Amélioration de la détection du Nord Blot des petits ARN espèces en
1Département de Génomique Fonctionnelle et Cancer, Institut de Génétique et de Biologie Moléculaire et Cellulaire, 2Center for Life NanoScience, Istituto Italiano di Tecnologia

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Le but de cette publication est de visualiser et de discuter des étapes opérationnelles d'un protocole Northern Blot améliorée sur l'ARN extrait de Drosophila melanogaster embryons, des cellules et des tissus. Ce protocole est particulièrement utile pour la détection efficace de petites espèces d'ARN.

Cite this Article

Copy Citation | Download Citations

Laneve, P., Giangrande, A. Enhanced Northern Blot Detection of Small RNA Species in Drosophila Melanogaster. J. Vis. Exp. (90), e51814, doi:10.3791/51814 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Les dernières décennies ont vu l'explosion de l'intérêt scientifique autour des mécanismes de contrôle de l'expression des gènes au niveau de l'ARN. Cette branche de la biologie moléculaire a été fortement alimentée par la découverte de non codantes des ARN comme des acteurs majeurs dans la régulation post-transcriptionnelle. Une telle perspective révolutionnaire a été accompagnée et déclenchée par le développement de technologies puissantes pour le profilage des ARN courte expression, à la fois au niveau haut débit (identification du génome entier) ou analyse d'un seul candidat (accumulation de l'état d'équilibre des espèces spécifiques). Bien que plusieurs stratégies état de l'art sont actuellement disponibles pour le dosage ou la visualisation de ces molécules fuyant, analyse Northern Blot reste l'approche droit dans la biologie moléculaire pour l'évaluation immédiate et précise de l'expression de l'ARN. Il constitue une première étape vers l'application de technologies coûteuses, plus sophistiqués et, dans de nombreux cas, reste une méthode préférentielle pour gagner facilement des idéesARN en biologie. Ici, nous aperçu un protocole efficace (Enhanced Northern Blot) pour détecter les microARN faiblement exprimés (ou d'autres espèces de petits ARN réglementaires) de Drosophila melanogaster embryons entiers, disséqué manuellement tissus / adultes larvaires ou dans des cellules cultivées in vitro. Une quantité très limitée de l'ARN est nécessaire et l'utilisation du matériel de flux cellules cytométrie isolées peuvent être également envisagée.

Introduction

ARN biochimie a connu progrès spectaculaires au cours des dernières années 1. Notre compréhension du potentiel de l'ARN dans le contrôle de l'expression génique a été éclaté par l'identification des puissants ribo-régulateurs non codants 2, par la découverte de nouveaux mécanismes de régulation à base d'ARN 3,4 et par une caractérisation détaillée des événements post-transcriptionnelle déjà connues 5. Tous biologie de l'ARN ensemble, ces études ont permis de faire considérablement la scène, devenant un important sujet de recherche dans le paysage scientifique actuel. En particulier, au cours des dernières années, nous obtenons une idée de l'impact profond du «monde de l'ARN" sur la neurobiologie moléculaire 6, l'un des domaines de recherche les plus dynamiques en sciences de la vie moderne. Dans la dernière décennie du siècle passé, le scénario scientifique globale a été révolutionné par la découverte de l'interférence ARN 7,8 et des petits ARN régulateurs 9,10notamment en ce qui concerne les micro-ARN 11 exprimé de manière endogène de petits ARN non codantes impliquées dans le contrôle de la quasi-totalité des fonctions cellulaires en tant que régulateurs pléiotropes et combinatoires de l'expression génique.

Près de 10 ans après la découverte initiale miARN dans Caenorhabditis elegans par Ambros et les laboratoires de Ruvkun, une attention renouvelée a été tourné dans le champ quand un grand nombre de miARN ont été identifiés chez la drosophile et dans les cellules humaines ainsi 12-15. Depuis lors, grâce à des approches transgéniques polyvalents, Drosophila melanogaster s'est distingué comme un contexte biologique précieux pour se plonger dans la biosynthèse des miARN et de l'activité. Drosophila miARN ont révélé des fonctions distinctes dans les processus d'insectes spécifiques ou évolutives conservées, allant de vieillissement de métabolisme, les voies de signalisation , le comportement et, bien sûr, la neurogenèse. Le long de cette direction, nous avons récemment dévoilé un lien nouveau 16 dans le co intriganterrelation survenant entre le gène maître gcm / descente et la voie de l'ARN. Le facteur de transcription Gcm mouche / Glide 17-19 constitue un exemple unique de destin cellulaire déterminant, qui dicte le choix de gliale vs destinée neuronale dans multipotentes voler précurseurs neuraux 20. Vingt ans de longues recherches sur ce sujet a clairement souligné l'apparition de multiples entrées et se chevauchent de la régulation de l'expression des gènes convergent sur ​​gcm / glisser 21-28 pour établir les seuils requis pour équilibrer le rapport délicat entre homologues neuronales et gliales au cours du développement neuronal.

Nous avons découvert que la régulation par DMEL-miR279 ciblage représente un niveau supplémentaire de contrôle contribuant à la post-transcriptionnelle de réglage fin de gcm / glisser expression 16. Améliorations méthodologiques spécifiques à l'échelle mondiale, ces lignes de recherche ont requis: le long des années, plusieurs technologies initialement développées pour analyser tradARN tradition- ont été convertis pour quantifier les petits ARN non codantes, comme tant RNase de protection, d'ADNc tableaux 29-31, méthodes de PCR en temps réel 32-35 et le séquençage de 36,37. De l'autre côté, le recalibrage des approches techniques a favorisé progrès continus dans le domaine.

Northern Blot dosage (NB, ou une analyse par transfert sur gel d'ARN) constitue un exemple représentatif: il est largement utilisé pour le profil de l'accumulation de l'ARN, car elle assure à la fois le niveau d'expression de quantification, ainsi que la détermination de la taille. Cependant, la faible sensibilité intrinsèque de la méthode est de limiter quand il est appliqué à l'expression des gènes tendeurs faible abondance, comme les ARN courts. Une conséquence néfaste est l'exigence de grandes quantités d'ARN total, ce qui rend difficile son application à des échantillons biologiques spécifiques. Pour ces raisons, les variantes NB spécifiques pour la détection des ARN petit ont été développés 38-40: nous avons profité d'un proc NB amélioréeedure 41 (ENB, Enhanced Northern Blot), tandis que l'élucidation du jeu susmentionné entre DMEL-miR279 et gcm / descente.

Cette méthode repose sur une étape de réticulation chimique sur la base de l'activité d'un dérivé de carbodiimide [1-éthyl-3-(3-diméthylamino-propyl) carbodiimide, EDC] pour fixer l'acide nucléique sur des supports solides. Carbodiimide est un agent de réticulation polyvalent connu pour catalyser la formation de liaisons amide entre les groupes carboxyle activés ou phosphate et des groupes amine 42. Cette propriété peut être exploitée pour coupler de manière covalente par l'intermédiaire de leurs petits ARN groupe 5'-hydroxyle mono-phosphorylé aux groupes amino à la surface des membranes de nylon. La configuration résultant de fixation augmente l'accessibilité de l'acide nucléique immobilisé et, par conséquent, l'efficacité de l'hybridation sonde-cible, ce qui conduit à l'amélioration remarquable de détection 43.

La technique suppose notamment relevance dans des études moléculaires de Drosophila, qui par l'apparition de nouvelles catégories distinctes et de petits ARN non codants de 44 émerge. Parmi ceux-ci, rasiRNAs 45,46 constituent un sous-type spécifique des ARN Piwi-interacting (piRNAs 47), impliqués dans l'inactivation de gène spécifique à la séquence. Détails opérationnels de cette méthode sont décrits en détail et visualisés ci-après, par rapport à l'analyse de la microARN DMEL-miR279 et DMEL-miR286 et, pour la première fois, d'une rasiRNA, rasi4. Nous avons poussé à l'extrême cette méthode, qui nous a permis révélant des objectifs mal exprimés à partir des quantités minimes de l'ARN (moins de 1 ug).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Collection 1 de l'échantillon

  1. Détachez 2 cellules de semi-adhérent, Schneider (1-5 x 10 6 cellules en moyenne), à la pipette et les récolter par centrifugation (100 g pendant 1 min). Dans le cas de cellules adhérentes en culture in vitro, trypsiniser eux dans des conditions standard ou directement à percevoir ces plaques dans une quantité convenable d'ARN réactif d'extraction, par l'aide d'un grattoir à cellules.
  2. Pour la collecte des embryons, développer des souches de drosophile dans des cages à mouches et laisser embryons s'accumulent sur ​​des plaques de ponte. Essuyez embryons hors d'un pinceau dans de l'eau distillée (dH 2 O), jeter des débris par filtrage tamis, rincer et récupérer des embryons dans un flacon 48.
  3. Comme une technique alternative, disséquer manuellement tissus / organes. Isoler les testicules (un système préférentiel pour l'analyse piRNA) de la drosophile abdomen dans un tampon phosphate salin (PBS) sous un stéréomicroscope (grossissement 20X), par l'utilisation d'aiguilles de dissection ou de pinces visualized dans Sullivan et al 49.
  4. Pilon homogénéiser les échantillons sur la dépendance de 0,5 volumes de réactif d'extraction d'ARN.

2 Extraction de l'ARN / Analyse

  1. Les instructions du fabricant suivantes effectuent isolement de l'ARN par les réactifs commerciaux. ATTENTION! Agents d'extraction d'ARN sont généralement toxique et caustique. En variante, appliquer un protocole basé sur la protéinase K pour l'isolement de l'ARN 50, comme suit:
    1. Diluer les échantillons dans 400 ul de mélange d'arrêt et incuber à température ambiante pendant 15 min.
    2. Récupérer les composants hydrosolubles de standard au phénol: chloroforme: alcool isoamylique et l'extraction dans le chloroforme et par l'éthanol (EtOH) précipitation / lavage. Air sécher les échantillons et remettre en suspension dans de diéthyle (DEPC) traités par une double distillation (dd) H 2 O.
  2. Évaluer la concentration d'ARN par mesure spectrophotométrique UV. Assurez-vous également la pureté de l'ARN est élevé, proche de 2,0, based sur A 260 / A 280 lecture.
  3. Vérifiez la préparation de l'ARN sur gel d'agarose dénaturant comme suit:
    1. Dans un bêcher propre, dissoudre 1,2 g d'agarose dans 82 ml de DEPC-DDH 2 O, sous agitation continue. Faire bouillir jusqu'à dissolution complète.
    2. Laisser la solution de gel à refroidir; lorsque la température atteint 60 ° C, ajouter 10 ml d'acide 4-10X morpholinepropanesulfonic (MOPS) tampon à 1X concentration finale (FC), et 8 ml de formaldéhyde à 37% à 3% FC. ATTENTION! formaldéhyde est cancérogène.
    3. Verser le gel dans une cellule d'électrophorèse horizontale. Laisser le gel se solidifier sous une hotte pendant au moins 1 h. Après solidification, immerger le gel dans MOPS 1X.
    4. Aliquote 2 pg d'échantillon d'ARN et 1 pg de contacts (utiliser un marqueur d'ARN lorsque l'évaluation précise est souhaitée). Ajouter 3 volumes de colorant de chargement agarose (ALD) à l'ARN et à l'échelle. Chauffer à 70 ° C pendant 5 min, puis refroidir sur glace. CAUTION! Contenu de ALD (de bromure d'éthidium et formamide, voir Matériaux) sont mutagène et corrosif, respectivement.
    5. Charger les échantillons et exécuter le gel à 50 V pendant environ 1 heure avec recyclage de tampon occasionnelle. Vérifiez le motif ARN de fractionnement par visualisation UV ou l'imagerie de gel. Reconnaître bandes discrètes correspondant à 28S et 18S ARNr et ARNt (voir Figure 1).
  4. Passez à l'Essai du Nord ou de l'ARN de conserver à -80 ° C.

3. dénaturation gel d'acrylamide Préparation

  1. Utilisez un petit appareil vertical électrophorétique pour cette étape de fractionnement (de la taille de la plaque d'environ 8 cm x 9 cm, épaisseur de 0,75 mm peigne).
  2. Assembler verres propres ensemble dans un cadre de coulée.
  3. Préparer 10 ml de 10% d'acrylamide / bis-acrylamide (19: 1) solution de MOPS 1x, 7 M d'urée. Juste avant la coulée, ajouter 100 ul de 10% de persulfate d'ammonium et 10 ul de TEMED et mélanger rapidement la solution. ATTENTION! L'acrylamide est neurotoxique et cancérogène.
  4. Verser le gel entre des plaques de verre et insérer le peigne bien soin d'éviter les bulles. Laisser polymériser le gel à température ambiante pendant au moins 45 min avant utilisation. Autrement, stockez le gel O / N, enveloppé dans du papier filtre imbibé d'eau et scellé dans du papier saran.

Préparation de l'échantillon 4

  1. Aliquote de 0,5 à 20 ug d'ARN total pour chaque échantillon. Si le volume dépasse 3-4 pi, vide sécher l'échantillon.
  2. Pour la détermination de la taille, exécutez une aliquote (20-30 cps) de radiomarqué échelle du bas-gamme en parallèle aux échantillons, comme un marqueur (voir rubrique 4.3 et 4.4 pour la préparation). Traiter en parallèle des échantillons, comme décrit dans l'étape 4.5.
  3. Ladder: mettre en place une réaction directe de phosphate en utilisant 0,1 ug d'une échelle de 10 pb-étape. Incuber à 37 ° C pendant 30 minutes et stopper la réaction par addition d'acide éthylènediaminetétraacétique (EDTA) à 20 mM FC.
  4. Purifier par précipitation avec EtOH / lavage, l'air sec etremettre en suspension dans le trou DDH 2 O (environ 100 pi). ATTENTION! 32 P est une source radioactive.
  5. Pour chaque échantillon ajouter un volume égal de colorant bleu acrylamide (ABD). Dénaturer par chauffage à 80 ° C pendant 5 min et laisser refroidir sur glace jusqu'au chargement. ATTENTION! Formamide (contenu dans ABD) est corrosif.

5. électrophorétique fractionnement

  1. Retirer les plaques de verre à partir de la pièce moulée de support et les assembler correctement dans la cellule d'électrophorèse. Remplissez les deux chambre intérieure et extérieure avec suffisamment de tampon de migration (RB).
  2. Retirez délicatement le peigne et pré-exécuter le gel à 200 V pendant 10 min. Avant le chargement des échantillons, laver les dépôts d'urée des puits en injectant une partie RB moyen d'une seringue.
  3. Utiliser des embouts plats à stratifier attentivement échantillons de l'étape 4.5 au fond de chaque puits. Vérifiez les connexions d'anode et de la cathode à éviter un fonctionnement inversé. Après que les échantillons entrent dans le gel à 100 V pendant 5 min, iUGMENTATION la tension de 200 V.
  4. Pour une longueur de fractionnement d'environ 7 cm, une 45-min est suffisante à long terme. Évitez bleu de bromophénol (un pigment de suivi dans ABD) à déborder le gel.
  5. Visualisez sur le gel de longues ARN fractionnées par le bromure d'éthidium (EtBr) de coloration, comme une étape facultative:
    1. Coupez 2 cm du haut du gel et les rincer rapidement la tranche dans le trou DDH 2 O.
    2. Incuber la tranche de gel à température ambiante pendant 15 min avec shacking douce dans RB, du BET 0,5 pg / ml FC.
    3. Destain le gel pendant 15 minutes à RB, visualiser longues ARNr par irradiation UV ou l'imagerie de gel. Vérifiez pour la charge d'ARN et de la qualité (voir la figure 1, Groupe 7). ATTENTION! Bromure d'éthidium est un agent mutagène.
  6. Pendant ce temps passer buvard la partie inférieure du gel contenant de petites espèces d'ARN.

6. Gel Blot

  1. Coupez 6 morceaux de papier buvard pour s'adapter à la zone de blot et une pièce équivalente de uncharged membrane de nylon. Humidifiez les feuilles de papier, membrane et 2 tampons buvards de RB. Assurez-vous de tremper complètement les plaquettes en les serrant à plusieurs reprises dans RB.
  2. Retirer le gel de l'appareil et ouvrir les verres en moyenne d'une spatule. Utilisez un coupe propre pour enlever les puits. Placez une feuille de papier Whatman humide sur le gel et soulevez-le délicatement.
  3. Placer la membrane de nylon sur la face libre du gel. Marquer un coin pour orienter le filtre selon le chargement des échantillons. Remplissez le "sandwich" (3 morceaux de papier de chaque côté). Rouler une tige en plastique sur la surface de la tache, pour éliminer les bulles d'air.
  4. Placez la tache entre deux sous-main et puis dans la cassette buvard. Monter la cassette dans le module buvard, remplir la chambre avec RB et vérifier l'orientation correcte (membrane de nylon doit rester entre le gel et le terminus positif).
  5. Transfert à 20 V pendant 20 min. Remarque: pour assurer des conditions homogènes, après 10 min ouvrir le module buvard et rOtate le sandwich de 180 ° avant de terminer le transfert.

7. membrane réticulation

  1. Préparer 6 ml de solution de reticulation frais (XLS). Saturer 10 cm x 10 cm (plus grand que membrane de nylon) morceau de papier buvard avec XLS. ATTENTION! HCl (un composant de XLS) est très corrosif.
  2. Démonter la tache et placer la membrane sur le papier filtre 3MM humide. Remarque: l'ARN doit pas être en contact direct avec le papier saturé. Placer le filtre et le papier entre deux plaques de verre et l'envelopper dans saran-wrap.
  3. Chauffer la membrane à 60 ° C pendant 2 heures, suivi par un trou DDH 2 O lavage. Stocker à -20 ° C ou de procéder à l'hybridation.

8. membrane Préhybridation

  1. Si la charge d'ARN a été vérifiée (étape optionnelle 5.5), passez directement à l'hybridation. Ou bien, Coupez 1 cm de la partie supérieure du filtre en nylon, pour éviter sonde transversale hybridizations à longs ARN fractionnées.
  2. Préchauffer 10 ml de solution d'hybridation (SH) à 37 ° C. Dénaturer 1 mg de sperme de saumon à 95 ° C pendant 5 min, refroidir sur glace et ajouter à HS.
  3. Incuber le filtre en HS à 37 ° C pendant au moins 1 h, en rotation dans un four à hybridation. Vérifiez que l'ARN-côté du filtre face HS.

9 Sonde de synthèse

  1. Mettre en place une réaction directe de phosphate à 10 pmol d'oligonucléotide antisens spécifique, comme décrit dans 4.3.
  2. Ajouter 5 volumes de tampon Tris-EDTA-NaCl (TEN) de tampon à la réaction et on purifie le amorce marquée à partir de nucleotides non incorporés par Chromatographie d'exclusion sur gel sur des colonnes de Sephadex G-25 (ou encore par précipitation par EtOH). l'activité de la sonde peut être évaluée par compteur à scintillation liquide.

10 membrane d'hybridation

  1. Remplacez le HS épuisé avec une nouvelle aliquote de 10 ml (préparé et complété comme décrit ci-dessus). Chauffer la sonde à95 ° C pendant 10 mn, laisser refroidir sur glace et ajouter à nouveau HS. Incuber le filtre à 37 ° C sous tension.

11 Membrane à laver

  1. Récupérer la solution d'hybridation et de le stocker à -20 ° C dans une boîte de radioactivité blindage.
  2. Rincez le filtre à tampon de lavage (BM) et le laver à fond pendant 10 min à température ambiante.
  3. Utiliser un détecteur Geiger Mueller pour le contrôle de la radioactivité résiduelle dans les coins de filtre. Lorsque l'émission de fond est d'environ 5 cps, procéder à la membrane exposition.

Détection du signal 12

  1. Exposer le filtre films d'autoradiographie ou sur un écran moléculaire imageur ON. Révéler signaux de traitement photographique ou de la conversion numérique.
  2. Analyser l'intensité de la bande par le logiciel de quantification dédié (ImageJ ou Optiquant).

13 Membrane dénuder

  1. Pour éliminer les signaux primaires, plonger la membrane dans 500 ml d'une solution bouillante à dénuder, Puis incuber à température ambiante pendant 1 min. Passez à nouveau (pré) hybridation ou entreposer le filtre à -20 ° C.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

En suivant la procédure générale décrite dans le texte et représentés schématiquement sur ​​la figure 1, nous avons évalué l'expression de petits ARN à partir d'échantillons d'ARN complexes de différentes origines. Dans l'expérience présentée à la figure 1, l'ARN a été isolé à partir de 2 cellules de Drosophila Schneider par extraction à la protéinase K, vérifiés pour l'intégrité (étape optionnelle: dénaturation agarose fractionnement de gel) et chargé dans le double. La moitié de gel a été transféré sur une membrane neutre et réticulé chimiquement par EDC; la deuxième moitié a été transféré sur un filtre de nylon chargée positivement, alors UV réticulé (1,2 x 10 5 uJ / cm 2). L'expression endogène de deux microARN appartenant à la famille DMEL-miR279 (DMEL-miR279 lui-même et DMEL-miR286 15) a été vérifiée dans les deux conditions. La procédure améliorée (ENB) assure une plus grande sensibilité à l'égard d'une norme (BNS).

les figures 2 et 3. Le raisonnement expérimental est le même que ci-dessus: nous rapportons ici le résultat représentant de Northern Blot détection autoradiographique de la rasi4 piRNA le long d'un titrage de l'ARN total extrait de mouche adulte testicules. ENB autorise déjà la détection d'une bande spécifique quand 0,5 ug d'ARN est chargé. La quantification de côté montre comment le signal augmente proportionnellement avec la quantité d'ARN fractionné, ce qui indique que le rapport dose / réponse se trouve dans la gamme linéaire de détection. Le panneau ci-dessous ratifie l'amélioration de la sensibilité de cette méthode par rapport à la BNS. Dans ce cas, un signal détectable est obtenue lors de fractionnement électrophorétique de 10 ug d'ARN au moins pour la BNS.

Des résultats similaires sont obtenus avec une autre espèce d'ARN non codant, par exemple, d'ARNr 5S, tel que rapporté dans la Figure 3 </ Strong>.

Figure 1
Figure 1 Représentation schématique de la procédure globale Northern Blot. Principales étapes de la procédure sont répertoriées et numérotées progressivement. Les résultats sont comparés entre le Blot améliorée du Nord (ENB) et Standard Northern Blot (BNS), réalisée en mêmes conditions: l'isolement de l'ARN à partir de 2 cellules (Groupe 1), de l'électrophorèse (Groupe 2), transfert (Panel 3) et l'hybridation de Drosophila Schneider ( Panel 5). ENB fait référence à l'amélioration de la procédure décrite dans ce rapport, qui nécessite un filtre neutre (Groupe 3, la moitié gauche de la membrane) et la réticulation à base d'EDC (Groupe 4), qui établit une liaison entre l'ARN cible extrémité 5 'et membrane covalente ( points roses dans le Panneau de 4). Dans BNS, ARN réticulation est obtenu par traitement UV (Groupe 4) sur une charge positive nylon membrane (Panel 3, la moitié droite de la membrane). Signal spécifique 5s ARN n'est pas un étalon dans des conditions comparatives, car il répond aussi à des différences entre la BNS et la procédure ENB. Ainsi, un montant (correspondant à 10 cps) d'un 5'-marqué (voir les points 4.3 et 4.4 du protocole), 50 oligonucléotide longtemps brouillé nt a été ajouté à chaque échantillon avant électrophorèse, de fonctionner comme un "pic de" référence ( Panel 7). Chargement en cours peut également être évaluée par le gel du BET coloration de longues ARNr (voir point 5.5 du protocole). L = échelle. FV = vue frontale, LV = Vue Latérale, HV = vue horizontal. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 2
Figure 2 Comparanalyse ative Northern Blot de l'expression rasi4. niveaux endogènes de la piRNA rasi4 spécifique du testicule sont révélés par un renforcement (ENB) ou standard (BNS) Northern Blot, réalisée sur les montants de l'ARN total (indiqué ci-dessus chaque voie) extrait de adultes testicules drosophile augmentation , ou de l'abdomen entiers (Abd). Pour chaque méthode, histogrammes côté déclarer les montants relatifs de respect rasi4 à la même quantité d'un "pic de" contrôle de chargement. Quantifications des deux méthodes sont combinées dans le graphique ci-dessous concluante placé les gels. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Figure 3
Figure analyse comparative 3 Northern Blot de 5s rExpression de l'ARN. Comme un contrôle positif et l'étalonnage expérimental, l'analyse précédente a été étendue à l'ARNr 5S. Détails comme dans la figure 2. S'il vous plaît cliquer ici pour voir une version plus grande de cette figure.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Bien que notre appréciation de l'entrelacement sophistiqué par lequel l'ARN régule la neurogenèse est en constante augmentation, les implications mécanistiques de circuiteries à base d'ARN qui affectent neurones biologie des cellules souches, la différenciation neuronale / intégration fonctionnelle, le développement de pathologies et cancers de neurones restent inexplorées. Le maintien de ces réseaux par les royaumes rend le potentiel des systèmes génétiques Drosophila melanogaster contribué à élucider les voies cellulaires inexplorées, dans lequel les ARN non codantes à court et facteurs de transcription sont considérées comme les principaux acteurs moléculaires. Dans cette perspective, le profilage de faibles niveaux d'expression d'ARN candidats est propédeutique à des analyses fonctionnelles précises: par exemple, vient de notre récente démonstration que DMEL-miR279 module GCM / glide sort déterminant in vivo, accompli par une version améliorée de dosage du Nord Blot comme un outil d'analyse de l'expression.

51, NB a été considérée comme une méthode de référence pour l'analyse de l'ARN. En dépit de certaines limitations intrinsèques de ce test, comme la conversion difficile à multiplexent formats ou les erreurs possibles avec signal de quantification, les récentes avancées en biologie moléculaire de l'ARN ont redécouvert cette technique classique comme un système "rapide et propre" pour le dosage de l'expression endogène de petite ribonucléique acides ou de validation de l'efficacité des approches intensité forte ou perte de fonction. Comme exemple paradigmatique, l'analyse du Nord pose à la base de la découverte originale de microARN, alors que l'approche reste à la pointe de sa pertinence dans la caractérisation de toujours nouvelles propriétés des ARN régulateurs 52.

La variante décrite ici est basée sur une sensibilité accrue à cause de la reticulation chimique de l'ARN. Nous believethe méthode est encore mal employées dans la drosophile, but quand exploité conduit à d'importantes découvertes 52, car elle rend possible l'expression de l'ARN de profilage à partir de petits échantillons (moins de 1 ug), avec une moyenne de 10-30 fois l'amélioration de la détection des ARN cible 41,43, que nous avons obtenu dans nos conditions (figures 2 et 3).

intégrité de l'ARN constitue un enjeu crucial pour obtenir des résultats cohérents et reproductibles. manipulations d'ARN nécessitent une précision et une rapidité de limiter la dégradation possible de l'échantillon se produisant entre l'extraction et le chargement. A cette fin, toutes les solutions doivent être diethylpyrocarbonate- (DEPC) traitée avant utilisation (2 heures d'incubation en présence de 0,1% de DEPC à 37 ° C et ensuite autoclavée) pour contourner l'activité de RNase. Solution de traitement assure de meilleurs résultats à l'égard de l'eau DEPC utilisant comme solvant. Tout le matériel sera également rincé dans DEPC ddH20, après le nettoyage par une surface spécifique décontaminant-RNase.

(par exemple, rasi4, Figure 2) ou lorsque la purification de l'ARN n'est pas effectuée sur des échantillons frais (par exemple, conservé dans le stockage de tissus réactifs). De l'expérience, l'isolement de l'ARN à partir d'échantillons stabilisés entraîné beaucoup plus sévère et nécessaire des conditions d'extraction plus drastiques. Dans des conditions normales, la méthode de la protéinase K décrit garantit des préparations de bonne qualité aussi bien, (un exemple significatif est représenté en figure 1), mais ce n'est pas le choix optimal pour les échantillons conservés dans les réactifs de stockage.

Enfin, étant donné que cette procédure vise à petit détection spécifique de l'ARN, en fonction des kits de purification dédié colonnes peuvent être utilisées pour les petites isolement direct d'ARN, même si ec'est fait difficile à vérifier l'intégrité de l'ARN. En alternative à la procédure en gel classique pour le contrôle de l'intégrité de l'ARN décrite ci-dessus, la qualité de l'ARN peut être évaluée par des instruments pour l'analyse sur puce miniaturisée de motifs d'acides nucléiques.

Choix tampon: tampon MOPS-NaOH (pH 7) a été proposé comme un tampon préférentiel pour les deux électrophorèse sur gel du Nord améliorée et blot. Nous avons aussi utilisé de façon satisfaisante Tris-borate-EDTA (TBE) dans nos expériences. Dans ce cas, étant donné que la présence de groupes amine nucléophile de Tris (hydroxyméthyl) aminométhane serait hydrolyser et inactiver DEPC lui-même au cours du traitement, il est recommandé de dissoudre Tris dans de l'eau traitée au DEPC au lieu de tampon TBE traitement déjà préparé.

Électrophorétique Run et Blot: Pré-exécuter le gel est essentiel pour éliminer l'excès de persulfate et d'éliminer hyperfocusing. Paramètres pré-exécution doivent être maintenues aussi pendant le fractionnement, évitant electropho trop viteterme retic. Avant le chargement, assurez-vous d'enlever les sédiments de l'urée à partir de puits, en injectant tampon à l'intérieur. Cela permettra de limiter échantillon de débordement et des garanties précises stratification de l'ARN, la production de bandes autoradiographiques résolus lors de la détection des signaux. Toute membrane de nylon neutre peut être utilisé comme un support pour le transfert d'acides nucléiques. Ne pas effacer l'ARN pour plus de 20-30 minutes dans les conditions spécifiées.

Réticulation: réticulation chimique à base d'EDC représente l'avance méthodologique critique de cette version améliorée de transfert de Northern. La possibilité de réticuler espèces d'ARN court à des surfaces neutres par bonds covalentes entre l'ARN 5'mono-groupe phosphate et nylon amines primaires laisse la majorité des bases disponibles pour l'hybridation. Cela améliore la sensibilité par 10-20xrespect de réticulation traditionnelle. Il est essentiel de préparer montant frais de solution de réticulation pour chaque blot, en quantité suffisante pour la saturation de la membrane appropriée.

Hybridation et de lavage: Les sondes doivent de préférence être fraîchement étiquetés. Sonde activité spécifique (en fonction de l'activité spécifique et la quantité de nucléotide radiomarqué incorporé et aussi de la quantité de sonde disponible pour l'hybridation) détermine la sensibilité de détection de la cible. Lorsque [γ- 32 P] ATP à une activité spécifique de 3000 Ci / mmol est utilisé, 10 6 cpm / pmol de marquage de 100% de l'extrémité 5 'est prévu.

La solution d'hybridation peut être récupéré et re-utilisé, étant donné que, en raison de 32 P décroissance, l'activité de la sonde moitiés dans environ 14 jours.

En raison de la neutralité de la membrane, un faible bruit de fond est prévue lors de l'hybridation. Si les conditions de lavage plus strictes sont nécessaires, réduire progressivement la force ionique du tampon de lavage (jusqu'à 0,2 x SSPE) ou ajouter des quantités croissantes de détergents ioniques (jusqu'à 0,5% de SDS) ou augmenter la température de lavage à 37 ° C.

L'analyse par Northern blot est indispensable lorsque la mesure de la taille de l'ARN est nécessaire. Même si ce test peut manquer de l'exactitude de qPCR basé sur la fluorescence des approches pour l'estimation de petits ARN, un avantage découle de l'utilisation de fractionnement dénaturation / transfert et hybridation de la sonde dépendant que des mesures uniques avant la détection des ARN cibles. Par conséquent, la révélation de signaux spécifiques de l'échantillon est direct et ne nécessite pas d'étape supplémentaire de traitement enzymatique / conversion / amplification, ce qui impliquerait l'utilisation de kits commerciaux dédiés. Les taux d'ARN peuvent être quantifiées et comparées entre plusieurs échantillons sur les membranes individuelles. Ainsi Northeblot rn est couramment employé comme une validation rigoureuse des données qPCR. Stimulé par les exigences expérimentales spécifiques, la méthode a été encore améliorée au cours des dernières années, tant au niveau de la sensibilité et de la résolution de sorte que quantité limitée d'ARN (voir les figures 2 et 3) sont requis pour l'analyse réussie.

Le protocole que nous avons présenté peut être adapté à une large gamme d'applications en particulier où le matériel est disponible en quantités limitées. La source biologique d'échantillons d'ARN peut être hétérogène: en ce qui concerne la drosophile, des embryons ou des autres stades de développement sont adaptés, mais aussi des tissus ou des organes disséqués manuellement, cellules individuelles cytotypes tri-isolé ou de cultures cellulaires.

En outre, même si les microARN sont la classe la plus abondante de courts ARN régulateurs dans la cellule et sous réserve d'investigation majeur dans le domaine de gène contrôle de l'expression de l'ARN-médiation, ils n'ont pas les inconvénientstitut la seule famille d'ARN non codantes cellulaires. Beaucoup de grappes de minuscules ARN fonctionnent à travers les royaumes (par exemple, siRNA endogènes, piRNAs, snoRNAs, plante tasiRNAs) et la plupart d'entre eux sont caractérisés à partir d'une connexion extrémité 5 '(non modifié), généralement provenant de la transformation de l'endo-ribonucléolytique de précurseurs des molécules. Cette caractéristique constitue la condition unique de structure strictement nécessaire à l'application de la méthodologie améliorée spécifique sur la base de réticulation chimique, même si la taille de l'ARN doivent être pris en considération, lors de longs ARN sont analysés. Dans la figure 2, nous présentons une analyse Northern Blot détecter comparative des niveaux de rasi4 54 un membre d'une classe de petits ARN spécifique de lignée germinale (ARN ou piRNAs Piou-interaction.) Dans des conditions de niveaux d'expression pauvres et spécifiques, la sensibilité accrue de cette méthode peut sanctionner des résultats positifs, surtout en considérant que le protocole signalé peut être encore améliorée en peigneINING avec d'autres implémentations concrètes déjà décrites dans la littérature 55,56.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

Ce travail a été financé par l'Institut National de la Santé et de la Recherche Médicale, le Centre National de la Recherche Scientifique, de l'Université de Strasbourg, l'Hôpital de Strasbourg, l'Association pour la Recherche sur le Cancer, l'Institut National du Cancer, l'Agence Nationale de la Recherche et la Région Alsace.

Pietro Laneve a été soutenu par la Fondation pour la Recherche Médicale. Actuellement, il est le bénéficiaire d'une Istituto Italiano Tecnologia (IIT) de fraternité. Les frais de publication sont pris en charge par le réseau Neurex (TriNeuron - Programme Interreg IV Rhin Supérieur)

Materials

Name Company Catalog Number Comments
FINAL COMPOSITION/NAME COMPANY CATALOGUE (Stock) COMMENTS
GENERAL REQUIREMENT
Centrifuge, 5418 Eppendorf 5418 000.017
Decontaminant, RNase Away Sigma-Aldrich 83931 Apply on glass/plasticware, wipe and rinse
RNase inhibitor, DEPC Sigma-Aldrich D5758 Hazardous //// 1609-47-8
SAMPLE PREPARATION
Stereo Microscope, M60 Leica 
1X PBS Buffer
137 mM NaCl Sigma-Aldrich S3014 7647-14-5  
2.7 mM KCl Sigma-Aldrich P9541 7447-40-7 
10 mM Na2HPO4 Sigma-Aldrich S3264 7558-79-4 
1.8 mM KH2PO4 Sigma-Aldrich P9791 7778-77-0 
RNA EXTRACTION/ANALYSIS
UV-Vis Spectrophotometer Thermo Scientific Nanodrop 2000
Gel Imager, ChemiDoc XRS+ Biorad 170-8265
Horizontal Electrophoresys, Mini-Sub Cell GT BioRad 170-4487EDU
RNA extraction reagent, TRIzol Reagent Life Technologies 15596026 Hazardous
PCA (25:24:1), 1:1 for extraction Sigma-Aldrich 77617 136112-00-0
Chlorophorm, 1:1 for extraction Sigma-Aldrich C2432 67-66-3  
EtOH, 2.5 vol. for precipitation, 70% for washing Sigma-Aldrich 59844 64-17-5 
Gene Ruler 1Kb DNA Ladder Thermo Scientific SM0311
Stop Mix
300 mM NaOAc, pH 5.5 Sigma-Aldrich S2889 127-09-3
1x RSB Solution
2% sodium dodecyl sulfate (SDS) Sigma-Aldrich 71736 Never cool down SDS to avoid  precipitation //// 151-21-3
2 mg/ml Proteinase K Roche Applied Science 0-3115828001 EC 3.4.21.64 9
10X Reticulocyte Standard Buffer (RSB)
100 mM Tris-Cl, pH 7.4 Sigma-Aldrich T5941 1185-53-1  
100 mM NaCl Sigma-Aldrich S3014 7647-14-5  
30 mM MgCl2 Sigma-Aldrich M8266 7786-30-3
Denaturing Agarose Gel
1.2% Agarose Sigma-Aldrich A9539 Let the gel solidify for at least 1 hr //// 9012-36-2
10X MOPS Buffer
0.2 M MOPS sodium salt, pH 7 Sigma-Aldrich M9381 Do not confuse MOPS sodium salt with MOPS //// 71119-22-7
Agarose Loading Dye
1x MOPS Buffer
3% formaldehyde Sigma-Aldrich F8775 Hazardous //// 50-00-0
50% formamide Sigma-Aldrich 47670 Hazardous //// 75-12-7
Ethidium bromide (EtBr) 30 μg/ml Sigma-Aldrich E1510 Hazardous //// 1239-45-8
Bromophenol blue  Sigma-Aldrich B0126 115-39-9 
SMALL RNA FRACTIONATION
Flat gel loading tips Life Technologies LC1002
Savant SpeedVac Concentrator Thermo Scientific  DNA120
Vertical Electrophoresis, Mini-PROTEAN Tetra Cell  Biorad 165-8000
Denaturing Acrylamide Gel
10% acrylamide/bis-acrylamide (19:1) Sigma-Aldrich A3449 Hazardous. Let the gel polymerize for 45 min before use
1x TBE Buffer (or 1x MOPS Buffer)
7 M urea Sigma-Aldrich U6504 57-13-6
0.1% ammonium persulfate Sigma-Aldrich 215589 7727-54-0 
0.1% TEMED Sigma-Aldrich T9281 110-18-9
Gene Ruler Ultra Low Range DNA Ladder (10 bp-step) Thermo Scientific SM1211 Label 0.1 μg, as described in the "probe labeling" reaction
Acrylamide Blue Dye 
50% formamide Sigma-Aldrich 47670 Hazardous //// 75-12-7
Bromophenol blue Sigma-Aldrich B0126 115-39-9 
Running Buffer (RB)
1x MOPS Buffer 
Alternative RB: 1x TBE Buffer
1x TBE Buffer
5X TBE
445 mM Tris-base Sigma-Aldrich T1503 77-86-1 
445 mM boric acid Sigma-Aldrich B7901 10043-35-3
20 mM EDTA Sigma-Aldrich EDS 60-00-4  
Gel Staining Solution
Ethidium bromide 0.5 μg/ml Sigma-Aldrich E1510 Hazardous //// 1239-45-8
1x RB Stain for 15 min with EtBr, destain for 15 min w/o EtBr
BLOTTING
3MM Whatman paper Sigma-Aldrich Z270849
Neutral Nylon Membrane, Hybond NX GE Healthcare Life Science RPN203T Photosensitive
CROSSLINKING
Crosslinking Solution (XLS)
1% 1-methylimidazole (v/v) Sigma-Aldrich 336092 Always prepare a fresh aliquot of XLS //// 616-47-7
12.5 mM HCl Sigma-Aldrich H1758 Hazardous //// 7647-01-0
3.1% EDC (w/v) Sigma-Aldrich 3450 25952-53-8  
(PRE)-HYBRIDIZATION
Liquid Scintillation Counter  Beckmann LS 6500
Sheared Salmon Sperm, 0.1 mg/ml  Life Technologies AM9680
rasi4 anti-sense probe 5' CGGUGUUCGACAGUUCCUCGGG -3'
5s-rRNA anti-sense probe 5'-CAACACGCGGTGTTCCCAAGCCG-3'
Dmel-miR279 anti-sense probe 5'-TTAATGAGTGTGGATCTAGTCA-3'
Dmel-miR286 anti-sense probe 5'-AGCACGAGTGTTCGGTCTAGTCA-3'
Purification Kit, Illustra MicroSpin G-25 Columns GE Healthcare Life Science 27-5325-01
(Pre)-Hybridization Solution (HS)
0.5% SDS Sigma-Aldrich 71736 151-21-3 
5x Denhardt's Solution
20X SSPE
3.6 M NaCl Sigma-Aldrich S3014 7647-14-5  
0.2 M sodium phosphate Sigma-Aldrich 342483 7601-54-9  
20 mM EDTA (pH 8.0) Sigma-Aldrich EDS  60-00-4  
50x Denhardt's Solution
1% Ficoll 400 (w/v) Sigma-Aldrich F2637 26873-85-8
1% Polyvinylpyrrolidone Sigma-Aldrich PVP40 9003-39-8
1% BSA Sigma-Aldrich A7906 9048-46-8  
1X TEN Buffer
10 mM Tris-Cl (pH 8.0) Sigma-Aldrich T1503 77-86-1 
100 mM NaCl Sigma-Aldrich S3014 7647-14-5  
1 mM EDTA (pH 8.0) Sigma-Aldrich EDS 60-00-4  
Probe Labelling
0.4 μM oligonucleotide
1.5 μl Ci/μl [γ-32P] ATP Perkin Elmer NEG002A Hazardous //// 51963-61-2
1x T4 Polynucleotide Kinase Buffer Biolabs B0201
T4 Polynucleotide Kinase 0.5 units/μl Biolabs M0201 EC 2.7.1.78
WASHING
Geiger Mueller Detectors Canberra Industries MCB2/CPS – EM77021
Washing Buffer (WB), 2x SSPE
Stringent Washing Buffers
0.2x SSPE
2x SSPE, 0.5% SDS
0.2x SSPE, 0.5% SDS
SIGNAL DETECTION
PharosFX Plus System Biorad 170-9460
Image J Freely available
Quantity One Biorad
X-ray films , BioMax XAR Sigma-Aldrich F5888 Photosensitive
Developer for X-ray films Sigma-Aldrich P7042
Fixer for X-ray films Sigma-Aldrich P7167
STRIPPING
Stripping Solution
10 mM Tris-HCl pH 8.8 Sigma-Aldrich T1503 77-86-1 
5 mM EDTA Sigma-Aldrich EDS 60-00-4  
0.1% SDS Sigma-Aldrich 71736 Add SDS after boiling to avoid foaming //// 151-21-3

DOWNLOAD MATERIALS LIST

References

  1. The RNA World. Gesteland, R. F., Cech, T. R., Atkins, J. F. 3rd, Cold Spring Harbor Laboratory Press. (2006).
  2. Mercer, T. R., Dinger, M. E., Mattick, J. S. Long non-coding RNAs: insights into functions. Nat Rev Genet. 10, 155-159 (2009).
  3. Salmena, L., Poliseno, L., Tay, Y., Kats, L., Pandolfi, P. P. A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell. 146, 353-358 (2011).
  4. Cesana, M., et al. A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA. Cell. 147, 358-369 (2011).
  5. Orphanides, G., Reinberg, D. A unified theory of gene expression. Cell. 108, 439-451 (2002).
  6. Mehler, M. F., Mattick, J. S. Noncoding RNAs and RNA editing in brain development, functional diversification, and neurological disease. Physiol Rev. 87, 799-823 (2007).
  7. Fire, A., Xu, S., Montgomery, M., Kostas, S., Driver, S., Mello, C. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391, 806-811 (1998).
  8. Hamilton, A., Baulcombe, D. A species of small antisense RNA in posttranscriptional gene silencing in plants. Science. 286, 950-952 (1999).
  9. Lee, R. C., Feinbaum, R. L., Ambros, V. The C. Elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 75, (1993).
  10. Wightman, B., Ha, I., Ruvkun, G. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell. 75, 855-862 (1993).
  11. Fabian, M. R., Sonenberg, N., Filipowicz, W. Regulation of mRNA translation and stability by microRNAs. Annu Rev Biochem. 79, 351-379 (2010).
  12. Pasquinelli, A. E., et al. Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature. 408, 86-89 (2000).
  13. Lagos-Quintana, M., Rauhut, R., Lendeckel, W., Tuschl, T. Identification of novel genes coding for small expressed RNAs. Science. 294, 853-858 (2001).
  14. Lau, N. C., Lim, L. P., Weinstein, E. G., Bartel, D. P. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science. 294, 858-862 (2001).
  15. Lee, R. C., Ambros, V. An extensive class of small RNAs in Caenorhabditis elegans. Science. 294, 862-864 (2001).
  16. Laneve, P., et al. The Gcm/Glide molecular and cellular pathway: new actors and new lineages. Dev Biol. 375, 65-78 (2013).
  17. Hosoya, T., Takizawa, K., Nitta, K., Hotta, Y. Glial cells missing: a binary switch between neuronal and glial determination in Drosophila. Cell. 82, 1025-1036 (1995).
  18. Jones, B. W., Fetter, R. D., Tear, G., Goodman, C. S. Glial cells missing: a genetic switch that controls glial versus neuronal fate. Cell. 82, 1013-1023 (1995).
  19. Vincent, S., Vonesch, J. L., Giangrande, A. Glide directs glial fate commitment and cell fate switch between neurons and glia. Developement. 122, 131-139 (1996).
  20. Cattenoz, P. B., Giangrande, A. Lineage specification in the fly nervous system and evolutionary implications. Cell Cycle. 12, 2753-2759 (2013).
  21. Jones, B. W., Abeysekera, M., Galinska, J., Jolicoeur, E. M. Transcriptional control of glial and blood cell development in Drosophila: cis-regulatory elements of glial cells missing. Dev Biol. 266, 374-387 (2004).
  22. Ragone, G., et al. Transcriptional regulation of glial cell specification. Dev Biol. 255, 138-150 (2003).
  23. Akiyama-Oda, Y., Hosoya, T., Hotta, Y. Asymmetric cell division of thoracic neuroblast 6-4 to bifurcate glial and neuronal lineage in Drosophila. Development. 126, 1967-1974 (1999).
  24. Bernardoni, R., Kammerer, M., Vonesch, J. L., Giangrande, A. Gliogenesis depends on glide/gcm through asymmetric division of neuroglioblasts. Dev Biol. 216, 265-275 (1999).
  25. Ragone, G., Bernardoni, R., Giangrande, A. A novel mode of asymmetric division identifies the fly neuroglioblast 6-4T. Dev Biol. 235, 74-85 (2001).
  26. Soustelle, L., Roy, N., Ragone, G., Giangrande, A. Control of gcm RNA stability is necessary for proper glial cell fate acquisition. Mol Cell Neurosci. 37, 657-662 (2008).
  27. Akiyama, Y., Hosoya, T., Poole, A. M., Hotta, Y. The gcm-motif: a novel DNA-binding motif conserved in Drosophila and mammals. Proc. Natl. Acad. Sci. USA. 25, 14912-14916 (1996).
  28. Miller, A. A., Bernardoni, R., Giangrande, A. Positive autoregulation of the glial promoting factor glide/gcm. EMBO J. 17, 6316-6326 (1998).
  29. Krichevsky, A. M., King, K. S., Donahue, C. P., Khrapko, K., Kosik, K. S. A microRNA array reveals extensive regulation of microRNAs during brain development. RNA. 9, 1274-1281 (2003).
  30. Liu, C. G., et al. An oligonucleotide microchip for genome-wide microRNA profiling in human and mouse tissues. Proc. Natl. Acad. Sci. USA. 101, 9740-9744 (2004).
  31. Yin, J. Q., Zhao, R. C., Morris, K. V. Profiling microRNA expression with microarrays. Trends Biotechnol. 26, 70-76 (2008).
  32. Schmittgen, T. D., Jiang, J., Liu, Q., Yang, L. A high-throughput method to monitor the expression of microRNA precursors. Nucleic Acids Res. 32, E43 (2004).
  33. Chen, C., et al. Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res. 33, e179 (2005).
  34. Shi, R., Chiang, V. L. Facile means for quantifying microRNA expression by real-time PCR. Biotechniques. 39, 519-525 (2005).
  35. Raymond, C. K., Roberts, B. S., Garrett-Engele, P., Lim, L. P., Johnson, J. M. Simple quantitative primer-extension PCR assay for direct monitoring of microRNAs and short-interfering RNAs. RNA. 11, 1737-1744 (2005).
  36. Wang, Z., Gerstein, M., Snyder, M. RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet. 10, 57-63 (2009).
  37. Linsen, S. E., et al. Limitations and possibilities of small RNA digital gene expression profiling. Nat Methods. 6, 474-476 (2009).
  38. Valoczi, A., et al. Sensitive and specific detection of microRNAs by northern blot analysis using LNA-modified oligonucleotide probes. Nucleic Acids Res. 32, e175 (2004).
  39. Varallyay, E., Burgyan, J., Havelda, Z. Detection of microRNAs by Northern blot analyses using LNA probes. Methods. 43, 140-145 (2007).
  40. Kim, S. W., et al. A sensitive non-radioactive northern blot method to detect small RNAs. Nucleic Acids Res. 38, e98 (2010).
  41. Pall, G. S., Hamilton, A. J. Improved northern blot method for enhanced detection of small RNA. Nat Protoc. 3, 1077-1084 (2008).
  42. Hermanson, G. T. Bioconjugate Techniques. 2nd, Academic Press, Inc. (2008).
  43. Pall, G. S., Codony-Servat, C., Byrne, J., Ritchie, L., Hamilton, A. Carbodiimide-mediated cross-linking of RNA to nylon membranes improves the detection of siRNA, miRNA and piRNA by northern blot. Nucleic Acids Res. 35, e60 (2007).
  44. Guzzardo, P. M., Muerdter, F., Hannon, G. J. The piRNA pathway in flies: highlights and future directions. Curr Opin Genet Dev. 23, 44-52 (2013).
  45. Aravin, A. A., et al. Double-stranded RNA-mediated silencing of genomic tandem repeats and transposable elements in the D. melanogaster germline. Curr. Biol. 11, 1017-1027 (2001).
  46. Vagin, V. V., et al. A distinct small RNA pathway silences selfish genetic elements in the germline. Science. 313, 320-324 (2006).
  47. Brennecke, J., et al. Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila. Cell. 128, 1089-1103 (2007).
  48. Sullivan, W., Ashburner, M., Hawley, R. S. Drosophila protocols. Cold Spring Harbor Laboratory Press. (2008).
  49. Zamore, P. D., Ma, S. Isolation of Drosophila melanogaster testes. J. Vis. Exp. (51), e2641 (2011).
  50. Sambrook, J., Fritsch, E. F., Maniatis, T. Molecular cloning : a laboratory manual. 2nd, Cold Spring Harbor Laboratory Press. (1989).
  51. Alwine, J. C., Kemp, D. J., Stark, G. R. Method for detection of specific RNAs in agarose gels by transfer to diazobenzyloxymethyl-paper and hybridisation with DNA probes. Proc. Natl. Acad. Sci. USA. 74, 5350-5354 (1977).
  52. Hansen, T. B., et al. Natural RNA circles function as efficient microRNA sponges. Nature. 495, 384-388 (2013).
  53. Flores-Jasso, C. F., Salomon, W. E., Zamore, P. D. Rapid and specific purification of Argonaute-small RNA complexes from crude cell lysates. RNA. 19, 271-279 (2013).
  54. Specchia, V., et al. Hsp90 prevents phenotypic variation by suppressing the mutagenic activity of transposons. Nature. 463, 662-665 (2010).
  55. Várallyay, E., Burgyán, J., Havelda, Z. MicroRNA detection by northern blotting using locked nucleic acid probes. Nat Protoc. 3, 190-196 (2008).
  56. Koscianska, E., Starega-Roslan, J., Czubala, K., Krzyzosiak, W. J. High-resolution northern blot for a reliable analysis of microRNAs and their precursors. ScientificWorldJournal. 11, 102-117 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics