Enhanced צפון כתם איתור של RNA קטן מינים ב

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

מטרתו של פרסום זה היא לדמיין ולדון בצעדים האופרטיביים של פרוטוקול צפון כתם משופר על RNA שחולץ מתסיסנית עוברים, תאים ורקמות. פרוטוקול זה שימושי במיוחד לאיתור יעיל של מיני RNA קטנים.

Cite this Article

Copy Citation | Download Citations

Laneve, P., Giangrande, A. Enhanced Northern Blot Detection of Small RNA Species in Drosophila Melanogaster. J. Vis. Exp. (90), e51814, doi:10.3791/51814 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

העשורים האחרונים היינו עדים לפיצוץ של כ מנגנוני בקרת ביטוי גני עניין מדעי ברמת RNA. ענף זה של ביולוגיה מולקולרית כבר מתודלק באופן משמעותי כתוצאה מגילוי noncoding RNAs כשחקנים מרכזיים בויסות לאחר תעתיק. כגון פרספקטיבה מהפכנית כבר מלווה ומופעלת על ידי הפיתוח של טכנולוגיות רבות עוצמה לאפיון ביטוי RNAs קצר, הן ברמת התפוקה הגבוהה (זיהוי הגנום) או כניתוח בודד מועמד (הצטברות מצב יציבה של מינים ספציפיים). למרות שכמה אסטרטגיות המדינה של אמנות זמינות כעת למינון או חזותי מולקולות שברחו כזה, assay צפון הכתם נשאר הגישה זכאית בביולוגיה מולקולרית להערכה מיידית ומדויקת של ביטוי RNA. זה מהווה צעד ראשון בדרך ליישום של, וטכנולוגיות יקרות יותר מתוחכמות, במקרים רבים, נותר שיטה מועדפת לתובנה בקלותלביולוגית RNA. כאן אנו סקירה כללית של פרוטוקול יעיל (Enhanced צפון כתם) לאיתור מייקרו RNA מתבטא בחולשה (או מיני RNA קטנים אחרים רגולטורים) מתסיסנית כל עוברים, גזורים באופן ידני רקמות / מבוגר זחל או בתאים בתרבית מבחנה. כמות מוגבלת מאוד של RNA נדרש והשימוש בחומר מתאי הזרימה cytometry-מבודדים יכולים להיות גם בחזונו.

Introduction

ביוכימיה RNA חוותה התקדמות מרהיבה בשנים האחרונות 1. ההבנה שלנו של פוטנציאל RNA בבקרת ביטוי גנים כבר פרצה על ידי זיהוי של ribo-רגולטורי noncoding החזקים 2, על ידי הגילוי של מנגנונים מבוססי RNA רומן הרגולציה 3,4 ועל ידי אפיון מעמיק יותר של אירועים שלאחר התעתיק כבר ידועים 5. כל הביולוגיה RNA יחד מחקרים אלה אפשרו לעשות באופן דרמטי את הסצנה, הפך נושא המחקר מרכזי בנוף המדעי הנוכחי. בפרט, בשנים האחרונות אנחנו מקבלים תחושה של ההשפעה המתפשטת של "עולם RNA" בנוירוביולוגיה המולקולרית 6, אחד מתחומי המחקר הדינמיים ביותר במדעי החיים מודרניים. בעשור האחרון של המאה שעברה, התרחיש המדעי הכולל כבר מהפכה על ידי הגילוי של התערבות RNA 7,8 ושל RNAs הרגולציה הקטן 9,10ביחס מסוים ל11 מייקרו RNA, באופן אנדוגני הביע RNAs noncoding הקטן מעורב בשליטה כמעט את כל הפונקציות הסלולריות כרגולטורי pleiotropic וקומבינטורית של ביטוי גנים.

כמעט 10 שנים לאחר הגילוי ראשוני מירנה בelegans Caenorhabditis ידי אמברוס והמעבדות של Ruvkun, תשומת לב מחודשת הפכה לשדה כאשר מספרים גבוהים של miRNAs זוהו בדרוזופילה ובתאים אנושיים, כמו גם 12-15. מאז, הודות לגישות מהונדסים תכליתיות, melanogaster דרוזופילה יש התבלט כהקשר ביולוגי יקר ערך עבור להתעמק ביוסינתזה ופעילות מירנה. דרוזופילה miRNAs חשפו פונקציות שונות בתהליכי חרקים ספציפיים או אבולוציונית משומרת, פורש מהזדקנות לחילוף חומרים, מסלולי איתות , התנהגות, וכמובן, נוירוגנזה. לאורך כיוון זה, אנו חשפו לאחרונה קישור רומן 16 בשיתוף המסקרןrrelation מתרחש בין GCM / דאיית גן האדון ומסלול RNA. גורם שעתוק זבוב GCM / Glide 17-19 מהווה דוגמא ייחודית של הקובע גורל תא, אשר מכתיב את בחירת הגורל העצבית גליה לעומת בmultipotent לטוס מבשרים עצביים 20. עשרים שנה מחקר ארוך בנושא זה באופן ברור הדגיש את התרחשותם של מספר רב של תשומות והחופפות של רגולציה ביטוי גנים מתכנסת על GCM / להחליק 21-28 להקים את רמות הסף הנדרשות לאיזון היחס העדין בין עמיתים עצביים וגליה במהלך התפתחות עצבית.

גילינו כי רגולציה, באמצעות מיקוד לפי Dmel-miR279 מייצגת רמת שליטה נוספת שתרמה לכוונון עדין שלאחר תעתיק של GCM / להחליק ביטוי 16. שיפורים מתודולוגיים ספציפיים בעולם, קווי מחקר אלה נדרשים: לאורך שנים, במספר טכנולוגיות שפותחו במקור כדי לנתח מסורתיתRNAs itional הוסב לכימות RNAs לא קטן קידוד, כמו כמבחני הגנה RNAse, מערכי cDNA 29-31, שיטות PCR בזמן אמת 32-35 ורצף 36,37. בצד השני, כיול של גישות טכניות טפח התקדמות רציפה בתחום.

צפון הכתם assay (NB, או assay כתם ג'ל RNA) מהווה דוגמא מייצגת: הוא מועסק במידה רבה לפרופיל הצטברות RNA, שכן הוא מבטיח שני quantitation רמת הביטוי, כמו גם קביעת גודל. עם זאת, רגישות העניים המהותית של השיטה היא להגביל כאשר הוא שיחול על מקלטי קנס ביטוי גנים נמוכים בשפע, כמו RNAs הקצר. תוצאה מזיקה היא הדרישה של כמויות גדולות של רנ"א הכל, מה שהופך את היישום שלה קשה לדגימות ביולוגיות ספציפיות. מסיבות כאלה, וריאנטים NB ספציפיים לגילוי RNA קטן פותחו 38-40: אנו ניצלנו proc NB השתפרedure 41 (ENB, משופר צפון כתם), ואילו הבהרת הגומלין הנ"ל בין Dmel-miR279 וGCM / דאייה.

שיטה זו מסתמכת על צעד כימי crosslinking מבוסס על הפעילות של נגזר Carbodiimide [1-אתיל 3-carbodiimide (3-dimethylaminopropyl), EDC] לתקן חומצות גרעין על תמיכה מוצקה. Carbodiimide הוא מקשר צלב צדדי הידוע לזרז את הקמתה של אגרות חוב אמיד בין קבוצות carboxyl או פוספט מופעלות וקבוצות האמינים 42. מאפיין זה יכול להיות מנוצל לזוג קוולנטית RNA הקטן באמצעות קבוצת 5'-הידרוקסיל מונו פוספורילציה לאמין קבוצות על פני השטח של קרום ניילון. תצורת הקובץ המצורף וכתוצאה מכך מגדילה את הנגישות של חומצות גרעין המשותקים ו, בתורו, את היעילות של הכלאת בדיקה-יעד, וכתוצאה מכך שיפור גילוי מדהים 43.

הטכניקה מניחה relevanc מסויםדואר במחקרים מולקולריים דרוזופילה, שבו ההתרחשות של כיתות רומן וייחודיות של RNAs noncoding הקטן מתגלה 44. בין אלה, rasiRNAs 45,46 מהווים תת סוג ספציפי של RNAs אינטראקציה-piwi (piRNAs 47), מעורב בהשתקת גני רצף ספציפי. פרטים אופרטיביים של שיטה זו מתוארים באופן מלא ומדמיינים להלן, ביחס לניתוח של מייקרו RNA Dmel-miR279 וDmel-miR286 ו, בפעם הראשונה, של אחד rasiRNA, rasi4. אנחנו דחפתי למצבים קיצוניים ששיטה זו, אשר אפשרה לנו לחשוף את המטרות הביעו גרוע מכמויות מינימליות של RNA (מיקרוגרם פחות מ 1).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

אוסף 1 לדוגמא

  1. ניתוק 2 התאים של שניידר למחצה חסיד, (1-5 x 10 6 תאים בממוצע), על ידי pipetting ולמסוק אותם על ידי צנטריפוגה (1 דקות 100 XG). במקרה של במבחנה תאים חסיד תרבותיים, trypsinize אותם בתנאים סטנדרטיים או ישירות לאסוף אותם מצלחות לסכום נוח של מגיב מיצוי RNA, על ידי עזרה של מגרד תא.
  2. לאוסף עובר, לגדול זני דרוזופילה בכלובי זבוב ועוברים לתת להצטבר על צלחות הטלת ביצים. נגבו את העוברים על ידי מכחול במים מזוקקים (DH 2 O), להשליך פסולת על ידי סינון מסננת, לשטוף ולשחזר עוברים ב48 בקבוקון.
  3. כטכניקה חלופית, לנתח באופן ידני רקמות / איברים. לבודד אשכים (מערכת מועדפת לניתוח Pirna) מבטן דרוזופילה בופר פוספט (PBS) תחת סטראו (הגדלה 20X), על ידי שימוש במחטים לנתיחה או מלקחיים כמו מולualized בסאליבן et al 49.
  4. העלי homogenize דגימות על התמכרות של 0.5 כרכים של מגיב מיצוי RNA.

2 הפקת RNA / ניתוח

  1. ההוראות של היצרנים הבאים לבצע בידוד RNA באמצעות חומרים כימיים מסחריים. זהירות! סוכני מיצוי RNA הם בדרך כלל רעילים ומאכל. לחלופין, להחיל פרוטוקול מבוסס K proteinase לבידוד RNA 50, כדלקמן:
    1. לדלל דגימות לתוך 400 μl של Stop מיקס ולדגור על RT במשך 15 דקות.
    2. לשחזר רכיבי hydrosoluble ידי פנול הסטנדרטי: כלורופורם: אלכוהול isoamyl ועקירות כלורופורם ועל ידי אתנול (EtOH) ממטרים / כביסה. אוויר יבש הדגימות וresuspend לdiethylpyrocarbonate (DEPC) -treated מזוקק פעמיים (dd) H 2 O.
  2. להעריך ריכוז RNA על ידי מדידת spectrophotometric UV. כמו כן להבטיח את טוהר RNA הוא גבוה, קרוב ל2.0, basעורך על 260 / קריאה 280.
  3. בדוק הכנת RNA על denaturing agarose ג'ל כדלקמן:
    1. בכוס נקייה, לפזר 1.2 גרם Agarose ב82 מ"ל של DEPC-DDH 2 O, תחת בחישה מתמדת. מרתיחים עד שהיא נמסה לחלוטין.
    2. אפשר פתרון ג'ל להתקרר; כאשר הטמפרטורה מגיעה 60 ° C להוסיף 10 מ"ל של 10X חומצה 4-morpholinepropanesulfonic (מגבים) חיץ לריכוז סופי 1X (FC), ו -8 מ"ל של 37% פורמלדהיד עד 3% FC. זהירות! פורמלדהיד הוא חומר מסרטן.
    3. יוצקים את הג'ל לתוך תא אלקטרופורזה אופקי. לאפשר את הג'ל לביסוס מתחת למכסת מנוע לשעה לפחות 1. בעקבות מיצוק, להטביע את הג'ל לתוך מגבים 1X.
    4. Aliquot 2 מיקרוגרם של מדגם RNA ו1 מיקרוגרם של סולם (השתמש סמן RNA כאשר הערכה מדויקת היא רצויה). הוסף 3 כרכים של צבע agarose טעינה (ALD) לרנ"א ולסולם. מחממים על 70 מעלות צלזיוס למשך 5 דקות וקרירות באופן מיידי על קרח. CAUTION! תוכן של ALD (רומיד ethidium ופוראמיד, ראה חומרים) הוא mutagen ומאכל, בהתאמה.
    5. טען את הדגימות ולהפעיל את הג'ל על 50 V כ 1 שעות עם מחזור חיץ מדי פעם. בדוק את דפוס חלוקה RNA על ידי ההדמיה UV או הדמיה ג'ל. להכיר להקות דיסקרטיות המתאימות ל28S ו18S rRNAs ולtRNAs (ראה איור 1).
  4. המשך צפון Assay או RNA חנות ב -80 מעלות צלזיוס.

.3 Denaturing Acrylamide ג'ל הכנה

  1. השתמש במנגנון קטן אנכי electrophoretic לצעד חלוקה זו (גודל צלחת על 8 סנטימטר x 9 סנטימטר, מ"מ 0.75 עובי מסרק).
  2. להרכיב משקפיים נקיים יחד במסגרת ליהוק.
  3. הכן 10 מ"ל של 10 acrylamide% / bis-acrylamide (19: 1) פתרון במגבי 1X, 7 מ אוריאה. מייד לפני המזיגה, להוסיף 10% persulfate אמוניום 100 μl ו10 μl של TEMED ומהירות לערבב הפתרון. זהירות! Acrylamide הוא רעיל למערכת עצבים וקרצינוגן.
  4. יוצקים את הג'ל בין לוחות זכוכית והכנס את המסרק היטב בזהירות כדי למנוע בועות. בואו ג'ל לפלמר ב RT לפחות 45 דקות לפני השימוש. לחלופין, לאחסן O ג'ל / N, עטוף בניירות מסנן ספוג מים ואטומים בניילון נצמד.

הכנת .4 דוגמא

  1. Aliquot .5-20 מיקרוגרם של RNA הכולל לכל דגימה. אם הנפח עולה על 3-4 μl, ואקום לייבש את המדגם.
  2. לקביעת גודל, לרוץ aliquot (20-30 CPS) של סולם נמוך לטווח radiolabeled במקביל לדגימות, כסמן (ראה סעיף 4.3 ו4.4 להכנה). פנקו אותו במקביל לדגימות, כפי שמתואר בשלב 4.5.
  3. סולם: להגדיר תגובה קדימה פוספט באמצעות 0.1 מיקרוגרם של סולם 10 נ"ב צעד. לדגור על 37 מעלות צלזיוס במשך 30 דקות ולעצור את התגובה על ידי הוספת חומצת ethylenediaminetetraacetic (EDTA) ל20 מ"מ FC.
  4. לטהר על ידי משקעים EtOH / כביסה, ייבוש באוויר וresuspend DDH 2 O (כ -100 μl). זהירות! 32 P הוא מקור רדיואקטיבי.
  5. לכל דגימה להוסיף נפח שווה של צבע acrylamide הכחול (ABD). לפגל על ידי חימום על 80 מעלות צלזיוס למשך 5 דקות ומגניבות על קרח עד טעינה. זהירות! פוראמיד (תוכן בABD) הוא מאכל.

.5 Electrophoretic פלזמה

  1. הסר את לוחות זכוכית מתמיכת הליהוק וכראוי להרכיב אותם בתא אלקטרופורזה. מלא את שני החדר הפנימי וחיצוני עם מספיק מאגר פועל (RB).
  2. להסיר בעדינות את המסרק ומראש להפעיל את הג'ל על 200 V עבור 10 דקות. לפני דגימות טעינה, לשטוף את פיקדונות אוריאה מהבארות על ידי התזה כמה RB באמצעות מזרק.
  3. השתמש בעצות שטוחות לזהירות דגימות רבד מצעד 4.5 בחלק התחתון של כל טוב. בדקו את חיבורי האנודה וקתודה, כדי למנוע ריצה הפוכה. לאחר הדגימות להיכנס לג'ל ב100 V למשך 5 דקות, אניncrease המתח 200 V.
  4. לאורך חלוקה של כ 7 סנטימטר, 45 דקות-טווח ארוך מספיק. הימנע bromophenol כחול (פיגמנט מעקב בABD) לעלות על גדותיו את הג'ל.
  5. דמיינו בג'ל RNAs הארוך המופרד על ידי רומיד ethidium מכתים (EtBr), כצעד אופציונאלי:
    1. לחתוך 2 סנטימטר מהחלק העליון של ג'ל ובקצרה לשטוף את הפרוסה בDDH 2 O.
    2. דגירה הפרוסה ג'ל ב RT ל15 דקות עם רועד עדין בRB, EtBr 0.5 מיקרוגרם / מ"ל ​​FC.
    3. Destain ג'ל ל15 דקות בRB, לדמיין rRNAs ארוך על ידי קרינת UV או הדמיה ג'ל. הגעה לטעינת RNA ואיכות (ראה תרשים 1, לוח 7). זהירות! Ethidium ברומיד הוא mutagen.
  6. בינתיים להמשיך סופג את החלק התחתון של ג'ל המכיל מיני RNA קטנים.

.6 ג'ל סופג

  1. חותך 6 חתיכות של נייר סופג כדי שיתאים לשטח הסופג וחתיכת uncharge שווה ערךקרום ניילון ד. לחלח גיליונות נייר, קרום ו2 רפידות סופגות בRB. הקפד לספוג לחלוטין את הרפידות על ידי סחיטתם שוב ושוב בRB.
  2. להסיר את הג'ל מהמכשירים ולפתוח את המשקפיים על ידי ממוצע של מרית. השתמש בחותך נקי כדי להסיר את הבארות. הנח גיליון נייר Whatman הרטוב על הג'ל בעדינות להרים את זה.
  3. מניחים את קרום הניילון על פניו חופשיות של ג'ל. סמן פינה כדי לכוון את המסנן בהתאם לטעינת מדגם. השלם את "הכריך" (חתיכות 3 נייר בכל צד). מרדדים מוט פלסטיק על פני השטח הכתם, כדי להסיר כל בועות אוויר אפשריות.
  4. הנח את הכתם בין שתי רפידות סופגות ולאחר מכן בקלטת הסופג. להרכיב את הקלטת במודול הסופג, למלא את התא עם RB ולבדוק את הכיוון הנכון (קרום הניילון חייב להישאר בין ג'ל והתחנה הסופי החיובית).
  5. העבר ב20 V עבור 20 דקות. הערה: על מנת להבטיח תנאים הומוגנית, לאחר 10 דקות לפתוח את המודול וr הסופגסוב הכריך ידי 180 ° לפני השלמת ההעברה.

.7 ממברנה Crosslinking

  1. הכן 6 מ"ל של תמיסה הטרי Crosslinking (XLS). להרוות 10 סנטימטר x 10 סנטימטר (גדול מקרום ניילון) פיסת נייר סופג עם XLS. זהירות! HCl (מרכיב של XLS) הוא מאכל מאוד.
  2. לפרק את הכתם ולמקם את הקרום על נייר סינון 3MM הרטוב. הערה: RNA לא חייב להיות במגע ישיר עם הנייר הרווי. הנח את המסנן ונייר בין שני לוחות זכוכית ולעטוף בניילון נצמד.
  3. מחממים את הקרום ב60 מעלות צלזיוס למשך 2 שעות, ואחריו DDH 2 O כביסה. אחסן ב-20 ° C או להמשיך לכלאה.

.8 ממברנה Prehybridization

  1. אם טעינת RNA נבדקה (צעד אופציונאלי 5.5), ישירות להמשיך לכלאה. או אחר, לחתוך 1 סנטימטר לחלק העליון של מסנן הניילון, כדי למנוע hybridizatio צולב בדיקהns לRNAs הארוך המופרד.
  2. מחממים 10 מ"ל של הכלאה פתרון (HS) על 37 מעלות צלזיוס. לפגל 1 מ"ג של זרע סלמון על 95 מעלות צלזיוס למשך 5 דקות, מגניב על קרח ולהוסיף לHS.
  3. דגירה המסנן בHS ב37 ˚ C במשך שעה לפחות 1, תחת סיבוב בתנור הכלאה. בדוק שRNA-הצד של המסנן עומד בפני HS.

.9 Probe סינתזה

  1. הגדר את התגובה קדימה פוספט ב10 pmol של מולקולת אנטיסנס קצרה ספציפית, כפי שמתואר ב4.3.
  2. הוסף 5 כרכים של טריס-EDTA-NaCl (TEN) חיץ לתגובה ולטהר פריימר שכותרתו מנוקלאוטידים מאוגדים על ידי כרומטוגרפיה הדרת ג'ל על עמודי G-25 Sephadex (או גם על ידי המשקעים EtOH). פעילות בדיקה ניתן להעריך על ידי נוזל נצנץ מתפרצות.

10. ממברנה הכלאה

  1. החלף את HS מותש עם טרי 10 מ"ל aliquot (שהוכן והושלם כפי שתואר לעיל). מחממים את הבדיקה בC 95 מעלות עבור 10 דקות, מגניב על קרח ולהוסיף לHS רומן. דגירה המסנן על 37 מעלות צלזיוס ON.

כביסה 11. ממברנה

  1. לשחזר את פתרון ההכלאה ולאחסן אותו ב-20 מעלות צלזיוס בתיבת מיגון רדיואקטיביות.
  2. יש לשטוף את המסנן בכביסה חוצץ (WB) ולשטוף אותו ביסודיות ל10 דקות ב RT.
  3. השתמש גייגר מילר גלאי לבדיקת רדיואקטיביות שיורית בפינות המסנן. כאשר פליטת רקע היא סביב 5 CPS, להמשיך קרום אקספוזיציה.

12. גילוי אותות

  1. לחשוף את המסנן על סרטי autoradiography או על גבי מסך תרמי מולקולרי. לחשוף אותות על ידי עיבוד צילום או המרה דיגיטלית.
  2. לנתח את עוצמת הלהקה על ידי תוכנה ייעודית כימות (ImageJ או Optiquant).

13. ממברנה חישוף

  1. כדי להסיר אותות עיקריים, להטביע את הקרום ב500 מ"ל רותח פתרון חישוף, אז לדגור על RT דקות 1. המשך לרומן הכלאה (מראש) או לאחסן את המסנן ב-20 מעלות צלזיוס.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

על ידי ביצוע ההליך הכולל המתואר בטקסט ואופן סכמטי המיוצג באיור 1, אנו הערכנו ביטוי RNA הקטן מדוגמאות RNA מורכבות של מקורות שונים. בניסוי שהוצג באיור 1, RNA היה מבודד מ2 התאים של דרוזופילה שניידר על ידי מיצוי proteinase K, בדיקת תקינות ב( שלב אופציונאלי: denaturing חלוקה agarose ג'ל) ועמוס בכפול. מחצית אחת של ג'ל הייתה מחקה על קרום ניטראלי וכימי צולבים על ידי EDC; המחצית השנייה הועברה על מסנן ניילון במטען חיובי, אז UV צולב (1.2 x 10 5 μJ / 2 סנטימטר). הביטוי אנדוגני של שני מייקרו RNA השייך למשפחת Dmel-miR279 (Dmel-miR279 עצמו ו15 Dmel-miR286) אומת בשני התנאים. ההליך המשופר (ENB) מבטיח כבוד רגישות גבוה יותר לסטנדרטי אחד (SNB).

s = "jove_content"> היעילות שונה בין שתי השיטות היא אפילו טוב יותר מודגש באיורים 2 ו -3. רציונל הניסוי הוא כנ"ל: כאן אנו מדווחים על תוצאת הנציג של איתור autoradiographic צפון כתם של rasi4 Pirna לאורך טיטרציה של רנ"א הכל חולץ ממבוגרים לטוס אשכים. ENB כבר מאפשר גילוי להקה ספציפית כאשר 0.5 מיקרוגרם של רנ"א נטען. הכימות בצד מראה כיצד האות יחסי עולה עם כמות הרנ"א מופרד, מצביע על כך שיחס מינון / תגובה נמצא בטווח ליניארי של זיהוי. הפנל מתחת מאשרר את הרגישות המשופרת של שיטה זו בהשוואה לSNB. במקרה זה, אות לזיהוי מתקבלת על חלוקה electrophoretic של 10 מיקרוגרם של רנ"א לפחות עבור הבנק המרכזי של שוויץ.

תוצאות דומות הושגו עם מיני RNA noncoding שונים, למשל, rRNA 5s, כפי שדווחו באיור 3 </ Strong>.

איור 1
איור 1 ייצוג סכמטי של הליך צפון הכתם הכולל. צעדים פרוצדורליים ראשיהם מופיעים וממוספרים בהדרגה. תוצאות הן בהשוואה בין הכתם משופר הצפון (ENB) ורגיל צפון הכתם (SNB), שבוצע באותם תנאים: בידוד RNA מן 2 התאים של דרוזופילה שניידר (לוח 1), אלקטרופורזה (לוח 2), העברה (לוח 3) וכלאה ( לוח 5). ENB מתייחס להליך השיפור שתואר בדוח זה, אשר דורש מסנן ניטראלי (לוח 3, מחצית השמאלית של הקרום) וcrosslinking (לוח 4) המבוסס על EDC הקובעת קשר הקוולנטי בין RNA היעד 5'-end וקרום ( נקודות ורודות בלוח 4). בבנק המרכזי של שוויץ, crosslinking RNA מתקבל על ידי טיפול UV (לוח 4) במטען חשמלי חיובי nylon קרום (לוח 3, מחצית ימנית של הקרום). אות ספציפית 5S RNA היא לא כיל בתנאים השוואתיים, כי זה גם מגיב להבדלים בין SNB והליך ENB. לפיכך, סכום (המקביל ל 10 CPS) של כותרת 5'(ראה נקודות 4.3 ו4.4 לפרוטוקול), 50 oligonucleotide NT המקושקשת ארוך התווסף לכל דגימה לפני אלקטרופורזה, לתפקד כ" עלייה חדה ב" התייחסות ( לוח 7). טוען יכול להיות גם שהוערך על ידי מכתים EtBr בג'ל של rRNAs הארוך (ראה נקודה 5.5 לפרוטוקול). L = סולם. FV = פרונטאלית צפה ב, LV = רוחב צפה ב, HV = צפה אופקי. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 2
איור 2 Comparניתוח יצירתי צפון כתם ביטוי rasi4. רמות אנדוגני של rasi4 Pirna האשך ספציפי מתגלים על ידי משופר (ENB) או סטנדרטי (SNB) צפון כתם, שבוצע על הגדלת כמויות של רנ"א הכל (שצוין לעיל כל מסלול) שחולץ מן האשכים דרוזופילה מבוגרות , או מכל בטן (עבד). עבור כל מתודולוגיה, היסטוגרמות הצידה לדווח כמויות היחסית של כבוד rasi4 לאותה כמות של "עלייה חדה ב" שליטת טעינה. Quantifications משתי השיטות משולבים בגרף חותך ממוקם מתחת לג'לי. אנא לחץ כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

איור 3
איור ניתוח .3 השוואתי צפון כתם של r 5SRNA ביטוי. כביקורת חיובית וכיול ניסיוני, ניתוח קודם הוארך עד rRNA 5s. פרטים כמו באיור 2. אנא לחצו כאן כדי לצפות בגרסה גדולה יותר של דמות זו.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

למרות ההערכה של המתוחכם משתרג דרכו RNA מסדיר נוירוגנזה שלנו עולה בהתמדה, ההשלכות מכניסטית של circuitries מבוסס RNA המשפיע על ביולוגיה של תאי גזע עצבי, הבחנה עצבית / אינטגרציה פונקציונלית, פיתוח של פתולוגיות וסוגי הסרטן עצביים להישאר שלא נחקרו. התחזוקה של רשתות כגון דרך הממלכות עושה את הפוטנציאל של מערכות גנטיות כתסיסנית סייעה לפענח מסלולים סלולריים שלא נחקרו, שבו RNAs noncoding הקצר וגורמי שעתוק נחשבים שחקנים מולקולריים גדולים. בתצוגה זו, הפרופיל של רמות ביטוי RNA הקטנות מועמד הוא propaedeutic לניתוחים תפקודיים מדויקים: דוגמא מגיעה מההפגנה האחרונה שלנו שDmel-miR279 מודולציה הקובע גורל GCM / דאיית in vivo, נעשתה באמצעות גרסה משופרת של assay הצפון סופג כ כלי לניתוח ביטוי.

51, NB כבר נחשב שיטת התייחסות לניתוח RNA. למרות כמה מגבלות פנימיות של assay זה, כמרה קשה זמנית שגיאות פורמט או אפשרי עם כימות אות, פריצות הדרך האחרונות בתחום הביולוגיה מולקולרית RNA גילו מחדש טכניקה קונבנציונלית זו כמערכת "מהירה ונקיה" למנסה לאמוד ביטוי אנדוגני של ריבונוקלאית קטנים חומצות או לאימות האפקטיביות של gain- או גישות אובדן של הפונקציה. כדוגמה פרדיגמטי, ניתוח צפון מניח בבסיס התגלית המקורית של מייקרו RNA, ואילו הגישה נשארה בחוד החנית להרלוונטיות שלה באפיון של נכסים הולכים וחדשים של RNAs הרגולציה 52.

הגרסה המתוארת כאן מבוססת על רגישות מוגברת בשל crosslinking כימי של RNA. אנו believethe שיטה עדיין מועסקים בצורה גרועה בדרוזופילה, ב ut כאשר ניצלו הוביל לתגליות משמעותיות 52, שכן הוא הופך את ביטוי RNA פרופיל אפשרי מדגימות קטנות (מיקרוגרם פחות מ 1), עם שיפור של פי 10-30 ממוצע של גילוי מטרת RNA 41,43, כפי שהשגנו בתנאים שלנו (דמויות 2 ו -3).

שלמות RNA מהווה נושא קריטי על מנת להשיג תוצאות עקביות ולשעתק. מניפולציות RNA דורשות דיוק ומהירות להגביל השפלה מדגם אפשרית המתרחשת בין החילוץ וטעינה. במטרה זו, כל הפתרונות צריכים להיות diethylpyrocarbonate- (DEPC) שטופל לפני השימוש (הדגירה שעה 2 בנוכחות DEPC 0.1% על 37 מעלות צלזיוס ולאחר מכן autoclaved) לעקוף פעילות RNase. טיפול פתרון מבטיח כבוד תוצאות טוב יותר לשימוש במי DEPC כממס. כל הציוד יהיה שטוף באותה מידה בDEPC ddH20, לאחר הניקוי על ידי decontaminant משטח RNase הספציפי.

> בידוד RNA: פרוטוקולים שונים ניתן להשתמש כדי לבודד RNA ללא פגע. כל מגיב thiocyanate-פנול, כלורופורם המסחרי guanidinium יכול להיות מועסק בהצלחה: הם מומלצים ביותר, כאשר הביטוי קטן RNA הוא נמוך במיוחד (למשל, rasi4, Figure2) או כאשר טיהור RNA לא מבוצעת על דגימות טריות (למשל, השתמר לאחסון רקמות ריאגנטים). מניסיון, בידוד RNA מן הדגימות התייצבו הביא חמור יותר באופן משמעותי ונדרש תנאי חילוץ דרסטיים יותר. בתנאים סטנדרטיים, שיטה המבוססת על K proteinase תיארה מבטיחה הכנות באיכות טובה, כמו גם, (דוגמא משמעותית מיוצגת בFigure1) אבל זה לא הבחירה האופטימלית עבור דגימות נשמרו בריאגנטים אחסון.

לבסוף, מאז הליך זה נועד לגילוי ספציפי RNA קטן, יכולות להיות מועסקות ערכות המבוססת על טיהור טור מוקדש לבידוד RNA קטן ישיר, למרות הכלומר הופך קשה יותר כדי לאמת את שלמות RNA. בחלופה להליך המבוסס על ג'ל הקלאסי לבקרת שלמות RNA שתוארה לעיל, ניתן להעריך איכות RNA על ידי מכשירים לניתוח זעיר על השבב של דפוסי חומצות גרעין.

מאגר בחירה: מגבים-NaOH חיץ (pH 7) הוצעה כחיץ מועדף עבור שתי אלקטרופורזה משופרת צפון ג'ל וסופג. אנחנו גם באופן משביע רצון בשימוש טריס- borate EDTA-חיץ (TBE) בניסויים שלנו. במקרה זה, שכן הנוכחות של קבוצות האמינים nucleophile של טריס aminomethane (hydroxymethyl) הייתה hydrolyze ולהשבית DEPC במהלך הטיפול עצמו, מומלץ המסת טריס למים DEPC שטופל במקום חיץ TBE טיפול כבר מוכן.

Electrophoretic הפעלה וסופג: טרום ריצת ג'ל היא חיונית להסרת persulfate העודף וביטול מיקוד יתר. פרמטרים טרום ריצה יש לשמור גם במהלך חלוקה, הימנעות electropho מהר מדיretic ריצה. לפני הטעינה, הקפד להסיר משקעי אוריאה אפשריים מבארות, על ידי התזת חיץ בתוך. זה יגביל את המדגם לשפוך מעל וערבויות ריבוד RNA מדויק, הפקת להקות autoradiographic נפתרו במהלך איתור אותות. כל קרום ניילון ניטראלי יכול לשמש כתמיכה להעברת חומצות גרעין. אל תמחה RNA ליותר מ 20-30 דקות בתנאים שצוינו.

Crosslinking: crosslinking כימי מבוסס EDC מייצג מראש מתודולוגית הביקורתיים של גרסת כתם זה משופר צפון. האפשרות לcrosslink מיני RNA הקצר למשטחים ניטרליים על ידי גבולות קוולנטיים בין קבוצת RNA 5'mono פוספט ואמינים ראשוניים ניילון משאיר את רוב הבסיסים זמינים להכלאה. זה משפר את הרגישות על ידי 10-20xrespect לcrosslinking מסורתי. זה חיוני כדי להכין כמות טריות של פתרון crosslinking לכל סופג, בכמות מספקת לרווית קרום נכונה.

הכלאה וכביסה: בדיקות רצוי להיות מתויגות טרי. לחקור פעילות ספציפית (תלוי בפעילות הספציפית וסכום של נוקלאוטיד radiolabeled התאגד וגם על הסכום של בדיקה זמינה להכלאה) קובע את הרגישות של זיהוי היעד. כאשר [γ- 32 P] ATP עם פעילות ספציפית של 3,000 Ci / mmol משמש, 10 6 עותקים לדקה / pmol לתיוג 100% מ5 'מסתיים צפוי.

פתרון ההכלאה ניתן לשחזר ומנוצל מחדש, בהתחשב בכך ש, בשל 32 ריקבון P, חצאים פעילות בדיקה בכ 14 ימים.

בשל ניטרליות קרום, רעש רקע נמוך צפוי על הכלאה. אם תנאי כביסה מחמירים יותר נדרשים, בהדרגה להפחית את הכוח יוני חיץ הכביסה (עד 0.2X SSPE) או להוסיף כמויות גדלות והולכות של חומרי ניקוי יוניים (עד 0.5% SDS) או להעלות את טמפרטורת כביסה ל37 C °.

= "Jove_content"> כדי להימנע מחפיפת אותות עם הכלאה הבאה, מומלץ לוודא מחדש על ידי חשיפה שהבדיקה הראשונית הוסרה לחלוטין מהמסנן על הפשטה. עם זאת, בשל אובדן הדרגתי של RNA מהמסנן יש להימנע יותר מ 3-4 מחזורים של הפשטה ומחדש חיטוט.

ניתוח כתם צפון הוא חיוני כאשר נדרש מדידת גודל RNA. למרות assay זה ייתכן חוסר הדיוק של qPCR הקרינה מבוססת גישות להערכת RNAs הזעיר, יתרון נובע משימוש בחלוקת denaturing / סופג והכלאת בדיקה תלויה כצעדים ייחודיים לפני הגילוי של RNAs היעד. כתוצאה מכך, ההתגלות של אותות ספציפיים מהמדגם היא ישירה ואינה דורשת כל צעד נוסף של טיפול / המרה / הגברה אנזימטית, שפירושה השימוש בערכות מסחריות ייעודיות. ניתן לכמת רמות RNA והשוואה בין דגימות מרובות על קרומים יחידים. כך Northeכתם rn מועסק בכינויו אימות מחמירה לנתונים qPCR. דרבן על ידי דרישות ניסוי ספציפיות, השיטה שופרה גם בשנים האחרונות, הן ברמת הרגישות ורזולוציה כך שכמות מוגבלת של RNAs (ראה איורים 2 ו -3) נדרשות לניתוח מוצלח.

הפרוטוקול שהצגנו יכול להיות מותאם למגוון רחב של יישומים במיוחד שבו חומר זמין בכמויות מוגבלות. המקור הביולוגי של דגימות RNA יכול להיות הטרוגנית: ככל דרוזופילה היא מודאגת, עוברים או שלבי התפתחות אחרים הם מתאימים, אלא גם ניתחו באופן ידני רקמות או איברים, cytotypes מבודד מיון תאים בודדים או בתרביות תאים.

יתר על כן, למרות שמייקרו RNA הוא בכיתה הנפוצה ביותר של RNAs רגולציה הקצר בתא והנושא העיקרי של חקירה בתחום בקרת ביטוי גנים בתיווך RNA, הם לא חסרונותtitute המשפחה היחידה של RNAs noncoding הסלולרי. אשכולות של RNAs הזעיר רבים לתפקד על פני ממלכות (למשל, siRNAs אנדוגני, piRNAs, snoRNAs, צמח tasiRNAs) ורובם מתאפיינים מתחנה סופית חופשית 5 '(ללא שינוי), בדרך כלל נובעים מעיבוד אנדו-ribonucleolytic של מולקולות מבשרים. תכונה זו מהווה התנאי מוקדם מבני הייחודי הנדרש אך ורק ליישום מתודולוגיה המשופרת הספציפית המבוססת על crosslinking כימי, למרות שגודל RNA יש לקחת בחשבון, כמו גם, כאשר RNAs יותר מנותחים. באיור 2 אנו מדווחים ניתוח צפון כתם יחסית איתור הרמות של rasi4 54 חבר כיתה של RNA הקטן נבט אונליין ספציפי (Piwi אינטראקצית RNA או piRNAs.) בתנאים של רמות ביטוי עניות וספציפיות, הרגישות המשופרת בשיטה זו יכולה להכשיר תוצאות מוצלחות, במיוחד בהתחשב בכך שהפרוטוקול שדווח ניתן לשפר עוד יותר על ידי מסרקining אותו עם יישומים מעשיים אחרים שכבר תוארו בספרות 55,56.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

עבודה זו נתמכה על ידי המכון הלאומי דה לה סנטה et de la המשוכלל והנדיר Médicale, המרכז הלאומי דה לה המשוכלל והנדיר Scientifique, האוניברסיטה לדה שטרסבורג, Hôpital דה שטרסבורג, האגודה לשפוך la משוכלל ונדיר sur le הסרטן, המכון הלאומי du הסרטן, סוכנות הידיעות Nationale de la המשוכלל והנדיר ואלזס האזור.

פייטרו Laneve כבר נתמך על ידי Fondation לשפוך la המשוכלל והנדיר Médicale. נכון לעכשיו, הוא מקבל מלגת Istituto Italiano Tecnologia (IIT). עלויות פרסום נתמכות על ידי רשת Neurex (TriNeuron - תכנית Interreg IV העליון הריין)

Materials

Name Company Catalog Number Comments
FINAL COMPOSITION/NAME COMPANY CATALOGUE (Stock) COMMENTS
GENERAL REQUIREMENT
Centrifuge, 5418 Eppendorf 5418 000.017
Decontaminant, RNase Away Sigma-Aldrich 83931 Apply on glass/plasticware, wipe and rinse
RNase inhibitor, DEPC Sigma-Aldrich D5758 Hazardous //// 1609-47-8
SAMPLE PREPARATION
Stereo Microscope, M60 Leica 
1X PBS Buffer
137 mM NaCl Sigma-Aldrich S3014 7647-14-5  
2.7 mM KCl Sigma-Aldrich P9541 7447-40-7 
10 mM Na2HPO4 Sigma-Aldrich S3264 7558-79-4 
1.8 mM KH2PO4 Sigma-Aldrich P9791 7778-77-0 
RNA EXTRACTION/ANALYSIS
UV-Vis Spectrophotometer Thermo Scientific Nanodrop 2000
Gel Imager, ChemiDoc XRS+ Biorad 170-8265
Horizontal Electrophoresys, Mini-Sub Cell GT BioRad 170-4487EDU
RNA extraction reagent, TRIzol Reagent Life Technologies 15596026 Hazardous
PCA (25:24:1), 1:1 for extraction Sigma-Aldrich 77617 136112-00-0
Chlorophorm, 1:1 for extraction Sigma-Aldrich C2432 67-66-3  
EtOH, 2.5 vol. for precipitation, 70% for washing Sigma-Aldrich 59844 64-17-5 
Gene Ruler 1Kb DNA Ladder Thermo Scientific SM0311
Stop Mix
300 mM NaOAc, pH 5.5 Sigma-Aldrich S2889 127-09-3
1x RSB Solution
2% sodium dodecyl sulfate (SDS) Sigma-Aldrich 71736 Never cool down SDS to avoid  precipitation //// 151-21-3
2 mg/ml Proteinase K Roche Applied Science 0-3115828001 EC 3.4.21.64 9
10X Reticulocyte Standard Buffer (RSB)
100 mM Tris-Cl, pH 7.4 Sigma-Aldrich T5941 1185-53-1  
100 mM NaCl Sigma-Aldrich S3014 7647-14-5  
30 mM MgCl2 Sigma-Aldrich M8266 7786-30-3
Denaturing Agarose Gel
1.2% Agarose Sigma-Aldrich A9539 Let the gel solidify for at least 1 hr //// 9012-36-2
10X MOPS Buffer
0.2 M MOPS sodium salt, pH 7 Sigma-Aldrich M9381 Do not confuse MOPS sodium salt with MOPS //// 71119-22-7
Agarose Loading Dye
1x MOPS Buffer
3% formaldehyde Sigma-Aldrich F8775 Hazardous //// 50-00-0
50% formamide Sigma-Aldrich 47670 Hazardous //// 75-12-7
Ethidium bromide (EtBr) 30 μg/ml Sigma-Aldrich E1510 Hazardous //// 1239-45-8
Bromophenol blue  Sigma-Aldrich B0126 115-39-9 
SMALL RNA FRACTIONATION
Flat gel loading tips Life Technologies LC1002
Savant SpeedVac Concentrator Thermo Scientific  DNA120
Vertical Electrophoresis, Mini-PROTEAN Tetra Cell  Biorad 165-8000
Denaturing Acrylamide Gel
10% acrylamide/bis-acrylamide (19:1) Sigma-Aldrich A3449 Hazardous. Let the gel polymerize for 45 min before use
1x TBE Buffer (or 1x MOPS Buffer)
7 M urea Sigma-Aldrich U6504 57-13-6
0.1% ammonium persulfate Sigma-Aldrich 215589 7727-54-0 
0.1% TEMED Sigma-Aldrich T9281 110-18-9
Gene Ruler Ultra Low Range DNA Ladder (10 bp-step) Thermo Scientific SM1211 Label 0.1 μg, as described in the "probe labeling" reaction
Acrylamide Blue Dye 
50% formamide Sigma-Aldrich 47670 Hazardous //// 75-12-7
Bromophenol blue Sigma-Aldrich B0126 115-39-9 
Running Buffer (RB)
1x MOPS Buffer 
Alternative RB: 1x TBE Buffer
1x TBE Buffer
5X TBE
445 mM Tris-base Sigma-Aldrich T1503 77-86-1 
445 mM boric acid Sigma-Aldrich B7901 10043-35-3
20 mM EDTA Sigma-Aldrich EDS 60-00-4  
Gel Staining Solution
Ethidium bromide 0.5 μg/ml Sigma-Aldrich E1510 Hazardous //// 1239-45-8
1x RB Stain for 15 min with EtBr, destain for 15 min w/o EtBr
BLOTTING
3MM Whatman paper Sigma-Aldrich Z270849
Neutral Nylon Membrane, Hybond NX GE Healthcare Life Science RPN203T Photosensitive
CROSSLINKING
Crosslinking Solution (XLS)
1% 1-methylimidazole (v/v) Sigma-Aldrich 336092 Always prepare a fresh aliquot of XLS //// 616-47-7
12.5 mM HCl Sigma-Aldrich H1758 Hazardous //// 7647-01-0
3.1% EDC (w/v) Sigma-Aldrich 3450 25952-53-8  
(PRE)-HYBRIDIZATION
Liquid Scintillation Counter  Beckmann LS 6500
Sheared Salmon Sperm, 0.1 mg/ml  Life Technologies AM9680
rasi4 anti-sense probe 5' CGGUGUUCGACAGUUCCUCGGG -3'
5s-rRNA anti-sense probe 5'-CAACACGCGGTGTTCCCAAGCCG-3'
Dmel-miR279 anti-sense probe 5'-TTAATGAGTGTGGATCTAGTCA-3'
Dmel-miR286 anti-sense probe 5'-AGCACGAGTGTTCGGTCTAGTCA-3'
Purification Kit, Illustra MicroSpin G-25 Columns GE Healthcare Life Science 27-5325-01
(Pre)-Hybridization Solution (HS)
0.5% SDS Sigma-Aldrich 71736 151-21-3 
5x Denhardt's Solution
20X SSPE
3.6 M NaCl Sigma-Aldrich S3014 7647-14-5  
0.2 M sodium phosphate Sigma-Aldrich 342483 7601-54-9  
20 mM EDTA (pH 8.0) Sigma-Aldrich EDS  60-00-4  
50x Denhardt's Solution
1% Ficoll 400 (w/v) Sigma-Aldrich F2637 26873-85-8
1% Polyvinylpyrrolidone Sigma-Aldrich PVP40 9003-39-8
1% BSA Sigma-Aldrich A7906 9048-46-8  
1X TEN Buffer
10 mM Tris-Cl (pH 8.0) Sigma-Aldrich T1503 77-86-1 
100 mM NaCl Sigma-Aldrich S3014 7647-14-5  
1 mM EDTA (pH 8.0) Sigma-Aldrich EDS 60-00-4  
Probe Labelling
0.4 μM oligonucleotide
1.5 μl Ci/μl [γ-32P] ATP Perkin Elmer NEG002A Hazardous //// 51963-61-2
1x T4 Polynucleotide Kinase Buffer Biolabs B0201
T4 Polynucleotide Kinase 0.5 units/μl Biolabs M0201 EC 2.7.1.78
WASHING
Geiger Mueller Detectors Canberra Industries MCB2/CPS – EM77021
Washing Buffer (WB), 2x SSPE
Stringent Washing Buffers
0.2x SSPE
2x SSPE, 0.5% SDS
0.2x SSPE, 0.5% SDS
SIGNAL DETECTION
PharosFX Plus System Biorad 170-9460
Image J Freely available
Quantity One Biorad
X-ray films , BioMax XAR Sigma-Aldrich F5888 Photosensitive
Developer for X-ray films Sigma-Aldrich P7042
Fixer for X-ray films Sigma-Aldrich P7167
STRIPPING
Stripping Solution
10 mM Tris-HCl pH 8.8 Sigma-Aldrich T1503 77-86-1 
5 mM EDTA Sigma-Aldrich EDS 60-00-4  
0.1% SDS Sigma-Aldrich 71736 Add SDS after boiling to avoid foaming //// 151-21-3

DOWNLOAD MATERIALS LIST

References

  1. The RNA World. Gesteland, R. F., Cech, T. R., Atkins, J. F. 3rd, Cold Spring Harbor Laboratory Press. (2006).
  2. Mercer, T. R., Dinger, M. E., Mattick, J. S. Long non-coding RNAs: insights into functions. Nat Rev Genet. 10, 155-159 (2009).
  3. Salmena, L., Poliseno, L., Tay, Y., Kats, L., Pandolfi, P. P. A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell. 146, 353-358 (2011).
  4. Cesana, M., et al. A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA. Cell. 147, 358-369 (2011).
  5. Orphanides, G., Reinberg, D. A unified theory of gene expression. Cell. 108, 439-451 (2002).
  6. Mehler, M. F., Mattick, J. S. Noncoding RNAs and RNA editing in brain development, functional diversification, and neurological disease. Physiol Rev. 87, 799-823 (2007).
  7. Fire, A., Xu, S., Montgomery, M., Kostas, S., Driver, S., Mello, C. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391, 806-811 (1998).
  8. Hamilton, A., Baulcombe, D. A species of small antisense RNA in posttranscriptional gene silencing in plants. Science. 286, 950-952 (1999).
  9. Lee, R. C., Feinbaum, R. L., Ambros, V. The C. Elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 75, (1993).
  10. Wightman, B., Ha, I., Ruvkun, G. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell. 75, 855-862 (1993).
  11. Fabian, M. R., Sonenberg, N., Filipowicz, W. Regulation of mRNA translation and stability by microRNAs. Annu Rev Biochem. 79, 351-379 (2010).
  12. Pasquinelli, A. E., et al. Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature. 408, 86-89 (2000).
  13. Lagos-Quintana, M., Rauhut, R., Lendeckel, W., Tuschl, T. Identification of novel genes coding for small expressed RNAs. Science. 294, 853-858 (2001).
  14. Lau, N. C., Lim, L. P., Weinstein, E. G., Bartel, D. P. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science. 294, 858-862 (2001).
  15. Lee, R. C., Ambros, V. An extensive class of small RNAs in Caenorhabditis elegans. Science. 294, 862-864 (2001).
  16. Laneve, P., et al. The Gcm/Glide molecular and cellular pathway: new actors and new lineages. Dev Biol. 375, 65-78 (2013).
  17. Hosoya, T., Takizawa, K., Nitta, K., Hotta, Y. Glial cells missing: a binary switch between neuronal and glial determination in Drosophila. Cell. 82, 1025-1036 (1995).
  18. Jones, B. W., Fetter, R. D., Tear, G., Goodman, C. S. Glial cells missing: a genetic switch that controls glial versus neuronal fate. Cell. 82, 1013-1023 (1995).
  19. Vincent, S., Vonesch, J. L., Giangrande, A. Glide directs glial fate commitment and cell fate switch between neurons and glia. Developement. 122, 131-139 (1996).
  20. Cattenoz, P. B., Giangrande, A. Lineage specification in the fly nervous system and evolutionary implications. Cell Cycle. 12, 2753-2759 (2013).
  21. Jones, B. W., Abeysekera, M., Galinska, J., Jolicoeur, E. M. Transcriptional control of glial and blood cell development in Drosophila: cis-regulatory elements of glial cells missing. Dev Biol. 266, 374-387 (2004).
  22. Ragone, G., et al. Transcriptional regulation of glial cell specification. Dev Biol. 255, 138-150 (2003).
  23. Akiyama-Oda, Y., Hosoya, T., Hotta, Y. Asymmetric cell division of thoracic neuroblast 6-4 to bifurcate glial and neuronal lineage in Drosophila. Development. 126, 1967-1974 (1999).
  24. Bernardoni, R., Kammerer, M., Vonesch, J. L., Giangrande, A. Gliogenesis depends on glide/gcm through asymmetric division of neuroglioblasts. Dev Biol. 216, 265-275 (1999).
  25. Ragone, G., Bernardoni, R., Giangrande, A. A novel mode of asymmetric division identifies the fly neuroglioblast 6-4T. Dev Biol. 235, 74-85 (2001).
  26. Soustelle, L., Roy, N., Ragone, G., Giangrande, A. Control of gcm RNA stability is necessary for proper glial cell fate acquisition. Mol Cell Neurosci. 37, 657-662 (2008).
  27. Akiyama, Y., Hosoya, T., Poole, A. M., Hotta, Y. The gcm-motif: a novel DNA-binding motif conserved in Drosophila and mammals. Proc. Natl. Acad. Sci. USA. 25, 14912-14916 (1996).
  28. Miller, A. A., Bernardoni, R., Giangrande, A. Positive autoregulation of the glial promoting factor glide/gcm. EMBO J. 17, 6316-6326 (1998).
  29. Krichevsky, A. M., King, K. S., Donahue, C. P., Khrapko, K., Kosik, K. S. A microRNA array reveals extensive regulation of microRNAs during brain development. RNA. 9, 1274-1281 (2003).
  30. Liu, C. G., et al. An oligonucleotide microchip for genome-wide microRNA profiling in human and mouse tissues. Proc. Natl. Acad. Sci. USA. 101, 9740-9744 (2004).
  31. Yin, J. Q., Zhao, R. C., Morris, K. V. Profiling microRNA expression with microarrays. Trends Biotechnol. 26, 70-76 (2008).
  32. Schmittgen, T. D., Jiang, J., Liu, Q., Yang, L. A high-throughput method to monitor the expression of microRNA precursors. Nucleic Acids Res. 32, E43 (2004).
  33. Chen, C., et al. Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res. 33, e179 (2005).
  34. Shi, R., Chiang, V. L. Facile means for quantifying microRNA expression by real-time PCR. Biotechniques. 39, 519-525 (2005).
  35. Raymond, C. K., Roberts, B. S., Garrett-Engele, P., Lim, L. P., Johnson, J. M. Simple quantitative primer-extension PCR assay for direct monitoring of microRNAs and short-interfering RNAs. RNA. 11, 1737-1744 (2005).
  36. Wang, Z., Gerstein, M., Snyder, M. RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet. 10, 57-63 (2009).
  37. Linsen, S. E., et al. Limitations and possibilities of small RNA digital gene expression profiling. Nat Methods. 6, 474-476 (2009).
  38. Valoczi, A., et al. Sensitive and specific detection of microRNAs by northern blot analysis using LNA-modified oligonucleotide probes. Nucleic Acids Res. 32, e175 (2004).
  39. Varallyay, E., Burgyan, J., Havelda, Z. Detection of microRNAs by Northern blot analyses using LNA probes. Methods. 43, 140-145 (2007).
  40. Kim, S. W., et al. A sensitive non-radioactive northern blot method to detect small RNAs. Nucleic Acids Res. 38, e98 (2010).
  41. Pall, G. S., Hamilton, A. J. Improved northern blot method for enhanced detection of small RNA. Nat Protoc. 3, 1077-1084 (2008).
  42. Hermanson, G. T. Bioconjugate Techniques. 2nd, Academic Press, Inc. (2008).
  43. Pall, G. S., Codony-Servat, C., Byrne, J., Ritchie, L., Hamilton, A. Carbodiimide-mediated cross-linking of RNA to nylon membranes improves the detection of siRNA, miRNA and piRNA by northern blot. Nucleic Acids Res. 35, e60 (2007).
  44. Guzzardo, P. M., Muerdter, F., Hannon, G. J. The piRNA pathway in flies: highlights and future directions. Curr Opin Genet Dev. 23, 44-52 (2013).
  45. Aravin, A. A., et al. Double-stranded RNA-mediated silencing of genomic tandem repeats and transposable elements in the D. melanogaster germline. Curr. Biol. 11, 1017-1027 (2001).
  46. Vagin, V. V., et al. A distinct small RNA pathway silences selfish genetic elements in the germline. Science. 313, 320-324 (2006).
  47. Brennecke, J., et al. Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila. Cell. 128, 1089-1103 (2007).
  48. Sullivan, W., Ashburner, M., Hawley, R. S. Drosophila protocols. Cold Spring Harbor Laboratory Press. (2008).
  49. Zamore, P. D., Ma, S. Isolation of Drosophila melanogaster testes. J. Vis. Exp. (51), e2641 (2011).
  50. Sambrook, J., Fritsch, E. F., Maniatis, T. Molecular cloning : a laboratory manual. 2nd, Cold Spring Harbor Laboratory Press. (1989).
  51. Alwine, J. C., Kemp, D. J., Stark, G. R. Method for detection of specific RNAs in agarose gels by transfer to diazobenzyloxymethyl-paper and hybridisation with DNA probes. Proc. Natl. Acad. Sci. USA. 74, 5350-5354 (1977).
  52. Hansen, T. B., et al. Natural RNA circles function as efficient microRNA sponges. Nature. 495, 384-388 (2013).
  53. Flores-Jasso, C. F., Salomon, W. E., Zamore, P. D. Rapid and specific purification of Argonaute-small RNA complexes from crude cell lysates. RNA. 19, 271-279 (2013).
  54. Specchia, V., et al. Hsp90 prevents phenotypic variation by suppressing the mutagenic activity of transposons. Nature. 463, 662-665 (2010).
  55. Várallyay, E., Burgyán, J., Havelda, Z. MicroRNA detection by northern blotting using locked nucleic acid probes. Nat Protoc. 3, 190-196 (2008).
  56. Koscianska, E., Starega-Roslan, J., Czubala, K., Krzyzosiak, W. J. High-resolution northern blot for a reliable analysis of microRNAs and their precursors. ScientificWorldJournal. 11, 102-117 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics