A subscription to JoVE is required to view this content. Sign in or start your free trial.

Method Article

Enhanced Northern Blot Detection of Small RNA Species in Drosophila Melanogaster

22.3K views

⸱

DOI:

10.3791/51814

⸱

August 21st, 2014

 , 
1Département de Génomique Fonctionnelle et Cancer, Institut de Génétique et de Biologie Moléculaire et Cellulaire, 2Center for Life NanoScience, Istituto Italiano di Tecnologia

In This Article

Summary

The aim of this publication is to visualize and discuss the operative steps of an Enhanced Northern Blot protocol on RNA extracted from Drosophila melanogaster embryos, cells, and tissues. This protocol is particularly useful for the efficient detection of small RNA species.

Abstract

The last decades have witnessed the explosion of scientific interest around gene expression control mechanisms at the RNA level. This branch of molecular biology has been greatly fueled by the discovery of noncoding RNAs as major players in post-transcriptional regulation. Such a revolutionary perspective has been accompanied and triggered by the development of powerful technologies for profiling short RNAs expression, both at the high-throughput level (genome-wide identification) or as single-candidate analysis (steady state accumulation of specific species). Although several state-of-art strategies are currently available for dosing or visualizing such fleeing molecules, Northern Blot assay remains the eligible approach in molecular biology for immediate and accurate evaluation of RNA expression. It represents a first step toward the application of more sophisticated, costly technologies and, in many cases, remains a preferential method to easily gain insights into RNA biology. Here we overview an efficient protocol (Enhanced Northern Blot) for detecting weakly expressed microRNAs (or other small regulatory RNA species) from Drosophila melanogaster whole embryos, manually dissected larval/adult tissues or in vitro cultured cells. A very limited amount of RNA is required and the use of material from flow cytometry-isolated cells can be also envisaged.

Introduction

RNA biochemistry has experienced spectacular progresses in the past years1. Our comprehension of RNA potential in the control of gene expression has been burst by the identification of powerful noncoding ribo-regulators2, by the discovery of novel RNA-based regulatory mechanisms3,4 and by a deeper characterization of already known post-transcriptional events5. All together these studies have allowed RNA biology to dramatically make the scene, becoming a major research subject in the current scientific landscape. In particular, over recent years we are getting a sense of the pervasive impact of the “RNA world” on molecular neurobiology6, one of the most dynamic research domains in modern life science. In the last decade of the past century, the overall scientific scenario has been revolutionized by the discovery of the RNA interference7,8 and of the small regulatory RNAs9,10 with particular regard to microRNAs11, endogenously expressed small noncoding RNAs implicated in the control of nearly all cellular functions as pleiotropic and combinatorial regulators of gene expression.

Almost 10 years after miRNA initial discovery in Caenorhabditis elegans by Ambros and Ruvkun’s labs, renewed attention was turned to the field when high numbers of miRNAs were identified in Drosophila and in human cells as well12-15. Since then, thanks to versatile transgenic approaches, Drosophila melanogaster has stood out as a valuable biological context for delving into miRNA biosynthesis and activity. Drosophila miRNAs have revealed distinct functions in insect-specific or evolutionarily conserved processes, spanning from aging to metabolism, signaling pathways, behavior and, of course, neurogenesis. Along this direction, we recently unveiled a novel link16 in the intriguing correlation occurring between the master gene gcm/glide and the RNA pathway. The fly transcription factor Gcm/Glide17-19 constitutes a unique example of cell fate determinant, which dictates the glial vs. neuronal fate choice in multipotent fly neural precursors20. Twenty-year long research on this topic has clearly underlined the occurrence of multiple and overlapping inputs of gene expression regulation converging over gcm/glide21-28 to establish the threshold levels required for balancing the delicate ratio between neuronal and glial counterparts during neural development.

We discovered that regulation via Dmel-miR279 targeting represents a further control level contributing to post-transcriptional fine-tuning of gcm/glide expression16. Globally, these research lines have required specific methodological improvements: along years, several technologies originally developed to analyze traditional RNAs have been converted for quantifying small non coding RNAs, like as RNAse protection assays, cDNA arrays29-31, real-time PCR methods32-35 and sequencing36,37. On the other side, recalibration of technical approaches has fostered continuous progresses in the field.

Northern Blot assay (NB, or RNA gel blot assay) constitutes a representative instance: it is largely employed to profile RNA accumulation, since it ensures both expression level quantitation as well as size determination. However, the intrinsic poor sensitivity of the method is limiting when it is to be applied to low-abundant gene expression fine tuners, like short RNAs. A detrimental consequence is the requirement of large amounts of total RNA, which makes difficult its application to specific biological samples. For such reasons, specific NB variants for small RNAs detection have been developed38-40: we took advantage of an improved NB procedure41 (ENB, Enhanced Northern Blot), while elucidating the abovementioned interplay between Dmel-miR279 and gcm/glide.

This method relies on a chemical crosslinking step based on the activity of a Carbodiimide derivative [1-ethyl-3-(3-dimethylaminopropyl)carbodiimide, EDC] to fix nucleic acid onto solid supports. Carbodiimide is a versatile cross linker known to catalyze the formation of amide bonds between activated carboxyl or phosphate groups and amine groups42. This property can be exploited to covalently couple small RNAs via their mono-phosphorylated 5′-hydroxyl group to amino groups at the surface of nylon membranes. The resulting attachment configuration increases the accessibility of the immobilized nucleic acid and, in turn, the efficiency of probe-target hybridization, which results in remarkable detection enhancement43.

The technique assumes particular relevance in Drosophila molecular studies, by which the occurrence of novel and distinctive classes of small noncoding RNAs is emerging44. Among these, rasiRNAs45,46 constitute a specific subtype of piwi-interacting RNAs (piRNAs47), involved in sequence-specific gene silencing. Operative details of this method are fully described and visualized hereinafter, relative to the analysis of the microRNAs Dmel-miR279 and Dmel-miR286 and, for the first time, of one rasiRNA, rasi4. We pushed to extremes this method, which allowed us revealing poorly expressed targets from minimal amounts of RNA (less than 1 μg).

Access restricted. Please log in or start a trial to view this content.

Protocol

1. Sample Collection

  1. Detach semi-adherent Schneider’s 2 cells, (1-5 x 106 cells on average), by pipetting and harvest them by centrifugation (100 x g for 1 min). In case of in vitro cultured adherent cells, trypsinize them in standard conditions or directly collect them from plates into a convenient amount of RNA extraction reagent, by help of a cell scraper.
  2. For embryo collection, grow Drosophila strains in fly cages and let embryos accumulate on egg laying plates. Wipe embryos off by a paintbrush in distilled water (dH2O), discard debris by sieve filtering, rinse and recover embryos in a vial48.
  3. As an alternate technique, manually dissect tissues/organs. Isolate testes (a preferential system for piRNA analysis) from Drosophila abdomen in phosphate buffered saline (PBS) under a stereomicroscope (20X magnification), by using dissection needles or forceps as visualized in Sullivan et al49.
  4. Pestle homogenize samples upon addiction of 0.5 volumes of RNA extraction reagent.

2. RNA Extraction/Analysis

  1. Following manufacturers’ instructions perform RNA isolation through commercial reagents. CAUTION! RNA extraction agents are usually toxic and caustic. Alternatively, apply a Proteinase K-based protocol for RNA isolation50, as follows:
    1. Dilute samples into 400 μl of Stop Mix and incubate at RT for 15 min.
    2. Recover hydrosoluble components by standard phenol:chloroform:isoamyl alcohol and chloroform extractions and by ethanol (EtOH) precipitation/washing. Air dry the samples and resuspend into diethylpyrocarbonate (DEPC)-treated double distilled (dd)H2O.
  2. Assess RNA concentration by UV spectrophotometric measurement. Also ensure the RNA purity is high, close to 2.0, based on A260/A280 reading.
  3. Check RNA preparation on denaturing agarose gel as follows:
    1. In a clean beaker, dissolve 1.2 g of Agarose in 82 ml of DEPC-ddH2O, under continuous stirring. Boil until completely dissolved.
    2. Allow the gel solution to cool down; when temperature reaches 60 °C add 10 ml of 10X 4-morpholinepropanesulfonic acid (MOPS) buffer to 1X final concentration (FC), and 8 ml of 37% formaldehyde to 3% FC. CAUTION! Formaldehyde is a carcinogen.
    3. Pour the gel into a horizontal electrophoresis cell. Allow the gel to solidify under a hood for at least 1 hr. Following solidification, submerge the gel into MOPS 1X.
    4. Aliquot 2 μg of RNA sample and 1 μg of Ladder (use an RNA marker when accurate evaluation is desired). Add 3 volumes of agarose loading dye (ALD) to RNA and to Ladder. Heat at 70 °C for 5 min and immediately cool on ice. CAUTION! Contents of ALD (ethidium bromide and formamide, see Materials) are mutagen and corrosive, respectively.
    5. Load the samples and run the gel at 50 V for about 1 hr with occasional buffer recycling. Check the RNA fractionation pattern by UV visualization or gel imaging. Recognize discrete bands corresponding to 28S and 18S rRNAs and to tRNAs (see Figure 1).
  4. Proceed to Northern Assay or store RNA at -80 °C.

3. Denaturing Acrylamide Gel Preparation

  1. Use a small vertical electrophoretic apparatus for this fractionation step (plate size about 8 cm x 9 cm, comb thickness 0.75 mm).
  2. Assemble clean glasses together in a casting frame.
  3. Prepare 10 ml of 10% acrylamide/bis-acrylamide (19:1) solution in MOPS 1X, 7 M urea. Immediately before pouring, add 100 μl of 10% ammonium persulfate and 10 μl of TEMED and rapidly mix the solution. CAUTION! Acrylamide is neurotoxic and carcinogen.
  4. Pour the gel between glass plates and insert the well comb carefully to avoid bubbles. Let the gel polymerize at RT for at least 45 min before use. Alternatively, store the gel O/N, wrapped in water-soaked filter papers and sealed in saran wrap.

4. Sample Preparation

  1. Aliquot 0.5-20 μg of total RNA for each sample. If volume exceeds 3-4 μl, vacuum dry the sample.
  2. For size determination, run an aliquot (20-30 cps) of radiolabeled low-range ladder in parallel to samples, as a marker (see section 4.3 and 4.4 for preparation). Treat it in parallel to samples, as described in step 4.5.
  3. Ladder: set up a phosphate forward reaction using 0.1 μg of a 10 bp-step ladder. Incubate at 37 °C for 30 min and stop the reaction by adding ethylenediaminetetraacetic acid (EDTA) to 20 mM FC.
  4. Purify by EtOH precipitation/washing, air dry and resuspend in ddH2O (about 100 μl). CAUTION! 32P is a radioactive source.
  5. To each sample add an equal volume of acrylamide blue dye (ABD). Denature by heating at 80 °C for 5 min and cool on ice until loading. CAUTION! Formamide (content in ABD) is corrosive.

5. Electrophoretic Fractionation

  1. Remove the glass plates from the casting support and properly assemble them in the electrophoresis cell. Fill both inner and outer chamber with sufficient Running Buffer (RB).
  2. Gently remove the comb and pre-run the gel at 200 V for 10 min.  Before loading samples, wash away urea deposits from the wells by squirting some RB through a syringe.
  3. Use flat tips to carefully stratify samples from step 4.5 at the bottom of each well. Check anode and cathode connections to avoid inverted running. After the samples enter the gel at 100 V for 5 min, increase the voltage to 200 V.
  4. For a fractionation length of about 7 cm, a 45 min-long run is sufficient. Avoid Bromophenol blue (a tracking pigment in ABD) to overflow the gel.
  5. Visualize on-gel the fractionated long RNAs by ethidium bromide (EtBr) staining, as an optional step:
    1. Cut away 2 cm from the top of the gel and briefly rinse the slice in ddH2O.
    2. Incubate the gel slice at RT for 15 min with gentle shacking in RB, EtBr 0.5 μg/ml FC.
    3. Destain the gel for 15 min in RB, visualize long rRNAs by UV irradiation or gel imaging. Check for RNA loading and quality (see Figure 1, Panel 7). CAUTION! Ethidium bromide is a mutagen.
  6. Meanwhile proceed blotting the lower part of the gel containing small RNA species.

6. Gel Blotting

  1. Cut 6 pieces of blotting paper to fit the blotting area and an equivalent piece of uncharged nylon membrane. Dampen paper sheets, membrane and 2 blotting pads in RB. Make sure to completely soak the pads by repeatedly squeezing them in RB.
  2. Remove the gel from the apparatus and open the glasses by mean of a spatula. Use a clean cutter to remove the wells. Place a sheet of wet Whatman paper on the gel and gently lift it up.
  3. Place the nylon membrane on the free face of the gel. Mark a corner to orient the filter according to sample loading. Complete the “sandwich” (3 paper pieces each side). Roll a plastic rod on the blot surface, to remove any possible air bubbles.
  4. Place the blot between two blotting pads and then in the blotting cassette. Assemble the cassette in the blotting module, fill the chamber with RB and check for the correct orientation (nylon membrane must stay between the gel and the positive terminus).
  5. Transfer at 20 V for 20 min. Note: to ensure homogeneous conditions, after 10 min open the blotting module and rotate the sandwich by 180°  before completing the transfer.

7. Membrane Crosslinking

  1. Prepare 6 ml of fresh Crosslinking Solution (XLS). Saturate a 10 cm x 10 cm (larger than nylon membrane) piece of blotting paper with XLS. CAUTION! HCl (a component of XLS) is highly corrosive.
  2. Dismantle the blot and place the membrane on the wet 3MM filter paper. Note: RNA must not be in direct contact with the saturated paper. Place the filter and paper between two glass plates and wrap in saran-wrap.
  3. Heat the membrane at 60 °C for 2 hr, followed by a ddH2O washing. Store at -20 °C or proceed to hybridization.

8. Membrane Prehybridization

  1. If RNA loading has been checked (optional step 5.5), directly proceed to hybridization. Or else, cut away 1 cm from to the top of the nylon filter, to avoid probe cross-hybridizations to fractionated long RNAs.
  2. Preheat 10 ml of Hybridization Solution (HS) at 37 °C. Denature 1 mg of Salmon Sperm at 95 °C for 5 min, cool on ice and add to HS.
  3. Incubate the filter in HS at 37˚C for at least 1 hr, under rotation in a hybridization oven. Check that the RNA-side of the filter faces HS.

9. Probe Synthesis

  1. Set up a phosphate forward reaction on 10 pmol of specific antisense oligonucleotide, as described in 4.3.
  2. Add 5 volumes of Tris-EDTA-NaCl (TEN) buffer to the reaction and purify the labeled primer from unincorporated nucleotides by gel exclusion chromatography on G-25 Sephadex columns (or also by EtOH precipitation). Probe activity can be assessed by Liquid Scintillation Counter.

10. Membrane Hybridization

  1. Replace the exhausted HS with a fresh 10 ml aliquot (prepared and complemented as described above). Heat the probe at 95 °C for 10 min, cool on ice and add to novel HS. Incubate the filter at 37 °C ON.

11. Membrane Washing

  1. Recover the hybridization solution and store it at -20 °C in a radioactivity-shielding box.
  2. Rinse the filter in Washing Buffer (WB) and wash it thoroughly for 10 min at RT.
  3. Use a Geiger Mueller Detector for checking residual radioactivity at the filter corners. When background emission is around 5 cps, proceed to membrane exposition.

12. Signal Detection

  1. Expose the filter on autoradiography films or on a molecular imager screen ON. Reveal signals by photographic processing or digital conversion.
  2. Analyze the band intensity by dedicated quantification software (ImageJ or Optiquant).

13. Membrane Stripping

  1. To remove primary signals, submerge the membrane in 500 ml of boiling Stripping solution, then incubate at RT for 1 min. Proceed to novel (pre)hybridization or store the filter at -20 °C.

Access restricted. Please log in or start a trial to view this content.

Results

By following the overall procedure described in the text and schematically represented in Figure 1, we assessed small RNAs expression from complex RNA samples of different origins. In the experiment presented in Figure 1, RNA was isolated from Drosophila Schneider’s 2 cells by Proteinase K extraction, checked for integrity (optional step: denaturing agarose gel fractionation) and loaded in double. One half of gel was blotted on a neutral membrane and chemically cross-linked by E...

Access restricted. Please log in or start a trial to view this content.

Discussion

Although our appreciation of the sophisticate intertwining through which RNA regulates neurogenesis is continuously increasing, the mechanistic implications of RNA-based circuitries affecting neural stem cell biology, neuronal differentiation/functional integration, development of neural pathologies and cancers remain unexplored. The maintenance of such networks through kingdoms makes the potential of genetic systems as Drosophila melanogaster instrumental to unravel unexplored cellular pathways, in which short ...

Access restricted. Please log in or start a trial to view this content.

Disclosures

The authors declare that they have no competing financial interests.

Acknowledgements

This work was supported by the Institut National de la Santé et de la Recherche Médicale, the Centre National de la Recherche Scientifique, the Université de Strasbourg, the Hôpital de Strasbourg, the Association pour la Recherche sur le Cancer, the Institut National du Cancer, the Agence Nationale de la Recherche and the Région Alsace.

Pietro Laneve has been supported by the Fondation pour la Recherche Médicale. Currently, he is a recipient of a Istituto Italiano Tecnologia (IIT) fellowship. Publication costs are supported by the Neurex network (TriNeuron – Program Interreg IV Upper Rhine)

Access restricted. Please log in or start a trial to view this content.

Materials

List of materials used in this article
NameCompanyCatalog NumberComments
FINAL COMPOSITION/NAMECOMPANYCATALOGUE (Stock)COMMENTS
GENERAL REQUIREMENT
Centrifuge, 5418Eppendorf5418 000.017
Decontaminant, RNase AwaySigma-Aldrich83931Apply on glass/plasticware, wipe and rinse
RNase inhibitor, DEPCSigma-AldrichD5758Hazardous //// 1609-47-8
SAMPLE PREPARATION
Stereo Microscope, M60Leica 
1X PBS Buffer
137 mM NaClSigma-AldrichS30147647-14-5  
2.7 mM KClSigma-AldrichP95417447-40-7 
10 mM Na2HPO4Sigma-AldrichS32647558-79-4 
1.8 mM KH2PO4Sigma-AldrichP97917778-77-0 
RNA EXTRACTION/ANALYSIS
UV-Vis SpectrophotometerThermo ScientificNanodrop 2000
Gel Imager, ChemiDoc XRS+Biorad170-8265
Horizontal Electrophoresys, Mini-Sub Cell GTBioRad170-4487EDU
RNA extraction reagent, TRIzol ReagentLife Technologies15596026Hazardous
PCA (25:24:1), 1:1 for extractionSigma-Aldrich77617136112-00-0
Chlorophorm, 1:1 for extractionSigma-AldrichC243267-66-3  
EtOH, 2.5 vol. for precipitation, 70% for washingSigma-Aldrich5984464-17-5 
Gene Ruler 1Kb DNA LadderThermo ScientificSM0311
Stop Mix
300 mM NaOAc, pH 5.5Sigma-AldrichS2889127-09-3
1x RSB Solution
2% sodium dodecyl sulfate (SDS)Sigma-Aldrich71736Never cool down SDS to avoid  precipitation //// 151-21-3
2 mg/ml Proteinase KRoche Applied Science0-3115828001EC 3.4.21.64 9
10X Reticulocyte Standard Buffer (RSB)
100 mM Tris-Cl, pH 7.4Sigma-AldrichT59411185-53-1  
100 mM NaClSigma-AldrichS30147647-14-5  
30 mM MgCl2Sigma-AldrichM82667786-30-3
Denaturing Agarose Gel
1.2% AgaroseSigma-AldrichA9539Let the gel solidify for at least 1 hr //// 9012-36-2
10X MOPS Buffer
0.2 M MOPS sodium salt, pH 7Sigma-AldrichM9381Do not confuse MOPS sodium salt with MOPS //// 71119-22-7
Agarose Loading Dye
1x MOPS Buffer
3% formaldehydeSigma-AldrichF8775Hazardous //// 50-00-0
50% formamideSigma-Aldrich47670Hazardous //// 75-12-7
Ethidium bromide (EtBr) 30 μg/mlSigma-AldrichE1510Hazardous //// 1239-45-8
Bromophenol blue Sigma-AldrichB0126115-39-9 
SMALL RNA FRACTIONATION
Flat gel loading tipsLife TechnologiesLC1002
Savant SpeedVac ConcentratorThermo Scientific DNA120
Vertical Electrophoresis, Mini-PROTEAN Tetra Cell Biorad165-8000
Denaturing Acrylamide Gel
10% acrylamide/bis-acrylamide (19:1)Sigma-AldrichA3449Hazardous. Let the gel polymerize for 45 min before use
1x TBE Buffer (or 1x MOPS Buffer)
7 M ureaSigma-AldrichU650457-13-6
0.1% ammonium persulfateSigma-Aldrich2155897727-54-0 
0.1% TEMEDSigma-AldrichT9281110-18-9
Gene Ruler Ultra Low Range DNA Ladder (10 bp-step)Thermo ScientificSM1211Label 0.1 μg, as described in the "probe labeling" reaction
Acrylamide Blue Dye 
50% formamideSigma-Aldrich47670Hazardous //// 75-12-7
Bromophenol blueSigma-AldrichB0126115-39-9 
Running Buffer (RB)
1x MOPS Buffer 
Alternative RB: 1x TBE Buffer
1x TBE Buffer
5X TBE
445 mM Tris-baseSigma-AldrichT150377-86-1 
445 mM boric acidSigma-AldrichB790110043-35-3
20 mM EDTASigma-AldrichEDS60-00-4  
Gel Staining Solution
Ethidium bromide 0.5 μg/mlSigma-AldrichE1510Hazardous //// 1239-45-8
1x RBStain for 15 min with EtBr, destain for 15 min w/o EtBr
BLOTTING
3MM Whatman paperSigma-AldrichZ270849
Neutral Nylon Membrane, Hybond NXGE Healthcare Life ScienceRPN203TPhotosensitive
CROSSLINKING
Crosslinking Solution (XLS)
1% 1-methylimidazole (v/v)Sigma-Aldrich336092Always prepare a fresh aliquot of XLS //// 616-47-7
12.5 mM HClSigma-AldrichH1758Hazardous //// 7647-01-0
3.1% EDC (w/v)Sigma-Aldrich345025952-53-8  
(PRE)-HYBRIDIZATION
Liquid Scintillation Counter BeckmannLS 6500
Sheared Salmon Sperm, 0.1 mg/ml Life TechnologiesAM9680
rasi4 anti-sense probe5' CGGUGUUCGACAGUUCCUCGGG -3'
5s-rRNA anti-sense probe5'-CAACACGCGGTGTTCCCAAGCCG-3'
Dmel-miR279 anti-sense probe5'-TTAATGAGTGTGGATCTAGTCA-3'
Dmel-miR286 anti-sense probe5'-AGCACGAGTGTTCGGTCTAGTCA-3'
Purification Kit, Illustra MicroSpin G-25 ColumnsGE Healthcare Life Science27-5325-01
(Pre)-Hybridization Solution (HS)
0.5% SDSSigma-Aldrich71736151-21-3 
5x Denhardt's Solution
20X SSPE
3.6 M NaClSigma-AldrichS30147647-14-5  
0.2 M sodium phosphateSigma-Aldrich3424837601-54-9  
20 mM EDTA (pH 8.0)Sigma-AldrichEDS 60-00-4  
50x Denhardt's Solution
1% Ficoll 400 (w/v)Sigma-AldrichF263726873-85-8
1% PolyvinylpyrrolidoneSigma-AldrichPVP409003-39-8
1% BSASigma-AldrichA79069048-46-8  
1X TEN Buffer
10 mM Tris-Cl (pH 8.0)Sigma-AldrichT150377-86-1 
100 mM NaClSigma-AldrichS30147647-14-5  
1 mM EDTA (pH 8.0)Sigma-AldrichEDS60-00-4  
Probe Labelling
0.4 μM oligonucleotide
1.5 μl Ci/μl [γ-32P] ATPPerkin ElmerNEG002AHazardous //// 51963-61-2
1x T4 Polynucleotide Kinase BufferBiolabsB0201
T4 Polynucleotide Kinase 0.5 units/μlBiolabsM0201EC 2.7.1.78
WASHING
Geiger Mueller DetectorsCanberra IndustriesMCB2/CPS – EM77021
Washing Buffer (WB), 2x SSPE
Stringent Washing Buffers
0.2x SSPE
2x SSPE, 0.5% SDS
0.2x SSPE, 0.5% SDS
SIGNAL DETECTION
PharosFX Plus SystemBiorad170-9460
Image JFreely available
Quantity OneBiorad
X-ray films , BioMax XARSigma-AldrichF5888Photosensitive
Developer for X-ray filmsSigma-AldrichP7042
Fixer for X-ray filmsSigma-AldrichP7167
STRIPPING
Stripping Solution
10 mM Tris-HCl pH 8.8Sigma-AldrichT150377-86-1 
5 mM EDTASigma-AldrichEDS60-00-4  
0.1% SDSSigma-Aldrich71736Add SDS after boiling to avoid foaming //// 151-21-3

References

  1. The RNA World. Gesteland, R. F., Cech, T. R., Atkins, J. F. , 3rd, Cold Spring Harbor Laboratory Press. (2006).
  2. Mercer, T. R., Dinger, M. E., Mattick, J. S. Long non-coding RNAs: insights into functions. Nat Rev Genet. 10, 155-159 (2009).
  3. Salmena, L., Poliseno, L., Tay, Y., Kats, L., Pandolfi, P. P. A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell. 146, 353-358 (2011).
  4. Cesana, M., et al. A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA. Cell. 147, 358-369 (2011).
  5. Orphanides, G., Reinberg, D. A unified theory of gene expression. Cell. 108, 439-451 (2002).
  6. Mehler, M. F., Mattick, J. S. Noncoding RNAs and RNA editing in brain development, functional diversification, and neurological disease. Physiol Rev. 87, 799-823 (2007).
  7. Fire, A., Xu, S., Montgomery, M., Kostas, S., Driver, S., Mello, C. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391, 806-811 (1998).
  8. Hamilton, A., Baulcombe, D. A species of small antisense RNA in posttranscriptional gene silencing in plants. Science. 286, 950-952 (1999).
  9. Lee, R. C., Feinbaum, R. L., Ambros, V. The C. Elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 75, (1993).
  10. Wightman, B., Ha, I., Ruvkun, G. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell. 75, 855-862 (1993).
  11. Fabian, M. R., Sonenberg, N., Filipowicz, W. Regulation of mRNA translation and stability by microRNAs. Annu Rev Biochem. 79, 351-379 (2010).
  12. Pasquinelli, A. E., et al. Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature. 408, 86-89 (2000).
  13. Lagos-Quintana, M., Rauhut, R., Lendeckel, W., Tuschl, T. Identification of novel genes coding for small expressed RNAs. Science. 294, 853-858 (2001).
  14. Lau, N. C., Lim, L. P., Weinstein, E. G., Bartel, D. P. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science. 294, 858-862 (2001).
  15. Lee, R. C., Ambros, V. An extensive class of small RNAs in Caenorhabditis elegans. Science. 294, 862-864 (2001).
  16. Laneve, P., et al. The Gcm/Glide molecular and cellular pathway: new actors and new lineages. Dev Biol. 375, 65-78 (2013).
  17. Hosoya, T., Takizawa, K., Nitta, K., Hotta, Y. Glial cells missing: a binary switch between neuronal and glial determination in Drosophila. Cell. 82, 1025-1036 (1995).
  18. Jones, B. W., Fetter, R. D., Tear, G., Goodman, C. S. Glial cells missing: a genetic switch that controls glial versus neuronal fate. Cell. 82, 1013-1023 (1995).
  19. Vincent, S., Vonesch, J. L., Giangrande, A. Glide directs glial fate commitment and cell fate switch between neurons and glia. Developement. 122, 131-139 (1996).
  20. Cattenoz, P. B., Giangrande, A. Lineage specification in the fly nervous system and evolutionary implications. Cell Cycle. 12, 2753-2759 (2013).
  21. Jones, B. W., Abeysekera, M., Galinska, J., Jolicoeur, E. M. Transcriptional control of glial and blood cell development in Drosophila: cis-regulatory elements of glial cells missing. Dev Biol. 266, 374-387 (2004).
  22. Ragone, G., et al. Transcriptional regulation of glial cell specification. Dev Biol. 255, 138-150 (2003).
  23. Akiyama-Oda, Y., Hosoya, T., Hotta, Y. Asymmetric cell division of thoracic neuroblast 6-4 to bifurcate glial and neuronal lineage in Drosophila. Development. 126, 1967-1974 (1999).
  24. Bernardoni, R., Kammerer, M., Vonesch, J. L., Giangrande, A. Gliogenesis depends on glide/gcm through asymmetric division of neuroglioblasts. Dev Biol. 216, 265-275 (1999).
  25. Ragone, G., Bernardoni, R., Giangrande, A. A novel mode of asymmetric division identifies the fly neuroglioblast 6-4T. Dev Biol. 235, 74-85 (2001).
  26. Soustelle, L., Roy, N., Ragone, G., Giangrande, A. Control of gcm RNA stability is necessary for proper glial cell fate acquisition. Mol Cell Neurosci. 37, 657-662 (2008).
  27. Akiyama, Y., Hosoya, T., Poole, A. M., Hotta, Y. The gcm-motif: a novel DNA-binding motif conserved in Drosophila and mammals. Proc. Natl. Acad. Sci. USA. 25, 14912-14916 (1996).
  28. Miller, A. A., Bernardoni, R., Giangrande, A. Positive autoregulation of the glial promoting factor glide/gcm. EMBO J. 17, 6316-6326 (1998).
  29. Krichevsky, A. M., King, K. S., Donahue, C. P., Khrapko, K., Kosik, K. S. A microRNA array reveals extensive regulation of microRNAs during brain development. RNA. 9, 1274-1281 (2003).
  30. Liu, C. G., et al. An oligonucleotide microchip for genome-wide microRNA profiling in human and mouse tissues. Proc. Natl. Acad. Sci. USA. 101, 9740-9744 (2004).
  31. Yin, J. Q., Zhao, R. C., Morris, K. V. Profiling microRNA expression with microarrays. Trends Biotechnol. 26, 70-76 (2008).
  32. Schmittgen, T. D., Jiang, J., Liu, Q., Yang, L. A high-throughput method to monitor the expression of microRNA precursors. Nucleic Acids Res. 32, E43(2004).
  33. Chen, C., et al. Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res. 33, e179(2005).
  34. Shi, R., Chiang, V. L. Facile means for quantifying microRNA expression by real-time PCR. Biotechniques. 39, 519-525 (2005).
  35. Raymond, C. K., Roberts, B. S., Garrett-Engele, P., Lim, L. P., Johnson, J. M. Simple quantitative primer-extension PCR assay for direct monitoring of microRNAs and short-interfering RNAs. RNA. 11, 1737-1744 (2005).
  36. Wang, Z., Gerstein, M., Snyder, M. RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet. 10, 57-63 (2009).
  37. Linsen, S. E., et al. Limitations and possibilities of small RNA digital gene expression profiling. Nat Methods. 6, 474-476 (2009).
  38. Valoczi, A., et al. Sensitive and specific detection of microRNAs by northern blot analysis using LNA-modified oligonucleotide probes. Nucleic Acids Res. 32, e175(2004).
  39. Varallyay, E., Burgyan, J., Havelda, Z. Detection of microRNAs by Northern blot analyses using LNA probes. Methods. 43, 140-145 (2007).
  40. Kim, S. W., et al. A sensitive non-radioactive northern blot method to detect small RNAs. Nucleic Acids Res. 38, e98(2010).
  41. Pall, G. S., Hamilton, A. J. Improved northern blot method for enhanced detection of small RNA. Nat Protoc. 3, 1077-1084 (2008).
  42. Hermanson, G. T. Bioconjugate Techniques. , 2nd, Academic Press, Inc. (2008).
  43. Pall, G. S., Codony-Servat, C., Byrne, J., Ritchie, L., Hamilton, A. Carbodiimide-mediated cross-linking of RNA to nylon membranes improves the detection of siRNA, miRNA and piRNA by northern blot. Nucleic Acids Res. 35, e60(2007).
  44. Guzzardo, P. M., Muerdter, F., Hannon, G. J. The piRNA pathway in flies: highlights and future directions. Curr Opin Genet Dev. 23, 44-52 (2013).
  45. Aravin, A. A., et al. Double-stranded RNA-mediated silencing of genomic tandem repeats and transposable elements in the D. melanogaster germline. Curr. Biol. 11, 1017-1027 (2001).
  46. Vagin, V. V., et al. A distinct small RNA pathway silences selfish genetic elements in the germline. Science. 313, 320-324 (2006).
  47. Brennecke, J., et al. Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila. Cell. 128, 1089-1103 (2007).
  48. Sullivan, W., Ashburner, M., Hawley, R. S. Drosophila protocols. , Cold Spring Harbor Laboratory Press. (2008).
  49. Zamore, P. D., Ma, S. Isolation of Drosophila melanogaster testes. J. Vis. Exp. (51), e2641(2011).
  50. Sambrook, J., Fritsch, E. F., Maniatis, T. Molecular cloning : a laboratory manual. , 2nd, Cold Spring Harbor Laboratory Press. (1989).
  51. Alwine, J. C., Kemp, D. J., Stark, G. R. Method for detection of specific RNAs in agarose gels by transfer to diazobenzyloxymethyl-paper and hybridisation with DNA probes. Proc. Natl. Acad. Sci. USA. 74, 5350-5354 (1977).
  52. Hansen, T. B., et al. Natural RNA circles function as efficient microRNA sponges. Nature. 495, 384-388 (2013).
  53. Flores-Jasso, C. F., Salomon, W. E., Zamore, P. D. Rapid and specific purification of Argonaute-small RNA complexes from crude cell lysates. RNA. 19, 271-279 (2013).
  54. Specchia, V., et al. Hsp90 prevents phenotypic variation by suppressing the mutagenic activity of transposons. Nature. 463, 662-665 (2010).
  55. Várallyay, E., Burgyán, J., Havelda, Z. MicroRNA detection by northern blotting using locked nucleic acid probes. Nat Protoc. 3, 190-196 (2008).
  56. Koscianska, E., Starega-Roslan, J., Czubala, K., Krzyzosiak, W. J. High-resolution northern blot for a reliable analysis of microRNAs and their precursors. ScientificWorldJournal. 11, 102-117 (2011).

Access restricted. Please log in or start a trial to view this content.

Reprints and Permissions

Explore More Articles

RNA DetectionAcrylamide Gel ElectrophoresisRNA ExtractionProbe HybridizationAutoradiography DetectionRNA IsolationGel Transfer
Enhanced Northern Blot Detection of Small RNA Species in Drosophila Melanogaster
Contact Us
Recommend to Library

Privacy

Terms of Use

Policies

Copyright © 2026 MyJoVE Corporation. All rights reserved.