작은 RNA 종의 북부 오 탐지의 향상된
1Département de Génomique Fonctionnelle et Cancer, Institut de Génétique et de Biologie Moléculaire et Cellulaire, 2Center for Life NanoScience, Istituto Italiano di Tecnologia

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

이 책의 목적은 시각화 및 초파리에서 추출한 RNA에 향상된 북부 얼룩 프로토콜의 동작 단계를 논의 배아, 세포 및 조직을 melanogaster하는 것입니다. 이 프로토콜은 작은 RNA 종의 효율적인 검출에 특히 유용하다.

Cite this Article

Copy Citation | Download Citations

Laneve, P., Giangrande, A. Enhanced Northern Blot Detection of Small RNA Species in Drosophila Melanogaster. J. Vis. Exp. (90), e51814, doi:10.3791/51814 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

지난 수십 RNA 수준에서 유전자 발현을 제어 메커니즘 주위 과학적 관심 폭발을 보아왔다. 분자 생물학의이 지점은 크게 전사 후 조절에 중요​​한 선수로의 RNA를 비 암호화의 발견에 의해 연료를 공급하고있다. 이러한 혁신적인 관점은 높은 처리량 레벨 (게놈 전체의 식별) 또는 단일 후보 분석 (특정 종의 정상 상태 축적)으로 모두 함께 짧은 RNA를 발현 프로파일 링에 대한 강력한 기술의 개발에 의해 촉발되었다. 여러 첨단 전략 투여 또는 도피 분자를 시각화 현재 사용할 수 있지만, 북부 오 점 분석은 RNA 발현의 즉각적이고 정확한 평가를위한 분자 생물학 자격이 접근 남아있다. 이는 많은 경우에 더 정교하고 고가의 기술의 응용을 향해 첫 단계는 쉽게 통찰력을 얻기 위해 우선적 인 방법 남아 나타내고RNA 생물학에. 여기에서 우리는 수동으로 애벌레 / 성인 조직을 해부 또는 체외 배양 된 세포에서, 전체 배아를 melanogaster 초파리에서 약하게 발현 마이크로 RNA (또는 다른 작은 규제 RNA 종)을 검출 (북 오 강화) 효율적인 프로토콜 개요. RNA의 매우 제한된 양이 필요하고 계측법 절연 세포가 될 수있는 흐름 물질의 사용은 또한 예상된다.

Introduction

RNA 생화학는 지난 몇 년 동안 일에 극적으로 진행되는 발생했습니다. 유전자 발현의 조절에서 RNA 전위의 우리의 이해는 신규 한 RNA 기반 규제 메커니즘 3,4의 발견에 의해 이미 공지 된 전사 후 이벤트 깊은 특성화에 의해, 강력한 비 암호화 리보 - 레귤레이터 (2)의 식별 정보를 이용하여 버스트되었습니다 5. 모두 함께 이러한 연구가 허용 한 RNA 생물학 극적으로 현재 과학 풍경에 주요 연구 대상이되고, 현장을 확인합니다. 특히, 최근 몇 년 동안 우리는 분자 신경 생물학 (6), 현대 생명 과학에서 가장 역동적 인 연구 영역 중 하나에서 "RNA 세계"의 보급에 미치는 영향의 감각을 얻고있다. 지난 세기 지난 10 년 동안 과학 전반적인 시나리오는 RNA 간섭 7,8 발견 의해 소형 RNA를 규제 9,10의 혁명되었습니다마이크로 RNA (11)에 특정과 관련하여, 내생 적 유전자 발현의다면 발현과 조합 규제 등 거의 모든 세포 기능의 조절에 관여 작은 비 암호화 RNA를 표현.

miRNA가 높은 번호가 초파리뿐만 아니라 12 ~ 15 인간의 세포에서 발견했을 때 거의 십년 AMBROS 및 Ruvkun의 연구소에 의해 예쁜 꼬마 선충에서 miRNA의 초기 발견 후, 새롭게 관심 분야에가되었습니다. 그 이후로, 다양한 형질 전환 방법 덕분에, 초파리는 miRNA의 생합성 및 활동에 대해 깊이 탐구 귀중한 생물 컨텍스트로서 서 있었다. 초파리의 miRNA가 경로를, 신진 대사 노화 신호에서 이르기-곤충 특정 또는 진화 적으로 보존 된 프로세스에 고유 한 기능을 계시했다 행동하고, 물론, 신경. 이 방향을 따라, 우리는 최근 흥미로운 공동의 소설 링크 16을 발표했다마스터 유전자 GCM / RNA 활공 경로 사이에서 발생 rrelation. 플라이 전사 인자 GCM / 글라이드 17-19 능성에 아교 대 신경 운명의 선택이 신경 전구체 20 비행 지시 세포 운명 결정의 독특한 예를 구성한다. 스물 년이 주제에 대한 오랜 연구는 GCM /를 통해 수렴 유전자 발현 조절의 다양하고 중복 입력의 발생 신경 개발 과정에서 신경 세포와 신경 교세포의 대응 사이의 섬세한 비율을 균형에 필요한 임계 값 레벨을 설정하는 21 ~ 28 활공을 강조 분명히하고있다.

우리는 DMEL-miR279 타겟팅을 통해 그 규정은 GCM의 전사 후 미세 조정 / 16활공에 기여하는 또 다른 제어 수준을 나타냅니다 발견했다. 전 세계적으로 이러한 연구 선이 필요 한 특정 방법론 개선 : 년 함께 몇 가지 기술은 원래 트라를 분석하기 위해 개발itional RNA들처럼, 작은 비 코딩의 RNA를 정량화 변환 된의 RNase 보호 분석법, cDNA를 배열 29-31, 실시간 PCR 방법 32-3536,37 시퀀싱 등. 다른 측면에서, 기술적 접근 방법의 재 교정이 분야에서 지속적으로 진행되는 육성하고있다.

북부 얼룩 분석 (NB, 또는 RNA 겔 블롯 분석은) 대표 인스턴스를 구성 : 그것은 크기가 결정뿐만 아니라 모두 발현 수준의 정량을 보장 이후 크게, RNA 축적을 프로파일 사용된다. 그러나, 본 방법의 본질적인 나쁨 감도는 짧은 RNA를 원한다면, 낮은 풍부한 유전자 발현 미세 튜너에인가 될 때 제한된다. 해로운 결과는 특정 생체 시료 어려운 그 응용 프로그램을 만드는 총 RNA, 많은 양의 요구 사항입니다. 이러한 이유로, 작은 RNA를 검출을위한 특정 NB 변종의 경우 38 ~ 40를 개발되어 있습니다 : 우리는 개선 된 NB 발동을 이용했다edure 41 (ENB, 향상된 북부 오), DMEL-miR279와 GCM / 활공의 전술 상호 작용을 해명하면서.

이 방법은, 카르 보디이 미드 유도체의 활동을 기반으로 화학적 가교 결합 단계에 의존 [1 - 에​​틸 3 - (3 - 디메틸 아미노 프로필) 카 보디이 미드, EDC] 고체 지지체에 핵산을 고정한다. 카르 보디이 미드 활성화 카복실 또는 포스페이트 그룹 및 아민 기 (42) 사이에 아미드 결합의 형성을 촉진하는 것으로 알려진 다기능 가교제이다. 이 속성은 나일론 막의 표면에서 그룹을 아미노하기 위해 모노 인산화 된 5'-하이드 록실 그룹을 통해 공유 커플 작은 RNA들에 악용 될 수 있습니다. 얻어진 부착 구성은 다시 검출 현저한 향상 43 결과 프로브의 타겟의 혼성화의 효율을 고정화 핵산의 접근성을 높이고.

이 기술은 특정 relevanc 가정초파리 분자 연구에서 전자가있는 작은 비 암호화 RNA를 소설과 독특한 클래스의 발생이 44 떠오르고있다. 이 중, 45, 46가 순서 특정 유전자 침묵 (gene silencing)에 참여 piwi 상호 작용하는 RNA를 (piRNAs 47)의 특정 하위 유형을 구성 rasiRNAs. 이 방법의 동작 상세하게 설명 하나 rasiRNA, rasi4 중, 최초로, 마이크로 RNA-DMEL miR279DMEL-miR286의 분석을 기준으로하고, 이하에서 가시화된다. 우리는 RNA (이하 1 μg)의 최소 금액에서 제대로 표현 대상도 공개 허용이 방법을, 극단으로 밀었다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1 샘플 컬렉션

  1. 피펫에 의해 반 부착 슈나이더의 두 세포 (평균 1-5 × 10 6 세포), 분리 및 원심 분리 (1 분 100 XG)에 의해 그들을 수확. 체외 부착 세포 배양의 경우는, 표준 조건에서 그들을를 Trypsinize 직접 셀 스크레이퍼의 도움으로, RNA 추출 시약의 양에 편리한 플레이트에서 그들을 수집.
  2. 배아 수집, 플라이 케이지에서 초파리 균주를 성장하게 배아는 계란 누워 판에 누적됩니다. 증류수에 붓 DH (2 O)에 의해 배아를 닦아, 자체 필터링 파편을 버리고 씻어 유리 병 (48)에 배아를 복구 할 수 있습니다.
  3. 다른 방법으로 수동으로 조직 / 장기를 해부하다. 힘으로 박리 바늘 또는 집게를 사용하여, 실체 현미경 (배율 20 배)에서는 인산염 완충 식염수 (PBS)에 초파리 복부에서 고환 (피르 분석을위한 우선적 인 시스템)을 격리설리반 49 ualized.
  4. 유 봉은 RNA 추출 시약 0.5 볼륨의 중독에 샘플을 균질화.

2 RNA 추출 / 분석

  1. 다음은 제조업체의 지침에 상용 시약을 통해 RNA 분리를 수행합니다.주의! RNA 추출 에이전트는 일반적으로 독성 및 부식성이다. 또는 다음과 같이, RNA 분리 (50)에 대한 테 K-기반의 프로토콜을 적용
    1. 정지 믹스 400 μL로 샘플을 희석하고 실온에서 15 분 동안 배양한다.
    2. 클로로포름 : 이소 아밀 알코올과 클로로포름 추출 및 에탄올 (EtOH를) 침전 / 세탁에 의한 표준 페놀에 의해 hydrosoluble 구성 요소를 복구 할 수 있습니다. 공기 샘플을 건조 diethylpyrocarbonate (DEPC)로 재현 탁 더블 (일) H 2 O 증류 - 처리
  2. UV 분광 측정하여 RNA 농도를 평가합니다. 또한, RNA의 순도는 2.0에 가까운 높은 BAS 보장260에 ED / 280 읽기.
  3. 다음과 같이 아가 로스 젤을 변성에 RNA 준비 확인
    1. 깨끗한 비커에서 연속 교반, DEPC-DDH 2 O의 82 ㎖에 아가로 오스의 1.2 g을 녹인다. 완전히 용해 될 때까지 끓인다.
    2. 겔 용액을 냉각시킵니다; 온도가 60 °가 10 배 4 morpholinepropanesulfonic 산 10 ㎖를 추가 C에 도달 할 때 (MOPS)는 1X 최종 농도 (FC)에 버퍼, 8 ml의 3 포름 알데히드 % 37 %의 FC.주의! 포름 알데히드는 발암 물질이다.
    3. 수평 전기 영동 셀에 겔을 붓고. 젤은 적어도 1 시간 동안 후드 강화하도록 허용합니다. 응고 후, MOPS 1X에 젤 잠수함.
    4. 분취 RNA 시료 2 μg 및 1 μg의 래더 (정확한 평가가 요구 될 때 RNA 마커를 사용). RNA에 아가로 오스 로딩 염료 (ALD)의 3 볼륨을 추가하고 사다리. 열 70 ° C 5 분 동안 얼음에 즉시 차가운에서. CA의 ution! ALD의 내용 (에티 디움 브로마이드 및 포름 아미드, 자료 참조)는 각각, 돌연변이 및 부식성이다.
    5. 샘플을로드하고 가끔 버퍼 재활용 약 1 시간 동안 50 V에서 젤을 실행합니다. UV 시각화 또는 젤 이미징에 의해 RNA의 분류 패턴을 확인합니다. 28S와 18S rRNAs과 된 tRNA에 해당하는 개별 밴드를 인식 (그림 1 참조).
  4. -80 ° C에서 북부 분석 또는 저장 RNA 진행합니다.

3 변성 아크릴 아마이드 젤 준비

  1. 이 분류 단계에 대한 작은 수직 전기 영동 장치 (플레이트의 크기 8cm X 9cm, 빗 두께 0.75 mm)를 사용합니다.
  2. 주조 프레임에서 함께 깨끗한 안경을 조립합니다.
  3. (1 19) MOPS 1X 용액, 7 M 우레아 10 % 아크릴 아미드 / 비스 - 아크릴 아미드 10 ㎖를 준비합니다. 바로 주입하기 전에, 10 %의과 황산 암모늄 100 ㎕ TEMED 및 10 μL를 추가하고 신속 용액을 혼합한다.주의! 아크릴 아마이드는 신경 독성 및 발암 물질이다.
  4. 유리판 사이에 젤을 부어 거품을 피하기 위해 신중하게 잘 빗를 삽입합니다. 젤은 사용하기 전에 적어도 45 분 동안 실온에서 중합 보자. 또한, 겔 O / N, 물에 젖은 여과지에 싸여 사란 랩에 밀봉 저장합니다.

4 샘플 준비

  1. 나누어지는 0.5-20 각 샘플에 대한 총 RNA ㎍의. 볼륨 3-4 μl를 초과하면, 진공은 샘플을 건조.
  2. 크기 결정 용 마커로서 (제조 섹션 4.3 및 4.4 참조), 샘플에 평행 방사성 표지 저역 사다리의 분취 량 (20-30 CPS)를 실행. 단계 4.5에 기재된 바와 같이, 샘플들에 병렬로 취급.
  3. 사다리 : 10 bp의 단계 사다리의 0.1 μg을 사용하여 인산 앞으로 반응을 설정합니다. 30 분 동안 37 ° C에서 품어 20 mM의 FC에 에틸렌 디아민 테트라 아세트산 (EDTA)를 추가하여 반응을 중지합니다.
  4. EtOH로 침전 / 세척, 건조 공기에 의해 정화DDH 2 O (약 100 μL).에 재현 탁주의! 32 P 방사성 소스입니다.
  5. 각 샘플에 아크릴 아미드 파란색 염료 (ABD)의 동일한 볼륨을 추가합니다. 5 분 동안 80 ° C에서 가열에 의해 변성 및로드.주의까지 얼음에 멋지다! 포름 아미드 (ABD의 내용이) 부식성이다.

(5) 전기 영동 분획

  1. 캐스팅 지원을 유리판을 제거하고 적절하게 전기 영동 셀을 조립한다. 충분한 실행 버퍼 (RB)와 모두 내부 및 외부 챔버를 입력합니다.
  2. 부드럽게 빗를 제거하고 10 분 동안 200 V에서 젤을 미리 실행합니다. 로드 샘플 전에 주사기를 통해 일부 RB를 분출하여 우물에서 요소 예금을 씻어.
  3. 플랫 팁을 사용하여 각 우물의 바닥에서 4.5 단계에서 신중 충 샘플. 거꾸로 실행을 방지하기 위해 양극과 음극 연결을 확인합니다. 샘플이 5 분 동안 100 V에서 젤을 입력 한 후, 난V. 200에 전압을 ncrease
  4. 약 7cm의 분별 길이를 들어, 45 분 - 장기적으로는 충분하다. 젤을 오버플로 브로 모 페놀 블루 (ABD에서 추적 안료를)하지 마십시오.
  5. 선택적인 단계로 에티 디움 브로마이드 (EtBr이) 염색에 의해 분류 된 긴 RNA를 겔에 - 시각화 :
    1. 겔의 정상에서 멀리 2cm를 잘라 짧게 DDH 2 O.에서 슬라이스를 씻어
    2. RB, EtBr이 0.5 μg / ml의 FC 부드러운 동거와 15 분 동안 실온에서 겔 슬라이스를 품어.
    3. RB에서 1​​5 분 동안 젤 Destain, UV 조사 또는 겔 촬상 장거리 rRNAs 시각화. RNA 로딩과 품질 (그림 1, 패널 7).주의를 확인! 에티 디움 브로마이드가 돌연변이이다.
  6. 한편 작은 RNA 종을 포함하는 겔의 하부 블로 팅을 진행.

6 젤 블로 팅

  1. 6 블롯 영역에 맞추기 위해 압지 조각과 uncharge의 상당 부분을 잘라D 나일론 막을. 용지, 막과 RB의 두 블로 팅 패드를 적 십니다. 완전히 반복 RB에서 그들을 압박하여 패드를 흡수해야합니다.
  2. 장치에서 젤을 제거하고 주걱의 평균에 의해 안경을 엽니 다. 우물을 제거하기 위해 깨끗한 커터를 사용합니다. 젤에 젖은 와트 종이를 놓고 조심스럽게 들어 올립니다.
  3. 겔의 자유면에 나일론 막을 놓습니다. 샘플 상태에 따라 필터의 방향을 모서리를 표시. "샌드위치"(3 종이 조각 각면)을 완료합니다. 가능한 모든 공기 방울을 제거하고, 표면에 오점 플라스틱 막대 롤.
  4. 모래 바닥 카세트에이 모래 바닥 패드와 다음 사이의 오점을 놓습니다. , 모래 바닥 모듈에 카세트를 조립 RB와 챔버를 작성하고 (겔과 긍정적 인 말단 사이에 유지해야 나일론 막) 올바른 방향을 확인합니다.
  5. 20 분 동안 20 V에서 전송합니다. 참고 : 10 분 블로 팅 모듈과 연구를 연 후, 균일 한 조건을 보장하기 위해전송을 완료하기 전에 180도 샌드위치 otate.

7 막 가교

  1. 신선한 가교 솔루션 (XLS)의 6 ML을 준비합니다. 포화 10cm는 (나일론 막보다 더 큰) 10cm XLS.주의와 압지의 조각을 X!에 HCl (XLS의 구성 요소)이 높은 부식성이다.
  2. 오점을 해체 젖은 3MM 필터 종이에 막 배치합니다. 참고 : RNA는 포화 종이와 직접 접촉하지 않아야합니다. 두 개의 유리판 사이의 필터 종이를 놓고 사란 랩에 포장.
  3. DDH 2 O 세척 한 다음 2 시간 동안 60 ° C에서 막을 열. -20 ° C에서 저장 또는 하이브리드를 진행합니다.

8 멤브레인의 프레 하이브 리다이 제이션

  1. RNA로드 (옵션 단계 5.5)을 선택되어 있으면 직접 하이브리드를 진행합니다. 아니면, 나일론 필터의 꼭대기로부터 거리 1cm 잘라 프로브 간 hybridizatio 않도록분별 긴 RNA를 ns의.
  2. 37 ° C에서 하이브리드 솔루션 (HS) 10 ㎖를 예열. 5 분 동안 95 ° C에서 연어 정자의 1 mg의 변성 얼음에 시원하고 HS 추가 할 수 있습니다.
  3. 혼성화 오븐에서 회전에 따라, 적어도 1 시간 동안 37 ℃에서 HS에서 필터를 배양한다. 필터의 RNA 측이 HS에 직면 해 있는지 확인합니다.

9 프로브 합성

  1. 4.3에 설명 된대로 특정 안티센스 올리고 뉴클레오티드의 10 pmol의에 인산 앞으로 반응을 설정합니다.
  2. (EtOH로 침전도 이상) 트리스-EDTA-염화나트륨 (TEN)의 5 볼륨이 반응 버퍼 및 G-25 세파 덱스 컬럼에 젤 배제 크로마토 그래피에 의한 합병되지 않는 뉴클레오티드의 표지 프라이머를 정화 추가합니다. 프로브 활성을 액체 섬광 계수기에 의해 평가 될 수있다.

(10) 멤브레인 하이브리드

  1. 신선한 10 ㎖의 분취 (전술 한 바와 같이 제조 및 보완)로 배출 HS를 교체합니다. 에 프로브를 가열얼음에 시원하고 새로운 HS에 추가 10 분 동안 95 ° C에서. 37 ° C ON에서 필터를 품어.

(11) 멤브레인 세척

  1. 하이브리드 솔루션을 복구 및 방사능 차폐 상자에 -20 ° C에서 보관하십시오.
  2. 세척 버퍼 (WB)의 필터를 세척하여 실온에서 10 분 동안 철저하게 씻는다.
  3. 필터 코너에서 잔류 방사능을 점검하기위한 가이거 뮬러 감지기를 사용합니다. 배경 배출량은 약 5 CPS 때, 박람회를 막에 진행합니다.

(12) 신호 감지

  1. 오토 라디오 그래피 필름 또는 분자 영상 화면 ON에 필터를 노출. 사진 처리 또는 디지털 변환하여 신호를 알 수있다.
  2. 전용 정량화 소프트웨어 (ImageJ에 또는 Optiquant)에 의해 밴드의 강도를 분석 할 수 있습니다.

(13) 멤브레인 스트립

  1. 스트리핑 끓는 용액의 500 ㎖에 잠수함, 막 1 차 신호를 제거하려면다음 1 분 동안 실온에서 배양한다. 소설 (전) 하이브리드를 진행 또는 -20 ° C에서 필터를 저장합니다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

도 1에서 설명 텍스트 및 개략적 전반적인 절차에 따라, 우리는 상이한 기원의 복잡한 RNA 샘플로부터 RNA를 작은 식을 평가 하였다. (: 아가 로스 젤 분류 변성 선택적 단계) 두 번에로드 그림 1에서 제시 한 실험에서, RNA는 무결성 검사 테 K 추출하여 초파리 슈나이더의이 세포로부터 분리되었다. 겔의 절반은 중립 멤브레인에 블 롯팅시키고, 화학적 가교 결합에 의해 EDC; 후반전 후 UV 크로스가 결합, 양전하 나일론 필터 상에 (1.2 × 105 μJ / cm 2)을 옮겼다. DMEL-miR279 가족에 속하는이 마이크로 RNA의 내생 적 표현은 (DMEL-miR279 자체 DMEL-miR286 15)는 두 조건 모두에서 확인되었다. 개선 된 절차 (ENB)는 표준 일 (SNB) 높은 감도 존중을 보장합니다.

그림 2와 3으로 강조 표시됩니다. 실험의 이론적 근거는 상기와 동일합니다 : 여기에 우리가 고환을 비행 성인에서 추출한 총 RNA의 적정 함께 피르의 rasi4 북부 오 방사 법적 검출의 대표 결과를보고합니다. RNA의 0.5 μg이로드 될 때 ENB가 이미 특정 대역을 감지 할 수 있습니다. 정량 옆으로 신호가 비례 용량 / 응답 비율이 검출 선형 범위에있는 것을 나타내는 분획 RNA의 양에 따라 증가하는 방법을 보여줍니다. 패널은 아래 SNB에 비해이 방법의 감도 향상을 비준. 이 경우, 검출 된 신호는 적어도 SNB위한 RNA의 10 μg의 전기 영동 분획에 얻어진다.

그림 3 <에보고 된 유사한 결과, 예를 들어 다른 비 암호화 RNA 종으로 5 초에 rRNA의를 얻을 수있다/ STRONG>.

그림 1
전체 북부 얼룩 절차의 도식 표현을 그림. 주요 절차 단계를 나열하고 점진적으로 번호가 매겨집니다. 결과는 동일한 조건에서 수행 된 강화 북부 오 (ENB) 및 표준 북부 오 (SNB), 사이 비교 : 초파리 슈나이더의 2 셀 (패널 1), 전기 (패널 2), 전송 (패널 3) 및 하이브리드 (에서 RNA 분리 패널 (5)). ENB 대상 RNA 5'-끝과 막 사이의 바인딩 공유를 (설정 중립 필터 (패널 3 막의 왼쪽 반) 및 EDC 기반의 가교 (패널 4)이 필요합니다 본 보고서에 기술 개선 절차를 의미 패널 4 핑크 도트). SNB에서 RNA 가교 긍정적 NYLO 충전에 UV 처리 (패널 (4))에 의해 얻어진다N 막 (3 판, 멤브레인의 우측 절반). 그것은 또한 SNB와 ENB 절차의 차이에 응답하기 때문에 5 초 RNA 특정 신호는 비교 조건에 교정기 없습니다. 따라서, 5'-표지 (10 CPS에 상당) 양 (기준 "에서 스파이크"역할 50 NT 긴 스크램블링 된 올리고 뉴클레오티드를 전기 영동 전에 각각의 샘플에 첨가하고, (점 4.3 프로토콜 4.4 참조) 패널 7). 또한 긴로드 rRNAs (프로토콜 포인트 5.5 참조)에서 겔을 EtBr 염색에 의해 평가 될 수있다. L = 사다리입니다. FV = 정면보기, LV = 측면보기, HV = 가로보기. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림이
그림 2와 비교 예rasi4 표현의 극상 북부 얼룩 분석. 고환 별 피르의 rasi4의 내인성 수준이 향상 (ENB) 또는 표준 (SNB) 북부의 얼룩에 의해 공개됩니다, 성인 초파리의 고환에서 추출 (각 레인 위에 표시) 총 RNA의 양을 증가 수행 , 또는 전체 복부에서 (압드). 각 방법의 경우, 옆으로 히스토그램 컨트롤을로드 "에 스파이크"같은 양의에 rasi4 존중의 상대적인 양을보고합니다. 두 가지 방법에서 정량화가 젤 아래에 배치 결정적인 그래프에 결합된다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 3
5 초 (R)의 그림 3과 비교 북부 얼룩 분석RNA 발현. 양성 대조군 및 실험 교정 같이, 이전의 분석 5S rRNA에까지 확장되었다. 자세한 사항은 그림 2에서와 같이. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

RNA가 신경을 조절 통해 얽혀 닳고 닳은 우리의 감사가 지속적으로 증가하고 있지만, 신경 줄기 세포 생물학, 신경 세포의 분화 / 기능 통합, 신경 병변 및 암의 개발에 영향을 미치는 RNA 기반 circuitries의 기계적인 의미는 미개척 남아있다. 초파리는 짧은 RNA를 비 암호화 및 전사 인자가 큰 분자 플레이어로 간주되는 비경 셀룰러 경로를 해명하는 수단으로서 melanogaster 왕국 통해 이러한 네트워크의 유지 보수 시스템은 유전자의 전위를 만든다. 이보기에서, 후보 작은 RNA 발현 수준의 프로파일 링은 정확한 기능 분석에 대한 초보의이다 : 예를 들어 북 블로 팅 분석의 개선 된 버전으로 통해 ​​수행 DMEL-miR279가 생체 내에서 GCM / 글라이드 운명의 결정을 변조 우리의 최근 시위에서 온다 발현 분석 용 툴.

(51)에서의 초기 개발 이후 클래스 = "jove_content는">, NB는 RNA 분석을위한 기준 방법으로 간주되어왔다. 신호 정량화와 형식이나 가능한 오류를 다중화하기 어려운 변환 등이 분석의 몇 가지 본질적인 한계에도 불구하고, RNA 분자 생물학의 최근 혁신은 작은 리보의 내생 적 표현을 시금위한 "신속하고 깨끗한"시스템과 같은 종래의 기술을 재발견 산 또는 이득이 또는 기능 상실 접근 방법의 효과를 검증하기위한. 접근 방식은 규제의 RNA (52)의 계속 새로운 특성의 특성의 관련성에 대한 최전선에 남아있는 반면 패러다임 인스턴스로, 북부 분석은 마이크로 RNA의 원래 발견의 기초에 낳는다.

여기에 설명 된 변형으로 인해 RNA의 화학적 가교로 증가 감도를 기반으로합니다. 우리는 believethe 방법은 여전히 저조한 초파리에 사용되며, B이 RNA의 표적 탐지 41,43의 평균 10 ~ 30 배 향상 작은 샘플 (이하 1 μg)에서 가능 프로파일 링 RNA 발현을 만드는 것이므로 우리는 우리의 조건에서 얻어진 유타 악용, 중요한 발견 52되었다 (그림23).

RNA의 무결성 일관되고 재현 가능한 결과를 얻기 위해 중요한 문제를 구성한다. RNA 조작 추출 및로드 사이에 발생 가능한 샘플의 저하를 제한하는 정확성과 신속성을 필요로한다. 이러한 목적에서 모든 솔루션의 RNase 활성을 회피하기 위해 (DEPC) (멸균 후 37 ° C에서 0.1 % DEPC의 존재에서 2 시간 배양 등)을 사용하기 전에 처리 diethylpyrocarbonate- 할 필요가있다. 용 체화 처리는 용매로서 물을 DEPC 사용에 대해 더 나은 결과를 보장한다. 모든 장비는 동등의 RNase 특정 표면 오염 제거제로 청소 한 후, DEPC ddH20 씻어야합니다.

(예를 들어, rasi4, 그림 2) 또는 RNA 정화가 (신선한 샘플에서 수행되지 않은 경우 예를 들어, 조직의 스토리지에 보존 시약). 경험에서, 안정화 된 샘플에서 RNA 분리는 상당히 가혹한 결과 더 과감한 추출 조건이 필요합니다. 표준 조건에서 설명한 테 K-기반의 방법뿐만 아니라, (a 상당한 예가 그림 1에 나타낸다) 양질의 제제를 보장하지만 스토리지 시약 보존 샘플에 대한 최적의 선택이 아니다.

이 절차는 작은 RNA 특정 검출 목표로 보낸 마지막으로, 전용 칼럼 정제 계 키트에도 불구 번째, 바로 작은 RNA의 분리를 위해 사용될 수있다IS는 RNA의 무결성을 확인하기 위해 더 열심히합니다. 상기 RNA 무결성 제어 고전 겔 기반 절차 대안으로, RNA의 질은 핵산 패턴 온칩 소형화 분석 장비에 의해 평가 될 수있다.

버퍼 선택 : MOPS-수산화 나트륨 완충액 (pH 7) 첨단 노던 겔 전기 영동 및 블랏 모두 우선적 버퍼로서 제안되었다. 우리는 또한 만족스럽게 우리의 실험에서 트리스 - 보레이트-EDTA (TBE) 버퍼를 사용했다. 트리스 (히드 록시 메틸) 아미노 메탄의 친핵체 아민 기의 존재 자체를 가수 분해 처리시 DEPC를 비활성화하기 때문이 경우, 그것은 DEPC-처리 된 물 대신 처리 TBE 버퍼 이미 제조에 트리스 용해 권장된다.

전기 영동 실행 및 모래 바닥 : 젤을 사전 실행하는 과잉과 황산을 제거하고 hyperfocusing을 제거하기위한 필수적입니다. 사전 실행 매개 변수를 너무 빨리 electropho을 피하고, 분별 동안도 유지되어야한다retic 실행됩니다. 넣기 전에 내부 버퍼를 분출하여, 우물에서 가능 우레아 퇴적물을 제거해야합니다. 이 신호를 검색하는 동안 해결 방사 법적 밴드를 생산, 샘플 파급 및 보증 정확한 RNA 계층화를 제한합니다. 상관 중립 나일론 막을 핵산 전달을위한 지지체로서 사용할 수있다. 지정된 조건에서보다 20 ~ 30 분 동안 RNA를 지워하지 마십시오.

가교 : EDC 기반의 화학적 가교 결합이 강화 된 북부 오 버전의 중요한 방법 론적 진보를 나타냅니다. 가능성 RNA 5'mono 포스페이트 그룹과 나일론 급 아민 사이의 공유 경계가 중립면에 단기 RNA 종을 가교 혼성화 가능한 염기의 대부분을 남긴다. 이것은 기존의 가교 결합 10-20xrespect하여 감도를 향상시킨다. 그것은 적절한 막 포화 충분한 양으로, 각각의 블 롯팅을 위해 가교 용액의 신선한 양을 제조하는 것이 중요하다.

하이브리드 및 세척 : 프로브는 바람직 갓 표시되어야합니다. (하이브리드 화 가능한 프로브의 양 또한 특정 활성에 의존하고 통합하는 방사성 표지 된 뉴클레오티드의 양) 특정 활성을 조사하면 타겟 검출의 민감도를 결정한다. 3000 CI / 밀리몰의 특정 활성 ATP 사용된다 [32 P가 γ-]하면, 5 '말단을 100 % 라벨링 106 CPM / pmol의 기대된다.

하이브리드 솔루션은 복구 할 수 있으며, 고려, 다시 - 사용, 그 때문에 32 P 붕괴, 약 14 일 프로브 활동 반쪽입니다.

때문에 막 중립성, 낮은 소음은 하이브리드에 기대된다. 엄격한 세척 조건이 필요한 경우, 점진적으로 (0.2X SSPE까지) 세척 완충액의 이온 세기를 감소 시키거나 37 °의 C로 세척 승온 온성 세제 또는 (0.5 % SDS에) 증가하는 양을 추가한다.

RNA 크기 측정이 필요한 경우 노던 블롯 분석은 필수적이다. 이 분석은 형광 계 qPCR에이 작은 RNA를 추정 용의 접근의 정확성이 부족하더라도 이점 / 변성 분획을 사용하여 블로 팅 및 표적 RNA를 검출하기 전에 고유 한 단계로서 의존​​ 혼성화 프로브로부터 도출한다. 따라서, 샘플에서 특정 신호의 계시를 직접하고 전용 상용 키트의 사용을 암시 효소 처리 / 변환 / 증폭의 추가 단계를 필요로하지 않는다. RNA 수준을 정량화하고 단일 막의 여러 시료 사이에 비교 될 수있다. 따라서 NORTHERN 오점 일반적 qPCR에 데이터에 대한 엄격한 검증로서 사용된다. 특정 실험 요구 사항에 박차를 가해,이 방법은 RNA를 제한 금액 (그림 23 참조)이 때문에 둘 모두를 감도와 해상도의 수준에서, 지난 년 동안 개선되었습니다 성공적인 분석을 위해 필요합니다.

우리가 제공하는 프로토콜은 재료가 제한된 양으로 사용할 특히 다양한 용도에 적용 할 수있다. RNA 샘플의 생물학적 소스 유형이 될 수 있습니다 초파리에 관한까지로, 배아 또는 다른 발달 단계는 개별 셀 정렬 절연 cytotypes 또는 세포 배양는 적합하지만, 수동 조직이나 장기를 해부.

또한, 마이크로 RNA는 세포 RN​​A 및 매개 유전자 발현 조절 분야에서의 주요한 연구 대상이 짧은 RNA를 규제의 가장 풍부한 수준이더라도, 이들은 단점이 수행되지휴대 비 암호화 RNA를 유일한 가족 titute. 작은 RNA를 많은 클러스터는 일반적으로 전구체 분자의 엔도 ribonucleolytic 처리에서 도출 나라 (예를 들면, 내인성 siRNA가, piRNAs, snoRNAs, 식물 tasiRNAs) 그들 대부분은 (변경되지 않은) 자유로운 5 '말단으로부터 특징 걸쳐 기능한다. 이 기능은 긴 RNA를 분석 할 때 RNA 크기뿐만 아니라 고려 될 필요가 있더라도, 엄격 화학적 가교 결합에 기초하여 특정 개선 된 방법을 적용하기 위해 필요한 고유 제반 구조를 구성한다. 도 2에서는, 향상된 민감도 노던 블롯 분석은 비교적 rasi4 54 나쁨 특정 발현 수준의 조건에서 세균 라인 별 작은 RNA들 중 최고 (RNA 또는 piRNAs을 Piwi이 - 작용.)의 부재의 레벨을 검출보고 이 방법의 특히보고 프로토콜이 상기 빗살함으로써 개선 될 수 있음을 고려하여, 성공적인 결과를 제재 할이미 문학 (55, 56)에 설명 된 다른 실제 구현과를 ining.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

이 작품은 연구소 국립 드 라 상테 동부 표준시 드 라 공들인 Médicale에 의해 지원되었다, 센터 국립 드 라 공들인 과학원, 4 대학 드 스트라스부르, HOPITAL 드 스트라스부르, 협회 부어 라 공들인 쉬르 르 암, 연구소 국립 뒤 암, 직원은 국립 드 라 공들인 및 지역 알자스.

피에트로 Laneve는 라 공들인 Médicale는 Fondation에 의해 부어지지를 받고 있습니다. 현재는있는 Istituto 이탈리아 Tecnologia (IIT) 교제의받는 사람입니다. 출판 비용을 Neurex 네트워크에 의해 지원됩니다 (TriNeuron - 프로그램 Interreg IV 상단 라인)

Materials

Name Company Catalog Number Comments
FINAL COMPOSITION/NAME COMPANY CATALOGUE (Stock) COMMENTS
GENERAL REQUIREMENT
Centrifuge, 5418 Eppendorf 5418 000.017
Decontaminant, RNase Away Sigma-Aldrich 83931 Apply on glass/plasticware, wipe and rinse
RNase inhibitor, DEPC Sigma-Aldrich D5758 Hazardous //// 1609-47-8
SAMPLE PREPARATION
Stereo Microscope, M60 Leica 
1X PBS Buffer
137 mM NaCl Sigma-Aldrich S3014 7647-14-5  
2.7 mM KCl Sigma-Aldrich P9541 7447-40-7 
10 mM Na2HPO4 Sigma-Aldrich S3264 7558-79-4 
1.8 mM KH2PO4 Sigma-Aldrich P9791 7778-77-0 
RNA EXTRACTION/ANALYSIS
UV-Vis Spectrophotometer Thermo Scientific Nanodrop 2000
Gel Imager, ChemiDoc XRS+ Biorad 170-8265
Horizontal Electrophoresys, Mini-Sub Cell GT BioRad 170-4487EDU
RNA extraction reagent, TRIzol Reagent Life Technologies 15596026 Hazardous
PCA (25:24:1), 1:1 for extraction Sigma-Aldrich 77617 136112-00-0
Chlorophorm, 1:1 for extraction Sigma-Aldrich C2432 67-66-3  
EtOH, 2.5 vol. for precipitation, 70% for washing Sigma-Aldrich 59844 64-17-5 
Gene Ruler 1Kb DNA Ladder Thermo Scientific SM0311
Stop Mix
300 mM NaOAc, pH 5.5 Sigma-Aldrich S2889 127-09-3
1x RSB Solution
2% sodium dodecyl sulfate (SDS) Sigma-Aldrich 71736 Never cool down SDS to avoid  precipitation //// 151-21-3
2 mg/ml Proteinase K Roche Applied Science 0-3115828001 EC 3.4.21.64 9
10X Reticulocyte Standard Buffer (RSB)
100 mM Tris-Cl, pH 7.4 Sigma-Aldrich T5941 1185-53-1  
100 mM NaCl Sigma-Aldrich S3014 7647-14-5  
30 mM MgCl2 Sigma-Aldrich M8266 7786-30-3
Denaturing Agarose Gel
1.2% Agarose Sigma-Aldrich A9539 Let the gel solidify for at least 1 hr //// 9012-36-2
10X MOPS Buffer
0.2 M MOPS sodium salt, pH 7 Sigma-Aldrich M9381 Do not confuse MOPS sodium salt with MOPS //// 71119-22-7
Agarose Loading Dye
1x MOPS Buffer
3% formaldehyde Sigma-Aldrich F8775 Hazardous //// 50-00-0
50% formamide Sigma-Aldrich 47670 Hazardous //// 75-12-7
Ethidium bromide (EtBr) 30 μg/ml Sigma-Aldrich E1510 Hazardous //// 1239-45-8
Bromophenol blue  Sigma-Aldrich B0126 115-39-9 
SMALL RNA FRACTIONATION
Flat gel loading tips Life Technologies LC1002
Savant SpeedVac Concentrator Thermo Scientific  DNA120
Vertical Electrophoresis, Mini-PROTEAN Tetra Cell  Biorad 165-8000
Denaturing Acrylamide Gel
10% acrylamide/bis-acrylamide (19:1) Sigma-Aldrich A3449 Hazardous. Let the gel polymerize for 45 min before use
1x TBE Buffer (or 1x MOPS Buffer)
7 M urea Sigma-Aldrich U6504 57-13-6
0.1% ammonium persulfate Sigma-Aldrich 215589 7727-54-0 
0.1% TEMED Sigma-Aldrich T9281 110-18-9
Gene Ruler Ultra Low Range DNA Ladder (10 bp-step) Thermo Scientific SM1211 Label 0.1 μg, as described in the "probe labeling" reaction
Acrylamide Blue Dye 
50% formamide Sigma-Aldrich 47670 Hazardous //// 75-12-7
Bromophenol blue Sigma-Aldrich B0126 115-39-9 
Running Buffer (RB)
1x MOPS Buffer 
Alternative RB: 1x TBE Buffer
1x TBE Buffer
5X TBE
445 mM Tris-base Sigma-Aldrich T1503 77-86-1 
445 mM boric acid Sigma-Aldrich B7901 10043-35-3
20 mM EDTA Sigma-Aldrich EDS 60-00-4  
Gel Staining Solution
Ethidium bromide 0.5 μg/ml Sigma-Aldrich E1510 Hazardous //// 1239-45-8
1x RB Stain for 15 min with EtBr, destain for 15 min w/o EtBr
BLOTTING
3MM Whatman paper Sigma-Aldrich Z270849
Neutral Nylon Membrane, Hybond NX GE Healthcare Life Science RPN203T Photosensitive
CROSSLINKING
Crosslinking Solution (XLS)
1% 1-methylimidazole (v/v) Sigma-Aldrich 336092 Always prepare a fresh aliquot of XLS //// 616-47-7
12.5 mM HCl Sigma-Aldrich H1758 Hazardous //// 7647-01-0
3.1% EDC (w/v) Sigma-Aldrich 3450 25952-53-8  
(PRE)-HYBRIDIZATION
Liquid Scintillation Counter  Beckmann LS 6500
Sheared Salmon Sperm, 0.1 mg/ml  Life Technologies AM9680
rasi4 anti-sense probe 5' CGGUGUUCGACAGUUCCUCGGG -3'
5s-rRNA anti-sense probe 5'-CAACACGCGGTGTTCCCAAGCCG-3'
Dmel-miR279 anti-sense probe 5'-TTAATGAGTGTGGATCTAGTCA-3'
Dmel-miR286 anti-sense probe 5'-AGCACGAGTGTTCGGTCTAGTCA-3'
Purification Kit, Illustra MicroSpin G-25 Columns GE Healthcare Life Science 27-5325-01
(Pre)-Hybridization Solution (HS)
0.5% SDS Sigma-Aldrich 71736 151-21-3 
5x Denhardt's Solution
20X SSPE
3.6 M NaCl Sigma-Aldrich S3014 7647-14-5  
0.2 M sodium phosphate Sigma-Aldrich 342483 7601-54-9  
20 mM EDTA (pH 8.0) Sigma-Aldrich EDS  60-00-4  
50x Denhardt's Solution
1% Ficoll 400 (w/v) Sigma-Aldrich F2637 26873-85-8
1% Polyvinylpyrrolidone Sigma-Aldrich PVP40 9003-39-8
1% BSA Sigma-Aldrich A7906 9048-46-8  
1X TEN Buffer
10 mM Tris-Cl (pH 8.0) Sigma-Aldrich T1503 77-86-1 
100 mM NaCl Sigma-Aldrich S3014 7647-14-5  
1 mM EDTA (pH 8.0) Sigma-Aldrich EDS 60-00-4  
Probe Labelling
0.4 μM oligonucleotide
1.5 μl Ci/μl [γ-32P] ATP Perkin Elmer NEG002A Hazardous //// 51963-61-2
1x T4 Polynucleotide Kinase Buffer Biolabs B0201
T4 Polynucleotide Kinase 0.5 units/μl Biolabs M0201 EC 2.7.1.78
WASHING
Geiger Mueller Detectors Canberra Industries MCB2/CPS – EM77021
Washing Buffer (WB), 2x SSPE
Stringent Washing Buffers
0.2x SSPE
2x SSPE, 0.5% SDS
0.2x SSPE, 0.5% SDS
SIGNAL DETECTION
PharosFX Plus System Biorad 170-9460
Image J Freely available
Quantity One Biorad
X-ray films , BioMax XAR Sigma-Aldrich F5888 Photosensitive
Developer for X-ray films Sigma-Aldrich P7042
Fixer for X-ray films Sigma-Aldrich P7167
STRIPPING
Stripping Solution
10 mM Tris-HCl pH 8.8 Sigma-Aldrich T1503 77-86-1 
5 mM EDTA Sigma-Aldrich EDS 60-00-4  
0.1% SDS Sigma-Aldrich 71736 Add SDS after boiling to avoid foaming //// 151-21-3

DOWNLOAD MATERIALS LIST

References

  1. The RNA World. Gesteland, R. F., Cech, T. R., Atkins, J. F. 3rd, Cold Spring Harbor Laboratory Press. (2006).
  2. Mercer, T. R., Dinger, M. E., Mattick, J. S. Long non-coding RNAs: insights into functions. Nat Rev Genet. 10, 155-159 (2009).
  3. Salmena, L., Poliseno, L., Tay, Y., Kats, L., Pandolfi, P. P. A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell. 146, 353-358 (2011).
  4. Cesana, M., et al. A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA. Cell. 147, 358-369 (2011).
  5. Orphanides, G., Reinberg, D. A unified theory of gene expression. Cell. 108, 439-451 (2002).
  6. Mehler, M. F., Mattick, J. S. Noncoding RNAs and RNA editing in brain development, functional diversification, and neurological disease. Physiol Rev. 87, 799-823 (2007).
  7. Fire, A., Xu, S., Montgomery, M., Kostas, S., Driver, S., Mello, C. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391, 806-811 (1998).
  8. Hamilton, A., Baulcombe, D. A species of small antisense RNA in posttranscriptional gene silencing in plants. Science. 286, 950-952 (1999).
  9. Lee, R. C., Feinbaum, R. L., Ambros, V. The C. Elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 75, (1993).
  10. Wightman, B., Ha, I., Ruvkun, G. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell. 75, 855-862 (1993).
  11. Fabian, M. R., Sonenberg, N., Filipowicz, W. Regulation of mRNA translation and stability by microRNAs. Annu Rev Biochem. 79, 351-379 (2010).
  12. Pasquinelli, A. E., et al. Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature. 408, 86-89 (2000).
  13. Lagos-Quintana, M., Rauhut, R., Lendeckel, W., Tuschl, T. Identification of novel genes coding for small expressed RNAs. Science. 294, 853-858 (2001).
  14. Lau, N. C., Lim, L. P., Weinstein, E. G., Bartel, D. P. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science. 294, 858-862 (2001).
  15. Lee, R. C., Ambros, V. An extensive class of small RNAs in Caenorhabditis elegans. Science. 294, 862-864 (2001).
  16. Laneve, P., et al. The Gcm/Glide molecular and cellular pathway: new actors and new lineages. Dev Biol. 375, 65-78 (2013).
  17. Hosoya, T., Takizawa, K., Nitta, K., Hotta, Y. Glial cells missing: a binary switch between neuronal and glial determination in Drosophila. Cell. 82, 1025-1036 (1995).
  18. Jones, B. W., Fetter, R. D., Tear, G., Goodman, C. S. Glial cells missing: a genetic switch that controls glial versus neuronal fate. Cell. 82, 1013-1023 (1995).
  19. Vincent, S., Vonesch, J. L., Giangrande, A. Glide directs glial fate commitment and cell fate switch between neurons and glia. Developement. 122, 131-139 (1996).
  20. Cattenoz, P. B., Giangrande, A. Lineage specification in the fly nervous system and evolutionary implications. Cell Cycle. 12, 2753-2759 (2013).
  21. Jones, B. W., Abeysekera, M., Galinska, J., Jolicoeur, E. M. Transcriptional control of glial and blood cell development in Drosophila: cis-regulatory elements of glial cells missing. Dev Biol. 266, 374-387 (2004).
  22. Ragone, G., et al. Transcriptional regulation of glial cell specification. Dev Biol. 255, 138-150 (2003).
  23. Akiyama-Oda, Y., Hosoya, T., Hotta, Y. Asymmetric cell division of thoracic neuroblast 6-4 to bifurcate glial and neuronal lineage in Drosophila. Development. 126, 1967-1974 (1999).
  24. Bernardoni, R., Kammerer, M., Vonesch, J. L., Giangrande, A. Gliogenesis depends on glide/gcm through asymmetric division of neuroglioblasts. Dev Biol. 216, 265-275 (1999).
  25. Ragone, G., Bernardoni, R., Giangrande, A. A novel mode of asymmetric division identifies the fly neuroglioblast 6-4T. Dev Biol. 235, 74-85 (2001).
  26. Soustelle, L., Roy, N., Ragone, G., Giangrande, A. Control of gcm RNA stability is necessary for proper glial cell fate acquisition. Mol Cell Neurosci. 37, 657-662 (2008).
  27. Akiyama, Y., Hosoya, T., Poole, A. M., Hotta, Y. The gcm-motif: a novel DNA-binding motif conserved in Drosophila and mammals. Proc. Natl. Acad. Sci. USA. 25, 14912-14916 (1996).
  28. Miller, A. A., Bernardoni, R., Giangrande, A. Positive autoregulation of the glial promoting factor glide/gcm. EMBO J. 17, 6316-6326 (1998).
  29. Krichevsky, A. M., King, K. S., Donahue, C. P., Khrapko, K., Kosik, K. S. A microRNA array reveals extensive regulation of microRNAs during brain development. RNA. 9, 1274-1281 (2003).
  30. Liu, C. G., et al. An oligonucleotide microchip for genome-wide microRNA profiling in human and mouse tissues. Proc. Natl. Acad. Sci. USA. 101, 9740-9744 (2004).
  31. Yin, J. Q., Zhao, R. C., Morris, K. V. Profiling microRNA expression with microarrays. Trends Biotechnol. 26, 70-76 (2008).
  32. Schmittgen, T. D., Jiang, J., Liu, Q., Yang, L. A high-throughput method to monitor the expression of microRNA precursors. Nucleic Acids Res. 32, E43 (2004).
  33. Chen, C., et al. Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res. 33, e179 (2005).
  34. Shi, R., Chiang, V. L. Facile means for quantifying microRNA expression by real-time PCR. Biotechniques. 39, 519-525 (2005).
  35. Raymond, C. K., Roberts, B. S., Garrett-Engele, P., Lim, L. P., Johnson, J. M. Simple quantitative primer-extension PCR assay for direct monitoring of microRNAs and short-interfering RNAs. RNA. 11, 1737-1744 (2005).
  36. Wang, Z., Gerstein, M., Snyder, M. RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet. 10, 57-63 (2009).
  37. Linsen, S. E., et al. Limitations and possibilities of small RNA digital gene expression profiling. Nat Methods. 6, 474-476 (2009).
  38. Valoczi, A., et al. Sensitive and specific detection of microRNAs by northern blot analysis using LNA-modified oligonucleotide probes. Nucleic Acids Res. 32, e175 (2004).
  39. Varallyay, E., Burgyan, J., Havelda, Z. Detection of microRNAs by Northern blot analyses using LNA probes. Methods. 43, 140-145 (2007).
  40. Kim, S. W., et al. A sensitive non-radioactive northern blot method to detect small RNAs. Nucleic Acids Res. 38, e98 (2010).
  41. Pall, G. S., Hamilton, A. J. Improved northern blot method for enhanced detection of small RNA. Nat Protoc. 3, 1077-1084 (2008).
  42. Hermanson, G. T. Bioconjugate Techniques. 2nd, Academic Press, Inc. (2008).
  43. Pall, G. S., Codony-Servat, C., Byrne, J., Ritchie, L., Hamilton, A. Carbodiimide-mediated cross-linking of RNA to nylon membranes improves the detection of siRNA, miRNA and piRNA by northern blot. Nucleic Acids Res. 35, e60 (2007).
  44. Guzzardo, P. M., Muerdter, F., Hannon, G. J. The piRNA pathway in flies: highlights and future directions. Curr Opin Genet Dev. 23, 44-52 (2013).
  45. Aravin, A. A., et al. Double-stranded RNA-mediated silencing of genomic tandem repeats and transposable elements in the D. melanogaster germline. Curr. Biol. 11, 1017-1027 (2001).
  46. Vagin, V. V., et al. A distinct small RNA pathway silences selfish genetic elements in the germline. Science. 313, 320-324 (2006).
  47. Brennecke, J., et al. Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila. Cell. 128, 1089-1103 (2007).
  48. Sullivan, W., Ashburner, M., Hawley, R. S. Drosophila protocols. Cold Spring Harbor Laboratory Press. (2008).
  49. Zamore, P. D., Ma, S. Isolation of Drosophila melanogaster testes. J. Vis. Exp. (51), e2641 (2011).
  50. Sambrook, J., Fritsch, E. F., Maniatis, T. Molecular cloning : a laboratory manual. 2nd, Cold Spring Harbor Laboratory Press. (1989).
  51. Alwine, J. C., Kemp, D. J., Stark, G. R. Method for detection of specific RNAs in agarose gels by transfer to diazobenzyloxymethyl-paper and hybridisation with DNA probes. Proc. Natl. Acad. Sci. USA. 74, 5350-5354 (1977).
  52. Hansen, T. B., et al. Natural RNA circles function as efficient microRNA sponges. Nature. 495, 384-388 (2013).
  53. Flores-Jasso, C. F., Salomon, W. E., Zamore, P. D. Rapid and specific purification of Argonaute-small RNA complexes from crude cell lysates. RNA. 19, 271-279 (2013).
  54. Specchia, V., et al. Hsp90 prevents phenotypic variation by suppressing the mutagenic activity of transposons. Nature. 463, 662-665 (2010).
  55. Várallyay, E., Burgyán, J., Havelda, Z. MicroRNA detection by northern blotting using locked nucleic acid probes. Nat Protoc. 3, 190-196 (2008).
  56. Koscianska, E., Starega-Roslan, J., Czubala, K., Krzyzosiak, W. J. High-resolution northern blot for a reliable analysis of microRNAs and their precursors. ScientificWorldJournal. 11, 102-117 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics