Enhanced Northern Blot Detection of Small RNA Species in Drosophila Melanogaster

Summary

The aim of this publication is to visualize and discuss the operative steps of an Enhanced Northern Blot protocol on RNA extracted from Drosophila melanogaster embryos, cells, and tissues. This protocol is particularly useful for the efficient detection of small RNA species.

Abstract

The last decades have witnessed the explosion of scientific interest around gene expression control mechanisms at the RNA level. This branch of molecular biology has been greatly fueled by the discovery of noncoding RNAs as major players in post-transcriptional regulation. Such a revolutionary perspective has been accompanied and triggered by the development of powerful technologies for profiling short RNAs expression, both at the high-throughput level (genome-wide identification) or as single-candidate analysis (steady state accumulation of specific species). Although several state-of-art strategies are currently available for dosing or visualizing such fleeing molecules, Northern Blot assay remains the eligible approach in molecular biology for immediate and accurate evaluation of RNA expression. It represents a first step toward the application of more sophisticated, costly technologies and, in many cases, remains a preferential method to easily gain insights into RNA biology. Here we overview an efficient protocol (Enhanced Northern Blot) for detecting weakly expressed microRNAs (or other small regulatory RNA species) from Drosophila melanogaster whole embryos, manually dissected larval/adult tissues or in vitro cultured cells. A very limited amount of RNA is required and the use of material from flow cytometry-isolated cells can be also envisaged.

Introduction

RNA biochemistry has experienced spectacular progresses in the past years¹. Our comprehension of RNA potential in the control of gene expression has been burst by the identification of powerful noncoding ribo-regulators², by the discovery of novel RNA-based regulatory mechanisms^3,4 and by a deeper characterization of already known post-transcriptional events⁵. All together these studies have allowed RNA biology to dramatically make the scene, becoming a major research subject in the current scientific landscape. In particular, over recent years we are getting a sense of the pervasive impact of the “RNA world” on ....

Protocol

1. Sample Collection

1. Detach semi-adherent Schneider’s 2 cells, (1-5 x 10⁶ cells on average), by pipetting and harvest them by centrifugation (100 x g for 1 min). In case of in vitro cultured adherent cells, trypsinize them in standard conditions or directly collect them from plates into a convenient amount of RNA extraction reagent, by help of a cell scraper.
2. For embryo collection, grow Drosophila strains in fly cages and let embryos accumulate on egg laying plates. Wipe embryos off by a paintbrush in distilled water (dH₂O), discard debris by sieve filtering, rinse and recover embryos in a vial

Results

By following the overall procedure described in the text and schematically represented in Figure 1, we assessed small RNAs expression from complex RNA samples of different origins. In the experiment presented in Figure 1, RNA was isolated from Drosophila Schneider’s 2 cells by Proteinase K extraction, checked for integrity (optional step: denaturing agarose gel fractionation) and loaded in double. One half of gel was blotted on a neutral membrane and chemically cross-linked by E.......

Discussion

Although our appreciation of the sophisticate intertwining through which RNA regulates neurogenesis is continuously increasing, the mechanistic implications of RNA-based circuitries affecting neural stem cell biology, neuronal differentiation/functional integration, development of neural pathologies and cancers remain unexplored. The maintenance of such networks through kingdoms makes the potential of genetic systems as Drosophila melanogaster instrumental to unravel unexplored cellular pathways, in which short .......

Materials

List of materials used in this article

Name	Company	Catalog Number	Comments
FINAL COMPOSITION/NAME	COMPANY	CATALOGUE (Stock)	COMMENTS
GENERAL REQUIREMENT
Centrifuge, 5418	Eppendorf	5418 000.017
Decontaminant, RNase Away	Sigma-Aldrich	83931	Apply on glass/plasticware, wipe and rinse
RNase inhibitor, DEPC	Sigma-Aldrich	D5758	Hazardous //// 1609-47-8
SAMPLE PREPARATION
Stereo Microscope, M60	Leica
1X PBS Buffer
137 mM NaCl	Sigma-Aldrich	S3014	7647-14-5
2.7 mM KCl	Sigma-Aldrich	P9541	7447-40-7
10 mM Na2HPO4	Sigma-Aldrich	S3264	7558-79-4
1.8 mM KH2PO4	Sigma-Aldrich	P9791	7778-77-0
RNA EXTRACTION/ANALYSIS
UV-Vis Spectrophotometer	Thermo Scientific	Nanodrop 2000
Gel Imager, ChemiDoc XRS+	Biorad	170-8265
Horizontal Electrophoresys, Mini-Sub Cell GT	BioRad	170-4487EDU
RNA extraction reagent, TRIzol Reagent	Life Technologies	15596026	Hazardous
PCA (25:24:1), 1:1 for extraction	Sigma-Aldrich	77617	136112-00-0
Chlorophorm, 1:1 for extraction	Sigma-Aldrich	C2432	67-66-3
EtOH, 2.5 vol. for precipitation, 70% for washing	Sigma-Aldrich	59844	64-17-5
Gene Ruler 1Kb DNA Ladder	Thermo Scientific	SM0311
Stop Mix
300 mM NaOAc, pH 5.5	Sigma-Aldrich	S2889	127-09-3
1x RSB Solution
2% sodium dodecyl sulfate (SDS)	Sigma-Aldrich	71736	Never cool down SDS to avoid  precipitation //// 151-21-3
2 mg/ml Proteinase K	Roche Applied Science	0-3115828001	EC 3.4.21.64 9
10X Reticulocyte Standard Buffer (RSB)
100 mM Tris-Cl, pH 7.4	Sigma-Aldrich	T5941	1185-53-1
100 mM NaCl	Sigma-Aldrich	S3014	7647-14-5
30 mM MgCl2	Sigma-Aldrich	M8266	7786-30-3
Denaturing Agarose Gel
1.2% Agarose	Sigma-Aldrich	A9539	Let the gel solidify for at least 1 hr //// 9012-36-2
10X MOPS Buffer
0.2 M MOPS sodium salt, pH 7	Sigma-Aldrich	M9381	Do not confuse MOPS sodium salt with MOPS //// 71119-22-7
Agarose Loading Dye
1x MOPS Buffer
3% formaldehyde	Sigma-Aldrich	F8775	Hazardous //// 50-00-0
50% formamide	Sigma-Aldrich	47670	Hazardous //// 75-12-7
Ethidium bromide (EtBr) 30 μg/ml	Sigma-Aldrich	E1510	Hazardous //// 1239-45-8
Bromophenol blue	Sigma-Aldrich	B0126	115-39-9
SMALL RNA FRACTIONATION
Flat gel loading tips	Life Technologies	LC1002
Savant SpeedVac Concentrator	Thermo Scientific	DNA120
Vertical Electrophoresis, Mini-PROTEAN Tetra Cell	Biorad	165-8000
Denaturing Acrylamide Gel
10% acrylamide/bis-acrylamide (19:1)	Sigma-Aldrich	A3449	Hazardous. Let the gel polymerize for 45 min before use
1x TBE Buffer (or 1x MOPS Buffer)
7 M urea	Sigma-Aldrich	U6504	57-13-6
0.1% ammonium persulfate	Sigma-Aldrich	215589	7727-54-0
0.1% TEMED	Sigma-Aldrich	T9281	110-18-9
Gene Ruler Ultra Low Range DNA Ladder (10 bp-step)	Thermo Scientific	SM1211	Label 0.1 μg, as described in the "probe labeling" reaction
Acrylamide Blue Dye
50% formamide	Sigma-Aldrich	47670	Hazardous //// 75-12-7
Bromophenol blue	Sigma-Aldrich	B0126	115-39-9
Running Buffer (RB)
1x MOPS Buffer
Alternative RB: 1x TBE Buffer
1x TBE Buffer
5X TBE
445 mM Tris-base	Sigma-Aldrich	T1503	77-86-1
445 mM boric acid	Sigma-Aldrich	B7901	10043-35-3
20 mM EDTA	Sigma-Aldrich	EDS	60-00-4
Gel Staining Solution
Ethidium bromide 0.5 μg/ml	Sigma-Aldrich	E1510	Hazardous //// 1239-45-8
1x RB			Stain for 15 min with EtBr, destain for 15 min w/o EtBr
BLOTTING
3MM Whatman paper	Sigma-Aldrich	Z270849
Neutral Nylon Membrane, Hybond NX	GE Healthcare Life Science	RPN203T	Photosensitive
CROSSLINKING
Crosslinking Solution (XLS)
1% 1-methylimidazole (v/v)	Sigma-Aldrich	336092	Always prepare a fresh aliquot of XLS //// 616-47-7
12.5 mM HCl	Sigma-Aldrich	H1758	Hazardous //// 7647-01-0
3.1% EDC (w/v)	Sigma-Aldrich	3450	25952-53-8
(PRE)-HYBRIDIZATION
Liquid Scintillation Counter	Beckmann	LS 6500
Sheared Salmon Sperm, 0.1 mg/ml	Life Technologies	AM9680
rasi4 anti-sense probe			5' CGGUGUUCGACAGUUCCUCGGG -3'
5s-rRNA anti-sense probe			5'-CAACACGCGGTGTTCCCAAGCCG-3'
Dmel-miR279 anti-sense probe			5'-TTAATGAGTGTGGATCTAGTCA-3'
Dmel-miR286 anti-sense probe			5'-AGCACGAGTGTTCGGTCTAGTCA-3'
Purification Kit, Illustra MicroSpin G-25 Columns	GE Healthcare Life Science	27-5325-01
(Pre)-Hybridization Solution (HS)
0.5% SDS	Sigma-Aldrich	71736	151-21-3
5x Denhardt's Solution
20X SSPE
3.6 M NaCl	Sigma-Aldrich	S3014	7647-14-5
0.2 M sodium phosphate	Sigma-Aldrich	342483	7601-54-9
20 mM EDTA (pH 8.0)	Sigma-Aldrich	EDS	60-00-4
50x Denhardt's Solution
1% Ficoll 400 (w/v)	Sigma-Aldrich	F2637	26873-85-8
1% Polyvinylpyrrolidone	Sigma-Aldrich	PVP40	9003-39-8
1% BSA	Sigma-Aldrich	A7906	9048-46-8
1X TEN Buffer
10 mM Tris-Cl (pH 8.0)	Sigma-Aldrich	T1503	77-86-1
100 mM NaCl	Sigma-Aldrich	S3014	7647-14-5
1 mM EDTA (pH 8.0)	Sigma-Aldrich	EDS	60-00-4
Probe Labelling
0.4 μM oligonucleotide
1.5 μl Ci/μl [γ-32P] ATP	Perkin Elmer	NEG002A	Hazardous //// 51963-61-2
1x T4 Polynucleotide Kinase Buffer	Biolabs	B0201
T4 Polynucleotide Kinase 0.5 units/μl	Biolabs	M0201	EC 2.7.1.78
WASHING
Geiger Mueller Detectors	Canberra Industries	MCB2/CPS – EM77021
Washing Buffer (WB), 2x SSPE
Stringent Washing Buffers
0.2x SSPE
2x SSPE, 0.5% SDS
0.2x SSPE, 0.5% SDS
SIGNAL DETECTION
PharosFX Plus System	Biorad	170-9460
Image J	Freely available
Quantity One	Biorad
X-ray films , BioMax XAR	Sigma-Aldrich	F5888	Photosensitive
Developer for X-ray films	Sigma-Aldrich	P7042
Fixer for X-ray films	Sigma-Aldrich	P7167
STRIPPING
Stripping Solution
10 mM Tris-HCl pH 8.8	Sigma-Aldrich	T1503	77-86-1
5 mM EDTA	Sigma-Aldrich	EDS	60-00-4
0.1% SDS	Sigma-Aldrich	71736	Add SDS after boiling to avoid foaming //// 151-21-3