تعزيز الشمالية كشف طخة الأنواع RNA الصغيرة في

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

والهدف من هذا المنشور هو تصور ومناقشة الخطوات المنطوق لتعزيز بروتوكول الشمالية صمة عار على الحمض النووي الريبي المستخرج من الدروسوفيلاميلانوجاستر الأجنة والخلايا والأنسجة. هذا البروتوكول هو مفيدة بشكل خاص للكشف عن كفاءة الأنواع RNA الصغيرة.

Cite this Article

Copy Citation | Download Citations

Laneve, P., Giangrande, A. Enhanced Northern Blot Detection of Small RNA Species in Drosophila Melanogaster. J. Vis. Exp. (90), e51814, doi:10.3791/51814 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

وقد شهدت العقود الأخيرة انفجار الفائدة العلمية حول آليات الرقابة التعبير الجيني على مستوى الحمض النووي الريبي. هذا الفرع من علم الأحياء الجزيئي واشتعل كثيرا اكتشاف الرنا غير المكودة باعتبارها من اللاعبين الرئيسيين في التنظيم بعد النسخي. وقد رافق هذا المنظور الثوري والناجمة عن تطوير تكنولوجيات قوية لالتنميط قصيرة الرنا التعبير، سواء على مستوى الإنتاجية العالية (التعرف على نطاق الجينوم) أو تحليل مرشح واحد (الدولة تراكم مستمر من أنواع محددة). وعلى الرغم من عدة دولة من بين الفن الاستراتيجيات المتاحة حاليا لجرعات أو تصور مثل هذه الجزيئات الفارين، يبقى لطخة الشمالية فحص النهج المؤهلين في مجال البيولوجيا الجزيئية لتقييم فوري ودقيق التعبير RNA. أنها تمثل خطوة أولى نحو تطبيق أكثر تطورا والتكنولوجيات مكلفة، وفي كثير من الحالات، يبقى وسيلة تفضيلية للحصول على أفكار بسهولةفي علم الأحياء الحمض النووي الريبي. نحن هنا نظرة عامة على بروتوكول كفاءة (المحسن الشمالية البقعة) للكشف عن الرنا الميكروية أعرب ضعيف (RNA التنظيمية أو الأنواع الصغيرة الأخرى) من الدروسوفيلاميلانوجاستر الأجنة كلها، تشريح أنسجة اليرقات / الكبار يدويا أو المختبر في الخلايا المستزرعة. مطلوب كمية محدودة جدا من الحمض النووي الريبي واستخدام مواد من تدفق خلايا معزولة الخلوي يمكن أن يكون التفكير أيضا.

Introduction

شهدت RNA الكيمياء الحيوية تقدمات مذهلة في السنوات الماضية 1. وقد انفجر فهمنا من إمكانات RNA في السيطرة على التعبير الجيني من خلال تحديد قوية غير المكودة RIBO المنظمين من خلال اكتشاف آليات جديدة على أساس RNA 3،4 التنظيمية وتوصيف أعمق من الأحداث آخر النسخي المعروف بالفعل 5. كل ذلك معا وقد سمحت هذه الدراسات البيولوجيا RNA لجعل المشهد بشكل كبير، وأصبح موضوع البحث الرئيسي في المشهد العلمي الحالي. على وجه الخصوص، خلال السنوات الأخيرة أننا نحصل على الشعور تأثير المتفشي من "عالم RNA" في بيولوجيا الأعصاب الجزيئية واحدة من المجالات البحثية الأكثر ديناميكية في علوم الحياة الحديثة. في العقد الأخير من القرن الماضي، وقد أحدثت ثورة في السيناريو العلمي الشامل قبل اكتشاف تدخل الحمض النووي الريبي و7،8 من الرنا التنظيمية صغيرة 9،10مع إيلاء اهتمام خاص لالرنا الميكروية 11، عن التطور الطبيعي الرنا غير مكود صغيرة المتورطين في السيطرة على جميع الوظائف الخلوية ما يقرب من المنظمين عديد المظاهر واندماجي في التعبير الجيني.

بعد ما يقرب من 10 عاما ميرنا الاكتشاف الأولي في ايليجانس انواع معينة من أمبروس ومختبرات Ruvkun، وتحولت اهتماما متجددا إلى الميدان عندما تم تحديد أعداد كبيرة من miRNAs في ذبابة الفاكهة وفي الخلايا البشرية فضلا 12-15. منذ ذلك الحين، وذلك بفضل النهج المعدلة وراثيا تنوعا، وقفت ذبابة الفاكهة السوداء البطن بها باعتبارها السياق البيولوجي قيما للالخوض ميرنا الحيوي والنشاط. كشفت ذبابة الفاكهة miRNAs ظائف متميزة في عمليات الحشرات محددة أو الحفظ تطويريا، والتي تمتد من الشيخوخة وحتى التمثيل الغذائي، مما يشير إلى مسارات والسلوك، وبطبيعة الحال، تكوين الخلايا العصبية. على طول هذا الاتجاه، فإننا كشف مؤخرا وجود صلة رواية 16 في التعاون فضولrrelation التي تحدث بين الجينات سيد صناع التغيير العالمي / وأنسل من مسار RNA. عامل ذبابة النسخ GCM / الإنزلاق 17-19 يشكل نموذجا فريدا من المحددات مصير الخلية، والتي تملي الدبقية مقابل خيار مصير الخلايا العصبية في متعدد القدرات تطير السلائف العصبية 20. عام البحوث والعشرين طويلة حول هذا الموضوع وأكدت بشكل واضح وقوع مدخلات متعددة ومتداخلة من الجين تنظيم التعبير تتلاقى على صناع التغيير العالمي / أنسل 21-28 لتأسيس مستويات الحد الأدنى المطلوب لتحقيق التوازن بين نسبة الحساسة بين نظرائهم العصبية والدبقية خلال التطور العصبي.

اكتشفنا أن التنظيم عبر استهداف Dmel-miR279 يمثل مستوى الرقابة مزيد من المساهمة في مرحلة ما بعد النسخي صقل من صناع التغيير العالمي / أنسل التعبير 16. تحسينات منهجية محددة على الصعيد العالمي، ويتطلب هذه الخطوط البحثية: طول سنوات، عدة تقنيات وضعت أصلا لتحليل التقليديةتم تحويل الرنا itional لقياس الرنا صغيرة غير الترميز، مثل ما المقايسات حماية ريبونوكلياز، المصفوفات [كدنا] 29-31، في الوقت الحقيقي PCR أساليب 32-35 وتسلسل 36،37. على الجانب الآخر، إعادة تقويم المناهج الفنية عزز تقدمات مستمرة في هذا المجال.

شمال لطخة فحص (NB، أو هلام RNA فحص لطخة) يشكل المثال التمثيلي: يعمل إلى حد كبير على البيانات الشخصية تراكم RNA، لأنه يضمن كل من مستوى التعبير الكميات وكذلك تحديد الحجم. ومع ذلك، فإن حساسية الفقيرة الجوهرية للطريقة يحد عندما يكون ليتم تطبيقها على التعبير الجيني المستقبلون غرامة المنخفضة وفيرة، مثل الرنا قصيرة. والنتيجة الضارة هي شرط كميات كبيرة من الحمض النووي الريبي مجموع، مما يجعل من الصعب تطبيقه على عينات بيولوجية محددة. لهذه الأسباب، NB المتغيرات المحددة للكشف الرنا صغيرة تم وضعها 38-40: نحن استغل لتحسين بروك NBedure 41 (ENB، وتعزيز الشمالية البقعة)، في حين توضيح التفاعل المذكور بين Dmel-miR279 وصناع التغيير العالمي / أنسل.

ويعتمد هذا الأسلوب على خطوة الكيميائية يشابك على أساس النشاط لمشتقات Carbodiimide [1 إيثيل-3- (3 dimethylaminopropyl) carbodiimide، EDC] لإصلاح الحمض النووي على دعامات صلبة. Carbodiimide هو رابط عبر تنوعا معروفة لتحفيز تشكيل السندات أميد بين الكربوكسيل أو مجموعات الفوسفات تنشيط والجماعات أمين 42. يمكن استغلال هذه الخاصية لالرنا صغيرة زوجين تساهميا عبر مجموعة أحادية فسفرته من 5'-الهيدروكسيل إلى الأمينية مجموعات على سطح الأغشية النايلون. التكوين مرفق الناتجة يزيد من سهولة الوصول للحمض النووي يجمد وبدوره، كفاءة التهجين التحقيق المستهدفة، مما يؤدي إلى تعزيز الكشف ملحوظا 43.

هذه التقنية تفترض relevanc معينةالإلكترونية في الدراسات الجزيئية ذبابة الفاكهة، التي وقوع فصول جديدة ومميزة من الرنا غير مكود صغيرة في الظهور 44. من بين هؤلاء، rasiRNAs 45،46 تشكل سلالة محددة من الرنا-التفاعل piwi (piRNAs 47)، والمشاركة في تسلسل محدد إسكات الجينات. تفاصيل منطوق هذه الطريقة يتم وصف كامل وتصور فيما بعد، نسبة إلى تحليل الرنا الميكروية Dmel-miR279 وDmel-miR286، وللمرة الأولى، من rasiRNA واحد، rasi4. نحن دفعت إلى التطرف هذه الطريقة، الأمر الذي سمح لنا الكشف عن أهداف أعرب سيئة من كميات ضئيلة من الحمض النووي الريبي (أقل من 1 ميكروغرام).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

مجموعة 1. عينة

  1. 2 فصل خلايا شبه ملتصقة شنايدر، (1-5 × 10 6 خلايا في المتوسط)، من قبل pipetting وحصادها بواسطة الطرد المركزي (100 x ج لمدة 1 دقيقة). في حالة في المختبر الخلايا الملتصقة مثقف، يعرض للتريبسين لهم في الظروف القياسية أو جمعها مباشرة من لوحات إلى كمية ملائمة من الحمض النووي الريبي استخراج كاشف، من خلال مساعدة من مكشطة الخلية.
  2. لجمع الجنين، وتنمو سلالات ذبابة الفاكهة في أقفاص الطيران والسماح الأجنة تتراكم على وضع البيض لوحات. مسح الأجنة من قبل الفرشاة في الماء المقطر (DH 2 O)، ونبذ الحطام تصفية غربال، وشطف واستعادة الأجنة في قارورة 48.
  3. كتقنية بديلة، تشريح الأنسجة / الأجهزة يدويا. عزل الخصيتين (نظام تفضيلي لتحليل بيرنا) من ذبابة الفاكهة البطن في الفوسفات مخزنة المالحة (PBS) تحت stereomicroscope (20X التكبير)، وذلك باستخدام الإبر أو ملقط تشريح وفيماualized في سوليفان وآخرون 49.
  4. مدقة التجانس عينات بناء على الإدمان من 0.5 حجم استخراج الحمض النووي الريبي كاشف.

2. استخراج الحمض النووي الريبي / تحليل

  1. التعليمات التالية الصانعين أداء عزل الحمض النووي الريبي من خلال الكواشف التجارية. تنبيه! كلاء استخراج الحمض النووي الريبي وعادة ما تكون سامة وكاوية. بدلا من ذلك، وتطبيق البروتوكول استنادا K-بروتين لRNA العزلة 50، على النحو التالي:
    1. تمييع العينات في 400 ميكرولتر من وقف ميكس واحتضان في RT لمدة 15 دقيقة.
    2. استعادة مكونات ذواب بالماء بواسطة الفينول القياسية: الكلوروفورم: كحول أيزو أميلي الاستخراج والكلوروفورم والإيثانول (ETOH) هطول / الغسيل. الهواء الجاف العينات و resuspend في diethylpyrocarbonate (DEPC) المعالجة بالإثير المقطر المزدوج (دد) H 2 O.
  2. تقييم تركيز الحمض النووي الريبي عن طريق الأشعة فوق البنفسجية القياس الطيفي. أيضا ضمان نقاء RNA عالية، على مقربة من 2.0 والسفلىإد على و260/280 قراءة.
  3. تحقق من إعداد RNA على تغيير طبيعة هلام الاغاروز على النحو التالي:
    1. في كوب نظيف، حل 1.2 غرام من الاغاروز في 82 مل من DEPC-DDH 2 O، مع التحريك المستمر. تغلي حتى يذوب تماما.
    2. يسمح الحل هلام ليبرد. عندما تصل درجة الحرارة 60 درجة مئوية إضافة 10 مل من حمض 10X 4 morpholinepropanesulfonic (اجتماعات الأطراف) عازلة ل1X التركيز النهائي (FC)، و 8 مل من الفورمالديهايد بنسبة 37٪ إلى 3٪ FC. تنبيه! الفورمالديهايد هو مادة مسرطنة.
    3. صب جل في خلية الكهربائي الأفقية. السماح للهلام ليصلب تحت غطاء محرك السيارة لا يقل عن 1 ساعة. بعد التصلب، غمر جل في اجتماعات الأطراف 1X.
    4. قسامة 2 ميكروغرام من عينة الحمض النووي الريبي و 1 ميكروغرام من سلم (استخدام علامة RNA عند المرجوة تقييم دقيق). إضافة 3 مجلدات من الاغاروز صبغ تحميل (ALD) إلى RNA وسلم. الحرارة عند 70 درجة مئوية لمدة 5 دقائق وبارد فورا على الجليد. CAUTION! محتويات ALD (بروميد إيثيديوم والفورماميد، انظر المواد) هي المغير وتآكل، على التوالي.
    5. تحميل العينات وتشغيل هلام في 50 فولت لمدة 1 ساعة مع إعادة التدوير عازلة في بعض الأحيان. التحقق من نمط RNA التجزئة التي تصور الأشعة فوق البنفسجية هلام أو التصوير. الاعتراف العصابات المنفصلة الموافق 28S 18S وrRNAs وtRNAs (انظر الشكل 1).
  4. المضي قدما إلى شمال الفحص أو متجر RNA في -80 درجة مئوية.

3. تغيير طبيعة الأكريلاميد إعداد جل

  1. استخدام جهاز صغير الرأسي الكهربي لهذه الخطوة التجزئة (حجم اللوحة حوالي 8 سم × 9 سم، وسمك المشط 0.75 ملم).
  2. تجميع النظارات نظيفة معا في إطار الصب.
  3. تحضير 10 مل من 10٪ مادة الأكريلاميد / مكرر الأكريلاميد (19: 1) حل في اجتماعات الأطراف 1X، 7 M اليوريا. مباشرة قبل صب، إضافة 100 ميكرولتر من بيرسلفات الأمونيوم 10٪ و 10 ميكرولتر من TEMED وتخلط بسرعة الحل. تنبيهالأكريلاميد! هو أعصاب ومسرطنة.
  4. صب جل بين لوحات الزجاج وإدراج مشط جيدا بعناية لتجنب الفقاعات. السماح للهلام تتبلمر في RT لمدة 45 دقيقة على الأقل قبل الاستخدام. بدلا من ذلك، تخزين هلام O / N، ملفوفة في أوراق الترشيح غارقة في المياه ومختومة في التفاف ساران.

إعداد 4. عينة

  1. قسامة 0،5 حتي 20 ميكروغرام من الحمض النووي الريبي مجموع لكل عينة. إذا تجاوز حجم 3-4 ميكرولتر، فراغ تجف العينة.
  2. لتحديد حجم، تشغيل قسامة (20-30 من القانون الجنائي) من رديولبلد انخفاض المدى سلم بالتوازي مع العينات، كعلامة (انظر القسم 4.3 و 4.4 لإعداد). التعامل معها بالتوازي مع العينات، كما هو موضح في الخطوة 4.5.
  3. سلم: إعداد رد الفعل إلى الأمام الفوسفات باستخدام 0.1 ميكروغرام من 10 نقطة أساس في خطوة وسلم. احتضان عند 37 درجة مئوية لمدة 30 دقيقة ووقف رد الفعل بإضافة حمض ethylenediaminetetraacetic (EDTA) إلى 20 ملي FC.
  4. تنقية بواسطة ETOH هطول / الغسيل، والهواء الجاف وResuspend في DDH 2 O (حوالي 100 ميكرولتر). تنبيه! 32 P هي مصدر المشع.
  5. لكل عينة إضافة حجم مساو من صبغة زرقاء الأكريلاميد (ABD). تفسد عن طريق التسخين عند 80 درجة مئوية لمدة 5 دقائق وبارد على الجليد حتى تحميل. تنبيه! الفورماميد (المحتوى في ABD) هو تآكل.

5. الكهربي تجزئة

  1. إزالة لوحات الزجاج من الدعم الصب وبشكل صحيح تجميعها في الخلية الكهربائي. ملء الغرفة الداخلية والخارجية على حد سواء مع كافية العازلة تشغيل (RB).
  2. بلطف إزالة مشط وقبل تشغيل هلام في 200 V لمدة 10 دقيقة. قبل عينات التحميل ويغسل الودائع اليوريا من الآبار بواسطة التدفق بعض RB من خلال حقنة.
  3. نصائح لاستخدام مسطحة بعناية تراصف عينات من الخطوة 4.5 في الجزء السفلي من كل بئر. تحقق الأنود والكاثود اتصالات لتجنب تشغيل مقلوب. بعد تدخل عينات هلام في 100 فولت لمدة 5 دقائق، طncrease الجهد إلى 200 V.
  4. لطول التجزئة من حوالي 7 سم، وشوط 45 دقيقة لمدة كافية. تجنب برموفينول الأزرق (صبغة تتبع في ABD) لتجاوز هلام.
  5. تصور على هلام في الرنا طويلة مجزأة بواسطة إيثيديوم بروميد (EtBr) تلطيخ، باعتباره خطوة اختيارية:
    1. قطع بعيدا 2 سم من أعلى الجل وشطف لفترة وجيزة شريحة في DDH 2 O.
    2. احتضان شريحة هلام في RT لمدة 15 دقيقة مع طيف التسكع في RB، EtBr 0.5 ميكروغرام / مل FC.
    3. يزيل اللون هلام لمدة 15 دقيقة في RB، تصور rRNAs طويلة من الأشعة فوق البنفسجية هلام أو التصوير. تحقق لتحميل RNA والجودة (انظر الشكل 1، لوحة 7). تنبيه! إيثيديوم بروميد هو المغير.
  6. وفي الوقت نفسه المضي قدما النشاف الجزء السفلي من هلام تحتوي على أنواع RNA الصغيرة.

6. جل التنشيف

  1. قطع 6 قطع من الورق النشاف لتناسب مساحة النشاف ويعادل قطعة من unchargeد النايلون الغشاء. بلل ورقة ورقة، وغشاء 2 منصات النشاف في RB. تأكد من نقع تماما منصات طريق الضغط عليها مرارا وتكرارا في RB.
  2. إزالة هلام من الجهاز وفتح النظارات بواسطة متوسط ​​ملعقة. استخدام قطع نظيفة لإزالة الآبار. وضع ورقة هتما الرطب على هلام ورفعه بلطف صعودا.
  3. وضع غشاء النايلون على وجه خال من هلام. علامة الزاوية لتوجيه مرشح وفقا لنموذج تحميل. استكمال "ساندويتش" (3 قطع الورق كل جانب). لفة قضيب من البلاستيك على سطح وصمة عار، لإزالة أي فقاعات الهواء الممكنة.
  4. وضع وصمة عار بين اثنين من منصات النشاف ثم في الكاسيت النشاف. تجميع الكاسيت في وحدة النشاف، وملء الغرفة مع RB والتحقق من التوجه الصحيح (غشاء النايلون يجب أن تبقى بين جل ومحطة ايجابية).
  5. نقل في 20 V لمدة 20 دقيقة. ملاحظة: لضمان ظروف متجانسة، وبعد 10 دقيقة فتح وحدة النشاف وصدوير في اتجاه شطيرة من 180 درجة قبل إتمام عملية التحويل.

7. غشاء يشابك

  1. إعداد 6 مل من الحل يشابك الطازجة (XLS). تشبع 10 سم × 10 سم (أكبر من الغشاء النايلون) قطعة من الورق النشاف مع XLS. تنبيه! حمض الهيدروكلوريك (أحد مكونات XLS) غير ضارة للغاية.
  2. تفكيك صمة عار ووضع غشاء على ورقة الترشيح 3MM الرطب. ملاحظة: يجب أن RNA لا يكون على اتصال مباشر مع ورقة المشبعة. وضع مرشح ورقة بين لوحين من الزجاج والتفاف في ساران التفاف.
  3. تسخين الغشاء عند 60 درجة مئوية لمدة 2 ساعة، تليها DDH 2 O الغسيل. تخزين في -20 درجة مئوية أو الشروع في التهجين.

8. غشاء Prehybridization

  1. إذا كان قد تم التحقق RNA تحميل (خطوة اختيارية 5.5) فانتقل مباشرة إلى التهجين. أو آخر، وقطع بعيدا 1 سم من أعلى إلى مرشح النايلون، لتجنب التحقيق عبر hybridizatioنانوثانية إلى الرنا طويلة مجزأة.
  2. سخن 10 مل من التهجين الحل (HS) عند 37 درجة مئوية. تفسد 1 ملغ من سمك السلمون الحيوانات المنوية عند 95 درجة مئوية لمدة 5 دقائق، وبارد على الجليد وإضافة إلى HS.
  3. احتضان مرشح في HS في 37C لمدة 1 ساعة على الأقل، في ظل التناوب في فرن التهجين. تأكد من أن الجانب RNA للمرشح يواجه HS.

9. التحقيق التجميعي

  1. إنشاء رد فعل الفوسفات إلى الأمام في 10 بمول من قليل النوكليوتيد العقاقير معين، كما هو موضح في 4.3.
  2. إضافة 5 مجلدات من تريس، EDTA-كلوريد الصوديوم (TEN) العازلة للتفاعل وتنقية التمهيدي المسمى من النيوكليوتيدات الفردية من هلام الإقصاء اللوني على أعمدة G-25 باستخدام Sephadex (أو أيضا ETOH هطول). النشاط التحقيق يمكن تقييمها من قبل السائل التلألؤ عداد.

10. غشاء التهجين

  1. استبدال HS استنفدت الطازجة مع 10 مل قسامة (أعدت واستكملت كما هو موضح أعلاه). تسخين التحقيق في95 درجة مئوية لمدة 10 دقيقة، وبارد على الجليد وإضافة إلى HS الرواية. احتضان مرشح في 37 ° C ON.

11. غشاء الغسل

  1. استرداد حل التهجين وتخزينها في -20 درجة مئوية في مربع التدريع النشاط الإشعاعي.
  2. شطف التصفية في غسل العازلة (WB)، وأغسلها جيدا لمدة 10 دقيقة في RT.
  3. استخدام كاشف جيجر مولر لفحص النشاط الإشعاعي المتبقية في زوايا التصفية. عندما الانبعاثات خلفية حوالي 5 من القانون الجنائي، انتقل إلى غشاء المعرض.

12. كشف الإشارة

  1. فضح تصفية على أفلام تصوير الإشعاع الذاتي أو على شاشة تصوير الجزيئي ON. الكشف عن إشارات عن طريق تجهيز الفوتوغرافية أو التحويل الرقمي.
  2. تحليل كثافة الفرقة بواسطة برنامج مخصص الكمي (يماغيج أو Optiquant).

13. غشاء تجريد

  1. لإزالة الإشارات الأولية، غمر الغشاء في 500 مل من الغليان حل تجريد، ثم في احتضان RT لمدة 1 دقيقة. الشروع في رواية (قبل) التهجين أو تخزين مرشح في -20 درجة مئوية.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

باتباع الإجراء الشامل وصفها في نص وتمثيل تخطيطي في الشكل 1، قمنا بتقييم التعبير الرنا صغيرة من عينات الحمض النووي الريبي معقدة من أصول مختلفة. في التجربة المعروضة في الشكل 1، تم عزل الحمض النووي الريبي من 2 خلايا ذبابة الفاكهة شنايدر عن طريق استخراج بروتين K، للتأكد من سلامة (خطوة اختيارية: تغيير طبيعة الاغاروز هلام تجزئة) وتحميلها في الضعف. وقد نشف والنصف من الجل على غشاء ومحايد كيميائيا عبر ربطها EDC. تم نقل النصف الثاني على مرشح النايلون موجبة، ثم عبر ربط الأشعة فوق البنفسجية (1.2 × 10 5 μJ / سم 2). التعبير الذاتية اثنين من الرنا الميكروية عائلة Dmel-miR279 تم التحقق (Dmel-miR279 نفسها وDmel miR286-15) في كل الظروف. الإجراء المحسنة (ENB) يضمن أعلى حساسية لاحترام معيار واحد (البنك الوطني السويسري).

ق = "jove_content"> والكفاءة مختلفة بين الطريقتين، بل هو أفضل وأبرز في أرقام 2 و 3. المنطق التجريبي هو نفسه على النحو الوارد أعلاه: نحن هنا يقدم تقريرا عن نتيجة تمثيلية من شمال لطخة الكشف autoradiographic من rasi4 بيرنا على طول المعايرة من الحمض النووي الريبي مجموع المستخرج من الكبار يطير الخصيتين. ENB بالفعل يسمح الكشف عن عصابة معينة عند 0.5 ميكروغرام من الحمض النووي الريبي يتم تحميل. يظهر جانبا الكمي كيف إشارة يزيد بالتناسب مع كمية من الحمض النووي الريبي مجزأة، مشيرا الى ان نسبة الجرعة / الاستجابة تكمن في مجموعة خطية من الكشف. تصادق لوحة أدناه حساسية تحسين هذه الطريقة بالمقارنة مع البنك المركزي السويسري. في هذه الحالة، يتم الحصول على إشارة للكشف على تجزئة الكهربي من 10 ميكروغرام من الحمض النووي الريبي على الأقل في البنك المركزي السويسري.

ويتم الحصول على نتائج مماثلة مع مختلف الأنواع غير مكود RNA، على سبيل المثال، 5S الريباسي، كما ورد في الشكل 3 </ قوي>.

الشكل 1
الرقم 1. تمثيل تخطيطي لإجراء الشمالية طخة العام. وترد الخطوات الإجرائية الرئيسية وترقيم تدريجيا. تتم مقارنة النتائج بين طخة المحسن الشمالية (ENB) وستاندرد الشمالية البقعة (SNB)، التي أجريت في الظروف نفسها: عزل الحمض النووي الريبي من 2 خلايا ذبابة الفاكهة شنايدر (لوحة 1)، الكهربائي (لوحة 2)، ونقل (لوحة 3) والتهجين ( لوحة 5). ENB يشير إلى إجراء تحسين وصفها في هذا التقرير، الأمر الذي يتطلب مرشح محايد (لوحة 3، النصف الأيسر من الغشاء) ومقرها يشابك EDC (لوحة 4) التي تنص على التساهمية ملزم بين RNA الهدف 5'نهاية وغشاء ( النقاط الوردية في لوحة 4). في البنك الوطني السويسري، يتم الحصول RNA يشابك من العلاج بالأشعة فوق البنفسجية (لوحة 4) على موجبة الشحنة NYLOن غشاء (لوحة 3، النصف الأيمن من الغشاء). 5S RNA إشارة محددة ليست تدريج في ظروف المقارنة، لأنه يستجيب أيضا إلى الاختلافات بين البنك الوطني السويسري والإجراءات ENB. وبالتالي، مبلغ (الموافق 10 من القانون الجنائي) من المسمى 5'(انظر 4.3 نقاط و 4.4 البروتوكول)، وأضيف 50 قليل النوكليوتيد الإقليم الشمالي تدافعت طويلا لكل عينة قبل الكهربائي، لتكون بمثابة "مسمار في" المرجعية ( لوحة 7). يمكن تقييم العملية أيضا على هلام EtBr تلطيخ rRNAs طويلة (انظر النقطة 5.5 من البروتوكول). L = سلم. FV = أمامي عرض، LV = الجانبي عرض، HV = عرض أفقي. الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

الشكل 2
الشكل 2. Comparوكشف تحليل سالبة الشمالية طخة التعبير rasi4. المستويين المحلي للالخصية محددة بيرنا rasi4 بواسطة محسن (ENB) أو معيار (SNB) طخة الشمالية، التي أجريت على كميات متزايدة من الحمض النووي الريبي مجموع (المشار إليها أعلاه كل حارة) المستخرجة من الخصية الكبار ذبابة الفاكهة ، أو من بطون كلها (عبد). لكل منهجية، المدرج الاحصائي جانبا الإبلاغ عن كميات النسبية من الاحترام rasi4 لنفس كمية من "تصاعد" السيطرة تحميل. يتم الجمع بين التحديد الكمي من طريقتين في الرسم البياني أدناه قاطعا وضع المواد الهلامية. الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

الرقم 3
الرقم التحليل المقارن 3. الشمالية البقعة من 5S صRNA التعبير. كعنصر تحكم إيجابية والمعايرة التجريبية، تم تمديد التحليل السابق ل5S الريباسي. التفاصيل كما في الشكل 2. الرجاء النقر هنا لمشاهدة نسخة أكبر من هذا الرقم.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

على الرغم من تقديرنا للالمحنك المتشابكة من خلالها RNA ينظم تكوين الخلايا العصبية في تزايد مستمر، والآثار الميكانيكية للcircuitries القائم على RNA العصبي التي تؤثر بيولوجيا الخلايا الجذعية، وتمايز الخلايا العصبية / التكامل الوظيفي، وتطوير الأمراض العصبية والسرطان لا تزال غير مستكشفة. صيانة هذه الشبكات من خلال الممالك يجعل إمكانات النظم الوراثية كما الدروسوفيلاميلانوجاستر مفيدة لكشف مسارات الخلوية غير مستكشفة، والتي تعتبر غير مكود الرنا القصير وعوامل النسخ كلاعبين الجزيئي كبير. في هذا الرأي، والتنميط صغيرة مستويات التعبير RNA المرشح propaedeutic إلى تحليلات دقيقة وظيفية: مثال يأتي من المظاهرة الأخيرة في أن Dmel-miR279 ينظم مصير المحدد صناع التغيير العالمي / أنسل في الجسم الحي، من خلال إنجاز نسخة محسنة من شمال التنشيف فحص و أداة لتحليل التعبير.

51، فقد كان ينظر ملحوظة كوسيلة مرجعية لتحليل الحمض النووي الريبي. على الرغم من بعض القيود الجوهرية لهذا الفحص، وتحويل الصعب معدد شكل أو الأخطاء المحتملة مع إشارة الكمي، قد اكتشفوا اختراقات الأخيرة في RNA البيولوجيا الجزيئية هذه التقنية التقليدية كنظام "سريعة ونظيفة" لمعايرة التعبير الذاتية للحمض نووي صغير الأحماض أو التحقق من فعالية gain- أو الخسارة من وظيفة النهج. والمثال نموذجي، يضع تحليل الشمالي على أساس اكتشاف الأصلي من الرنا الميكروية، في حين يبقى النهج في طليعة لأهميتها في توصيف خصائص جديدة من أي وقت مضى من الرنا التنظيمية 52.

ويستند البديل الموصوفة هنا على زيادة الحساسية بسبب يشابك الكيميائي من الحمض النووي الريبي. نحن believethe الطريقة لا تزال تستخدم بشكل سيئ في ذبابة الفاكهة، ب التحرير عندما تستغل أدت إلى اكتشافات هامة 52، لأنه يجعل من الممكن التعبير التنميط الحمض النووي الريبي من عينات صغيرة (أقل من 1 ميكروغرام)، بمتوسط ​​10-30 تحسين أضعاف كشف الهدف RNA 41،43، كما حصلنا عليها في ظروفنا (أرقام 2 و 3).

تشكل سلامة الحمض النووي الريبي مسألة حاسمة من أجل الحصول على نتائج متسقة وقابلة للتكرار. التلاعب RNA تتطلب دقة وسرعة للحد من احتمال تدهور العينة التي تحدث بين استخراج والتحميل. في هذا الغرض، يتعين على جميع الحلول لتكون diethylpyrocarbonate- (DEPC) معاملة قبل الاستخدام (حضانة 2 ساعة في وجود 0.1٪ DEPC عند 37 درجة مئوية ومن ثم تعقيمها) للتحايل على النشاط ريبونوكلياز. العلاج حل يضمن أفضل النتائج فيما يتعلق باستخدام المياه DEPC كمذيب. سيتم تشطف جميع المعدات على قدم المساواة في DEPC ddH20، وبعد تنظيف السطح من قبل المطهر ريبونوكلياز محددة.

> RNA العزلة: بروتوكولات مختلفة يمكن استخدامها لعزل الحمض النووي الريبي سليمة. أي Guanidinium التجاري ثيوسيانات-الفينول كلوروفورم كاشف يمكن أن تستخدم بنجاح: ويوصى بشدة أنهم عندما التعبير RNA الصغيرة هي منخفضة بشكل خاص (على سبيل المثال، rasi4، Figure2) أو عندما لا يتم تنفيذ تنقية RNA على عينات جديدة (على سبيل المثال، والحفاظ عليها في تخزين الأنسجة الكواشف). من التجربة، أسفرت عزل الحمض النووي الريبي من عينات استقرت أقسى بكثير وتتطلب شروط استخراج أكثر جذرية. في الظروف القياسية، وطريقة تستند K-بروتين وصف الاستعدادات يضمن نوعية جيدة كذلك، (ويمثل نموذجا هاما في Figure1) ولكنها ليست الخيار الأمثل للعينات المحفوظة في الكواشف التخزين.

وأخيرا، لأن هذا الإجراء يهدف إلى الكشف محدد RNA الصغيرة، ومجموعات القائم على تنقية عمود مخصص يمكن استخدامها مباشرة لعزل الحمض النووي الريبي الصغيرة، على الرغم عشرغير يجعل من الصعب التحقق من سلامة الحمض النووي الريبي. في بديل لهذا الإجراء القائم على هلام الكلاسيكي للسيطرة على سلامة الحمض النووي الريبي هو موضح أعلاه، يمكن تقييم جودة RNA بواسطة أدوات للتحليل على رقاقة مصغرة من أنماط الحمض النووي.

واقترح MOPS-هيدروكسيد الصوديوم العازلة (درجة الحموضة 7) كمنطقة عازلة التفضيلية لكلا المحسن الكهربائي هلام الشمالي والنشاف: عازلة الاختيار. علينا أيضا أن تستخدم بصورة مرضية تريس بورات-EDTA (TBE) العازلة في تجاربنا. في هذه الحالة، لأن وجود جماعات أمين النيوكليوفيل من تريس (هيدروكسي) aminomethane أن يتحلل أو إلغاء DEPC خلال العلاج نفسه، فمن المستحسن حل تريس في المياه المعالجة DEPC بدلا من علاج عازلة TBE أعدت بالفعل.

الكهربي تشغيل والتنشيف: قبل تشغيل هلام أمر ضروري لإزالة الزائدة بيرسلفات والقضاء hyperfocusing. ينبغي الحفاظ على تشغيل ما قبل المعلمات أيضا خلال تجزئة، وتجنب electropho سريع جداretic المدى. قبل التحميل، تأكد من إزالة الرواسب اليوريا الممكنة من الآبار، من خلال التدفق عازلة داخل. هذا وسوف تحد عينة امتداد والضمانات دقيقة الطبقات RNA، وإنتاج أشرطة autoradiographic حلها خلال الكشف عن الإشارات. أي غشاء النايلون محايد يمكن استخدامها كوسيلة لدعم نقل الحمض النووي. لا صمة عار الحمض النووي الريبي لأكثر من 20-30 دقيقة في الشروط المحددة.

يشابك: يمثل يشابك الكيميائية استنادا EDC-التقدم المنهجي حاسم من هذه نسخة مطورة لطخة الشمالي. إمكانية تشعبي الأنواع RNA قصيرة على الأسطح محايدة من حدود تساهمية بين مجموعة RNA 5'mono فوسفات والنايلون الأمينات الأولية يترك غالبية القواعد المتاحة لالتهجين. هذا يعزز حساسية من 10-20xrespect ليشابك التقليدي. لا بد من إعداد كمية جديدة من حل يشابك لكل النشاف، بكميات كافية لتشبع غشاء المناسب.

التهجين والغسل: تحقيقات يفضل أن يكون المسمى حديثا. بحث في نشاط معين (يعتمد على نشاط محدد وكمية من دمجها النوكليوتيدات رديولبلد وأيضا على كمية من مسبار المتاحة لالتهجين) يحدد حساسية الكشف عن الهدف. عندما [γ- 32 P] يستخدم ATP مع نشاط معين من 3،000 تسى / ملمول، ويتوقع 10 نسخة في الدقيقة 6 / بمول لوضع العلامات 100٪ من 5 'ينتهي.

حل التهجين يمكن استردادها وإعادة الاستفادة منها، معتبرا أنه نظرا ل32 P الاضمحلال، نصفين النشاط التحقيق في حوالي 14 يوما.

بسبب حياد الغشاء، ومن المتوقع على التهجين انخفاض الضوضاء في الخلفية. إذا كانت هناك حاجة الظروف الغسيل أكثر صرامة، والحد تدريجيا غسل العازلة القوة الأيونية (تصل إلى 0.2x SSPE) أو إضافة كميات متزايدة من المنظفات الأيونية (تصل إلى 0.5٪ SDS) أو غسل رفع درجة الحرارة إلى 37 درجة مئوية.

= "jove_content"> لتجنب تداخل الإشارات مع التهجين المقبل، فمن المستحسن للتحقق من خلال إعادة تعريض-أن التحقيق الأولي قد أزيلت تماما من مرشح على تجريد. ولكن نظرا لفقدان التدريجي للRNA من مرشح ينبغي تجنب أكثر من 3-4 دورات من تجريد وإعادة التحقيق.

تحليل لطخة الشمالي ضروري عندما يتطلب قياس حجم RNA. على الرغم من أن هذا الاختبار قد تفتقر إلى دقة QPCR النهج القائم على مضان لتقدير الرنا صغيرة، ميزة تستمد من استخدام تغيير طبيعة تجزئة / النشاف والتي تعتمد على تحقيق التهجين كخطوة فريدة من نوعها قبل الكشف عن الرنا الهدف. ونتيجة لذلك، والوحي من إشارات محددة من العينة مباشرة و لا يتطلب أي خطوة إضافية من الأنزيمية العلاج / تحويل / التضخيم، وهو ما يعني استخدام مجموعات تجارية مخصصة. مستويات RNA يمكن قياس ومقارنة بين عينات متعددة على الأغشية واحدة. وبالتالي Northeيعمل صمة عار آكانيوز عادة باعتباره التحقق الصارمة بالنسبة لبيانات QPCR. وبدافع من متطلبات تجريبية محددة، الأسلوب تم حتى تحسنت خلال السنوات الأخيرة، سواء على مستوى الحساسية والدقة بحيث كمية محدودة من الرنا (أنظر الشكلين 2 و 3) ويلزم للتحليل ناجحة.

بروتوكول قدمنا ​​يمكن تكييفها لمجموعة واسعة من التطبيقات وخاصة حيث المواد متاحة بكميات محدودة. المصدر البيولوجي للعينات الحمض النووي الريبي يمكن أن يكون غير متجانس: بقدر ما تشعر بالقلق ذبابة الفاكهة والأجنة أو مراحل النمو الأخرى هي مناسبة، ولكن أيضا تشريح الأنسجة أو الأعضاء يدويا، والخلايا الفردية المعزولة الفرز cytotypes أو مزارع الخلايا.

وعلاوة على ذلك، على الرغم من الرنا الميكروية هي الطبقة الأكثر وفرة من الرنا التنظيمية قصيرة في الخلية والموضوع الرئيسي للتحقيق في مجال الجينات السيطرة التعبير بوساطة RNA، فإنها لا سلبياتtitute الأسرة الوحيدة من الرنا غير المكودة الخلوية. العديد من مجموعات صغيرة من الرنا تعمل عبر الممالك (على سبيل المثال، الرناوات siRNAs الذاتية، piRNAs، snoRNAs، مصنع tasiRNAs) وتتميز معظمهم من "محطة المجانية 5 (معدلة)، المستمدة عادة من تجهيز إندو ribonucleolytic السلائف الجزيئات. وتشكل هذه الميزة الشرط الهيكلي الفريد المطلوبة بدقة لتطبيق تحسين منهجية محددة تستند إلى يشابك الكيميائية، على الرغم من حجم RNA يتعين النظر أيضا، عندما يتم تحليل الرنا أطول. في الشكل 2 ونحن التقرير تحليلا الشمالية طخة كشف نسبيا مستويات rasi4 54 عضوا في الطبقة الجرثومية من الخط محددة الرنا صغيرة (Piwi-RNA أو التفاعل piRNAs). في ظروف مستويات التعبير الفقيرة ومحددة، وتعزيز حساسية هذه الطريقة يمكن معاقبة نتائج ناجحة، ولا سيما بالنظر إلى أن البروتوكول أفادت يمكن تحسينها بواسطة مشطining مع التطبيقات العملية الأخرى التي سبق وصفها في الأدب 55،56.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

وأيد هذا العمل من قبل المعهد الوطني للسانتيه آخرون ميديكال للبحوث، والمركز الوطني للبحوث العلمية، وجامعة دي ستراسبورغ، دخلت المستشفى دي ستراسبورغ، وجمعية صب لا SUR LE بحوث السرطان، والمعهد الوطني للسرطان، الوكالة الوطنية للبحوث ومنطقة الألزاس.

وقد تم دعم بيترو انيف من قبل مؤسسة بحوث صب لا ميديكال. حاليا، فهو حاصل على الزمالة ISTITUTO ايطالي TECNOLOGIA (IIT). معتمدة تكاليف النشر من قبل الشبكة Neurex (TriNeuron - برنامج INTERREG الرابع الراين العليا)

Materials

Name Company Catalog Number Comments
FINAL COMPOSITION/NAME COMPANY CATALOGUE (Stock) COMMENTS
GENERAL REQUIREMENT
Centrifuge, 5418 Eppendorf 5418 000.017
Decontaminant, RNase Away Sigma-Aldrich 83931 Apply on glass/plasticware, wipe and rinse
RNase inhibitor, DEPC Sigma-Aldrich D5758 Hazardous //// 1609-47-8
SAMPLE PREPARATION
Stereo Microscope, M60 Leica 
1X PBS Buffer
137 mM NaCl Sigma-Aldrich S3014 7647-14-5  
2.7 mM KCl Sigma-Aldrich P9541 7447-40-7 
10 mM Na2HPO4 Sigma-Aldrich S3264 7558-79-4 
1.8 mM KH2PO4 Sigma-Aldrich P9791 7778-77-0 
RNA EXTRACTION/ANALYSIS
UV-Vis Spectrophotometer Thermo Scientific Nanodrop 2000
Gel Imager, ChemiDoc XRS+ Biorad 170-8265
Horizontal Electrophoresys, Mini-Sub Cell GT BioRad 170-4487EDU
RNA extraction reagent, TRIzol Reagent Life Technologies 15596026 Hazardous
PCA (25:24:1), 1:1 for extraction Sigma-Aldrich 77617 136112-00-0
Chlorophorm, 1:1 for extraction Sigma-Aldrich C2432 67-66-3  
EtOH, 2.5 vol. for precipitation, 70% for washing Sigma-Aldrich 59844 64-17-5 
Gene Ruler 1Kb DNA Ladder Thermo Scientific SM0311
Stop Mix
300 mM NaOAc, pH 5.5 Sigma-Aldrich S2889 127-09-3
1x RSB Solution
2% sodium dodecyl sulfate (SDS) Sigma-Aldrich 71736 Never cool down SDS to avoid  precipitation //// 151-21-3
2 mg/ml Proteinase K Roche Applied Science 0-3115828001 EC 3.4.21.64 9
10X Reticulocyte Standard Buffer (RSB)
100 mM Tris-Cl, pH 7.4 Sigma-Aldrich T5941 1185-53-1  
100 mM NaCl Sigma-Aldrich S3014 7647-14-5  
30 mM MgCl2 Sigma-Aldrich M8266 7786-30-3
Denaturing Agarose Gel
1.2% Agarose Sigma-Aldrich A9539 Let the gel solidify for at least 1 hr //// 9012-36-2
10X MOPS Buffer
0.2 M MOPS sodium salt, pH 7 Sigma-Aldrich M9381 Do not confuse MOPS sodium salt with MOPS //// 71119-22-7
Agarose Loading Dye
1x MOPS Buffer
3% formaldehyde Sigma-Aldrich F8775 Hazardous //// 50-00-0
50% formamide Sigma-Aldrich 47670 Hazardous //// 75-12-7
Ethidium bromide (EtBr) 30 μg/ml Sigma-Aldrich E1510 Hazardous //// 1239-45-8
Bromophenol blue  Sigma-Aldrich B0126 115-39-9 
SMALL RNA FRACTIONATION
Flat gel loading tips Life Technologies LC1002
Savant SpeedVac Concentrator Thermo Scientific  DNA120
Vertical Electrophoresis, Mini-PROTEAN Tetra Cell  Biorad 165-8000
Denaturing Acrylamide Gel
10% acrylamide/bis-acrylamide (19:1) Sigma-Aldrich A3449 Hazardous. Let the gel polymerize for 45 min before use
1x TBE Buffer (or 1x MOPS Buffer)
7 M urea Sigma-Aldrich U6504 57-13-6
0.1% ammonium persulfate Sigma-Aldrich 215589 7727-54-0 
0.1% TEMED Sigma-Aldrich T9281 110-18-9
Gene Ruler Ultra Low Range DNA Ladder (10 bp-step) Thermo Scientific SM1211 Label 0.1 μg, as described in the "probe labeling" reaction
Acrylamide Blue Dye 
50% formamide Sigma-Aldrich 47670 Hazardous //// 75-12-7
Bromophenol blue Sigma-Aldrich B0126 115-39-9 
Running Buffer (RB)
1x MOPS Buffer 
Alternative RB: 1x TBE Buffer
1x TBE Buffer
5X TBE
445 mM Tris-base Sigma-Aldrich T1503 77-86-1 
445 mM boric acid Sigma-Aldrich B7901 10043-35-3
20 mM EDTA Sigma-Aldrich EDS 60-00-4  
Gel Staining Solution
Ethidium bromide 0.5 μg/ml Sigma-Aldrich E1510 Hazardous //// 1239-45-8
1x RB Stain for 15 min with EtBr, destain for 15 min w/o EtBr
BLOTTING
3MM Whatman paper Sigma-Aldrich Z270849
Neutral Nylon Membrane, Hybond NX GE Healthcare Life Science RPN203T Photosensitive
CROSSLINKING
Crosslinking Solution (XLS)
1% 1-methylimidazole (v/v) Sigma-Aldrich 336092 Always prepare a fresh aliquot of XLS //// 616-47-7
12.5 mM HCl Sigma-Aldrich H1758 Hazardous //// 7647-01-0
3.1% EDC (w/v) Sigma-Aldrich 3450 25952-53-8  
(PRE)-HYBRIDIZATION
Liquid Scintillation Counter  Beckmann LS 6500
Sheared Salmon Sperm, 0.1 mg/ml  Life Technologies AM9680
rasi4 anti-sense probe 5' CGGUGUUCGACAGUUCCUCGGG -3'
5s-rRNA anti-sense probe 5'-CAACACGCGGTGTTCCCAAGCCG-3'
Dmel-miR279 anti-sense probe 5'-TTAATGAGTGTGGATCTAGTCA-3'
Dmel-miR286 anti-sense probe 5'-AGCACGAGTGTTCGGTCTAGTCA-3'
Purification Kit, Illustra MicroSpin G-25 Columns GE Healthcare Life Science 27-5325-01
(Pre)-Hybridization Solution (HS)
0.5% SDS Sigma-Aldrich 71736 151-21-3 
5x Denhardt's Solution
20X SSPE
3.6 M NaCl Sigma-Aldrich S3014 7647-14-5  
0.2 M sodium phosphate Sigma-Aldrich 342483 7601-54-9  
20 mM EDTA (pH 8.0) Sigma-Aldrich EDS  60-00-4  
50x Denhardt's Solution
1% Ficoll 400 (w/v) Sigma-Aldrich F2637 26873-85-8
1% Polyvinylpyrrolidone Sigma-Aldrich PVP40 9003-39-8
1% BSA Sigma-Aldrich A7906 9048-46-8  
1X TEN Buffer
10 mM Tris-Cl (pH 8.0) Sigma-Aldrich T1503 77-86-1 
100 mM NaCl Sigma-Aldrich S3014 7647-14-5  
1 mM EDTA (pH 8.0) Sigma-Aldrich EDS 60-00-4  
Probe Labelling
0.4 μM oligonucleotide
1.5 μl Ci/μl [γ-32P] ATP Perkin Elmer NEG002A Hazardous //// 51963-61-2
1x T4 Polynucleotide Kinase Buffer Biolabs B0201
T4 Polynucleotide Kinase 0.5 units/μl Biolabs M0201 EC 2.7.1.78
WASHING
Geiger Mueller Detectors Canberra Industries MCB2/CPS – EM77021
Washing Buffer (WB), 2x SSPE
Stringent Washing Buffers
0.2x SSPE
2x SSPE, 0.5% SDS
0.2x SSPE, 0.5% SDS
SIGNAL DETECTION
PharosFX Plus System Biorad 170-9460
Image J Freely available
Quantity One Biorad
X-ray films , BioMax XAR Sigma-Aldrich F5888 Photosensitive
Developer for X-ray films Sigma-Aldrich P7042
Fixer for X-ray films Sigma-Aldrich P7167
STRIPPING
Stripping Solution
10 mM Tris-HCl pH 8.8 Sigma-Aldrich T1503 77-86-1 
5 mM EDTA Sigma-Aldrich EDS 60-00-4  
0.1% SDS Sigma-Aldrich 71736 Add SDS after boiling to avoid foaming //// 151-21-3

DOWNLOAD MATERIALS LIST

References

  1. The RNA World. Gesteland, R. F., Cech, T. R., Atkins, J. F. 3rd, Cold Spring Harbor Laboratory Press. (2006).
  2. Mercer, T. R., Dinger, M. E., Mattick, J. S. Long non-coding RNAs: insights into functions. Nat Rev Genet. 10, 155-159 (2009).
  3. Salmena, L., Poliseno, L., Tay, Y., Kats, L., Pandolfi, P. P. A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell. 146, 353-358 (2011).
  4. Cesana, M., et al. A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA. Cell. 147, 358-369 (2011).
  5. Orphanides, G., Reinberg, D. A unified theory of gene expression. Cell. 108, 439-451 (2002).
  6. Mehler, M. F., Mattick, J. S. Noncoding RNAs and RNA editing in brain development, functional diversification, and neurological disease. Physiol Rev. 87, 799-823 (2007).
  7. Fire, A., Xu, S., Montgomery, M., Kostas, S., Driver, S., Mello, C. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391, 806-811 (1998).
  8. Hamilton, A., Baulcombe, D. A species of small antisense RNA in posttranscriptional gene silencing in plants. Science. 286, 950-952 (1999).
  9. Lee, R. C., Feinbaum, R. L., Ambros, V. The C. Elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 75, (1993).
  10. Wightman, B., Ha, I., Ruvkun, G. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell. 75, 855-862 (1993).
  11. Fabian, M. R., Sonenberg, N., Filipowicz, W. Regulation of mRNA translation and stability by microRNAs. Annu Rev Biochem. 79, 351-379 (2010).
  12. Pasquinelli, A. E., et al. Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature. 408, 86-89 (2000).
  13. Lagos-Quintana, M., Rauhut, R., Lendeckel, W., Tuschl, T. Identification of novel genes coding for small expressed RNAs. Science. 294, 853-858 (2001).
  14. Lau, N. C., Lim, L. P., Weinstein, E. G., Bartel, D. P. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science. 294, 858-862 (2001).
  15. Lee, R. C., Ambros, V. An extensive class of small RNAs in Caenorhabditis elegans. Science. 294, 862-864 (2001).
  16. Laneve, P., et al. The Gcm/Glide molecular and cellular pathway: new actors and new lineages. Dev Biol. 375, 65-78 (2013).
  17. Hosoya, T., Takizawa, K., Nitta, K., Hotta, Y. Glial cells missing: a binary switch between neuronal and glial determination in Drosophila. Cell. 82, 1025-1036 (1995).
  18. Jones, B. W., Fetter, R. D., Tear, G., Goodman, C. S. Glial cells missing: a genetic switch that controls glial versus neuronal fate. Cell. 82, 1013-1023 (1995).
  19. Vincent, S., Vonesch, J. L., Giangrande, A. Glide directs glial fate commitment and cell fate switch between neurons and glia. Developement. 122, 131-139 (1996).
  20. Cattenoz, P. B., Giangrande, A. Lineage specification in the fly nervous system and evolutionary implications. Cell Cycle. 12, 2753-2759 (2013).
  21. Jones, B. W., Abeysekera, M., Galinska, J., Jolicoeur, E. M. Transcriptional control of glial and blood cell development in Drosophila: cis-regulatory elements of glial cells missing. Dev Biol. 266, 374-387 (2004).
  22. Ragone, G., et al. Transcriptional regulation of glial cell specification. Dev Biol. 255, 138-150 (2003).
  23. Akiyama-Oda, Y., Hosoya, T., Hotta, Y. Asymmetric cell division of thoracic neuroblast 6-4 to bifurcate glial and neuronal lineage in Drosophila. Development. 126, 1967-1974 (1999).
  24. Bernardoni, R., Kammerer, M., Vonesch, J. L., Giangrande, A. Gliogenesis depends on glide/gcm through asymmetric division of neuroglioblasts. Dev Biol. 216, 265-275 (1999).
  25. Ragone, G., Bernardoni, R., Giangrande, A. A novel mode of asymmetric division identifies the fly neuroglioblast 6-4T. Dev Biol. 235, 74-85 (2001).
  26. Soustelle, L., Roy, N., Ragone, G., Giangrande, A. Control of gcm RNA stability is necessary for proper glial cell fate acquisition. Mol Cell Neurosci. 37, 657-662 (2008).
  27. Akiyama, Y., Hosoya, T., Poole, A. M., Hotta, Y. The gcm-motif: a novel DNA-binding motif conserved in Drosophila and mammals. Proc. Natl. Acad. Sci. USA. 25, 14912-14916 (1996).
  28. Miller, A. A., Bernardoni, R., Giangrande, A. Positive autoregulation of the glial promoting factor glide/gcm. EMBO J. 17, 6316-6326 (1998).
  29. Krichevsky, A. M., King, K. S., Donahue, C. P., Khrapko, K., Kosik, K. S. A microRNA array reveals extensive regulation of microRNAs during brain development. RNA. 9, 1274-1281 (2003).
  30. Liu, C. G., et al. An oligonucleotide microchip for genome-wide microRNA profiling in human and mouse tissues. Proc. Natl. Acad. Sci. USA. 101, 9740-9744 (2004).
  31. Yin, J. Q., Zhao, R. C., Morris, K. V. Profiling microRNA expression with microarrays. Trends Biotechnol. 26, 70-76 (2008).
  32. Schmittgen, T. D., Jiang, J., Liu, Q., Yang, L. A high-throughput method to monitor the expression of microRNA precursors. Nucleic Acids Res. 32, E43 (2004).
  33. Chen, C., et al. Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res. 33, e179 (2005).
  34. Shi, R., Chiang, V. L. Facile means for quantifying microRNA expression by real-time PCR. Biotechniques. 39, 519-525 (2005).
  35. Raymond, C. K., Roberts, B. S., Garrett-Engele, P., Lim, L. P., Johnson, J. M. Simple quantitative primer-extension PCR assay for direct monitoring of microRNAs and short-interfering RNAs. RNA. 11, 1737-1744 (2005).
  36. Wang, Z., Gerstein, M., Snyder, M. RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet. 10, 57-63 (2009).
  37. Linsen, S. E., et al. Limitations and possibilities of small RNA digital gene expression profiling. Nat Methods. 6, 474-476 (2009).
  38. Valoczi, A., et al. Sensitive and specific detection of microRNAs by northern blot analysis using LNA-modified oligonucleotide probes. Nucleic Acids Res. 32, e175 (2004).
  39. Varallyay, E., Burgyan, J., Havelda, Z. Detection of microRNAs by Northern blot analyses using LNA probes. Methods. 43, 140-145 (2007).
  40. Kim, S. W., et al. A sensitive non-radioactive northern blot method to detect small RNAs. Nucleic Acids Res. 38, e98 (2010).
  41. Pall, G. S., Hamilton, A. J. Improved northern blot method for enhanced detection of small RNA. Nat Protoc. 3, 1077-1084 (2008).
  42. Hermanson, G. T. Bioconjugate Techniques. 2nd, Academic Press, Inc. (2008).
  43. Pall, G. S., Codony-Servat, C., Byrne, J., Ritchie, L., Hamilton, A. Carbodiimide-mediated cross-linking of RNA to nylon membranes improves the detection of siRNA, miRNA and piRNA by northern blot. Nucleic Acids Res. 35, e60 (2007).
  44. Guzzardo, P. M., Muerdter, F., Hannon, G. J. The piRNA pathway in flies: highlights and future directions. Curr Opin Genet Dev. 23, 44-52 (2013).
  45. Aravin, A. A., et al. Double-stranded RNA-mediated silencing of genomic tandem repeats and transposable elements in the D. melanogaster germline. Curr. Biol. 11, 1017-1027 (2001).
  46. Vagin, V. V., et al. A distinct small RNA pathway silences selfish genetic elements in the germline. Science. 313, 320-324 (2006).
  47. Brennecke, J., et al. Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila. Cell. 128, 1089-1103 (2007).
  48. Sullivan, W., Ashburner, M., Hawley, R. S. Drosophila protocols. Cold Spring Harbor Laboratory Press. (2008).
  49. Zamore, P. D., Ma, S. Isolation of Drosophila melanogaster testes. J. Vis. Exp. (51), e2641 (2011).
  50. Sambrook, J., Fritsch, E. F., Maniatis, T. Molecular cloning : a laboratory manual. 2nd, Cold Spring Harbor Laboratory Press. (1989).
  51. Alwine, J. C., Kemp, D. J., Stark, G. R. Method for detection of specific RNAs in agarose gels by transfer to diazobenzyloxymethyl-paper and hybridisation with DNA probes. Proc. Natl. Acad. Sci. USA. 74, 5350-5354 (1977).
  52. Hansen, T. B., et al. Natural RNA circles function as efficient microRNA sponges. Nature. 495, 384-388 (2013).
  53. Flores-Jasso, C. F., Salomon, W. E., Zamore, P. D. Rapid and specific purification of Argonaute-small RNA complexes from crude cell lysates. RNA. 19, 271-279 (2013).
  54. Specchia, V., et al. Hsp90 prevents phenotypic variation by suppressing the mutagenic activity of transposons. Nature. 463, 662-665 (2010).
  55. Várallyay, E., Burgyán, J., Havelda, Z. MicroRNA detection by northern blotting using locked nucleic acid probes. Nat Protoc. 3, 190-196 (2008).
  56. Koscianska, E., Starega-Roslan, J., Czubala, K., Krzyzosiak, W. J. High-resolution northern blot for a reliable analysis of microRNAs and their precursors. ScientificWorldJournal. 11, 102-117 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics