L., Giangrande, A. Glide directs glial fate commitment and cell fate switch between neurons and glia. Developement. 122, 131-139 (1996).
  20. Cattenoz, P. B., Giangrande, A. Lineage specification in the fly nervous system and evolutionary implications. Cell Cycle. 12, 2753-2759 (2013).
  21. Jones, B. W., Abeysekera, M., Galinska, J., Jolicoeur, E. M. Transcriptional control of glial and blood cell development in Drosophila: cis-regulatory elements of glial cells missing. Dev Biol. 266, 374-387 (2004).
  22. Ragone, G., et al. Transcriptional regulation of glial cell specification. Dev Biol. 255, 138-150 (2003).
  23. Akiyama-Oda, Y., Hosoya, T., Hotta, Y. Asymmetric cell division of thoracic neuroblast 6-4 to bifurcate glial and neuronal lineage in Drosophila. Development. 126, 1967-1974 (1999).
  24. Bernardoni, R., Kammerer, M., Vonesch, J. L., Giangrande, A. Gliogenesis depends on glide/gcm through asymmetric division of neuroglioblasts. Dev Biol. 216, 265-275 (1999).
  25. Ragone, G., Bernardoni, R., Giangrande, A. A novel mode of asymmetric division identifies the fly neuroglioblast 6-4T. Dev Biol. 235, 74-85 (2001).
  26. Soustelle, L., Roy, N., Ragone, G., Giangrande, A. Control of gcm RNA stability is necessary for proper glial cell fate acquisition. Mol Cell Neurosci. 37, 657-662 (2008).
  27. Akiyama, Y., Hosoya, T., Poole, A. M., Hotta, Y. The gcm-motif: a novel DNA-binding motif conserved in Drosophila and mammals. Proc. Natl. Acad. Sci. USA. 25, 14912-14916 (1996).
  28. Miller, A. A., Bernardoni, R., Giangrande, A. Positive autoregulation of the glial promoting factor glide/gcm. EMBO J. 17, 6316-6326 (1998).
  29. Krichevsky, A. M., King, K. S., Donahue, C. P., Khrapko, K., Kosik, K. S. A microRNA array reveals extensive regulation of microRNAs during brain development. RNA. 9, 1274-1281 (2003).
  30. Liu, C. G., et al. An oligonucleotide microchip for genome-wide microRNA profiling in human and mouse tissues. Proc. Natl. Acad. Sci. USA. 101, 9740-9744 (2004).
  31. Yin, J. Q., Zhao, R. C., Morris, K. V. Profiling microRNA expression with microarrays. Trends Biotechnol. 26, 70-76 (2008).
  32. Schmittgen, T. D., Jiang, J., Liu, Q., Yang, L. A high-throughput method to monitor the expression of microRNA precursors. Nucleic Acids Res. 32, E43 (2004).
  33. Chen, C., et al. Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res. 33, e179 (2005).
  34. Shi, R., Chiang, V. L. Facile means for quantifying microRNA expression by real-time PCR. Biotechniques. 39, 519-525 (2005).
  35. Raymond, C. K., Roberts, B. S., Garrett-Engele, P., Lim, L. P., Johnson, J. M. Simple quantitative primer-extension PCR assay for direct monitoring of microRNAs and short-interfering RNAs. RNA. 11, 1737-1744 (2005).
  36. Wang, Z., Gerstein, M., Snyder, M. RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet. 10, 57-63 (2009).
  37. Linsen, S. E., et al. Limitations and possibilities of small RNA digital gene expression profiling. Nat Methods. 6, 474-476 (2009).
  38. Valoczi, A., et al. Sensitive and specific detection of microRNAs by northern blot analysis using LNA-modified oligonucleotide probes. Nucleic Acids Res. 32, e175 (2004).
  39. Varallyay, E., Burgyan, J., Havelda, Z. Detection of microRNAs by Northern blot analyses using LNA probes. Methods. 43, 140-145 (2007).
  40. Kim, S. W., et al. A sensitive non-radioactive northern blot method to detect small RNAs. Nucleic Acids Res. 38, e98 (2010).
  41. Pall, G. S., Hamilton, A. J. Improved northern blot method for enhanced detection of small RNA. Nat Protoc. 3, 1077-1084 (2008).
  42. Hermanson, G. T. Bioconjugate Techniques. 2nd, Academic Press, Inc. (2008).
  43. Pall, G. S., Codony-Servat, C., Byrne, J., Ritchie, L., Hamilton, A. Carbodiimide-mediated cross-linking of RNA to nylon membranes improves the detection of siRNA, miRNA and piRNA by northern blot. Nucleic Acids Res. 35, e60 (2007).
  44. Guzzardo, P. M., Muerdter, F., Hannon, G. J. The piRNA pathway in flies: highlights and future directions. Curr Opin Genet Dev. 23, 44-52 (2013).
  45. Aravin, A. A., et al. Double-stranded RNA-mediated silencing of genomic tandem repeats and transposable elements in the D. melanogaster germline. Curr. Biol. 11, 1017-1027 (2001).
  46. Vagin, V. V., et al. A distinct small RNA pathway silences selfish genetic elements in the germline. Science. 313, 320-324 (2006).
  47. Brennecke, J., et al. Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila. Cell. 128, 1089-1103 (2007).
  48. Sullivan, W., Ashburner, M., Hawley, R. S. Drosophila protocols. Cold Spring Harbor Laboratory Press. (2008).
  49. Zamore, P. D., Ma, S. Isolation of Drosophila melanogaster testes. J. Vis. Exp. (51), e2641 (2011).
  50. Sambrook, J., Fritsch, E. F., Maniatis, T. Molecular cloning : a laboratory manual. 2nd, Cold Spring Harbor Laboratory Press. (1989).
  51. Alwine, J. C., Kemp, D. J., Stark, G. R. Method for detection of specific RNAs in agarose gels by transfer to diazobenzyloxymethyl-paper and hybridisation with DNA probes. Proc. Natl. Acad. Sci. USA. 74, 5350-5354 (1977).
  52. Hansen, T. B., et al. Natural RNA circles function as efficient microRNA sponges. Nature. 495, 384-388 (2013).
  53. Flores-Jasso, C. F., Salomon, W. E., Zamore, P. D. Rapid and specific purification of Argonaute-small RNA complexes from crude cell lysates. RNA. 19, 271-279 (2013).
  54. Specchia, V., et al. Hsp90 prevents phenotypic variation by suppressing the mutagenic activity of transposons. Nature. 463, 662-665 (2010).
  55. Várallyay, E., Burgyán, J., Havelda, Z. MicroRNA detection by northern blotting using locked nucleic acid probes. Nat Protoc. 3, 190-196 (2008).
  56. Koscianska, E., Starega-Roslan, J., Czubala, K., Krzyzosiak, W. J. High-resolution northern blot for a reliable analysis of microRNAs and their precursors. ScientificWorldJournal. 11, 102-117 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics