Forbedret Northern Blot detektering af små RNA-art i

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Formålet med denne publikation er at visualisere og diskutere de operative trin i en Enhanced Northern blot protokol om RNA ekstraheret fra Drosophila melanogaster embryoner, celler og væv. Denne protokol er særligt anvendelige til effektiv detektering af små RNA-species.

Cite this Article

Copy Citation | Download Citations

Laneve, P., Giangrande, A. Enhanced Northern Blot Detection of Small RNA Species in Drosophila Melanogaster. J. Vis. Exp. (90), e51814, doi:10.3791/51814 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

De sidste årtier har været vidne til eksplosionen af ​​videnskabelig interesse omkring genekspression kontrolmekanismer på RNA-niveau. Denne gren af ​​molekylær biologi har været stærkt næret af opdagelsen af ​​ikke-kodende RNA som vigtige aktører i posttranskriptionel regulering. Et sådant revolutionært perspektiv er blevet ledsaget og udløst af udviklingen af ​​kraftfulde teknologier til profilering korte RNA'er udtryk, både på højt gennemløb niveau (genom-dækkende identifikation) eller som enkelt-kandidat analyse (steady state ophobning af specifikke arter). Selv om flere state-of-art strategier er i øjeblikket tilgængelig for dosering eller visualisere sådanne flygter molekyler, Northern blot analysen forbliver den berettigede tilgang i molekylær biologi til øjeblikkelig og præcis evaluering af RNA-ekspression. Det udgør et første skridt hen imod anvendelsen af ​​mere avancerede, dyre teknologier og i mange tilfælde, er fortsat en privilegeret metode til nemt at få indsigttil RNA biologi. Her oversigt vi en effektiv protokol (Enhanced Northern blot) til påvisning af svagt udtrykt microRNA (eller andre små regulatoriske RNA arter) fra Drosophila melanogaster hele embryoner manuelt dissekeret larvernes / voksent væv eller in vitro-dyrkede celler. En meget begrænset mængde af RNA er påkrævet, og anvendelse af materiale fra flowcytometri-isolerede celler kan også overvejes.

Introduction

RNA-biokemi har oplevet spektakulære skrider i de sidste år 1. Vores forståelse af RNA potentiale i kontrol af genekspression er brast ved identifikation af kraftige kodende ribo- regulatorer 2, ved opdagelsen af nye RNA-baserede reguleringsmekanismer 3,4 og en dybere karakterisering af allerede kendte posttranskriptionel begivenheder 5. Alle sammen disse undersøgelser har tilladt RNA biologi til dramatisk gøre scenen, bliver et større forskningsprojekt emne i den aktuelle videnskabelige landskab. Især vi i de seneste år får en fornemmelse af den omsiggribende virkninger af "RNA-verden" på molekylær neurobiologi 6, en af de mest dynamiske forskningsområder i det moderne liv videnskab. I det sidste årti af det sidste århundrede, har den overordnede videnskabelige scenarie blevet revolutioneret af opdagelsen af RNA-interferens 7,8 og af de små regulatoriske RNA 9,10navnlig med hensyn til microRNA 11, endogent udtrykte små ikke-kodende RNA impliceret i kontrollen af næsten alle cellulære funktioner som pleiotropiske og kombinatoriske regulatorer af genekspression.

Næsten 10 år efter, at miRNA første opdagelse i Caenorhabditis elegans fra Ambros og Ruvkun labs blev fornyet opmærksomhed vendt til det område, hvor der blev konstateret høje antal af miRNA i Drosophila og i humane celler samt 12-15. Siden da, takket være alsidige transgene metoder har Drosophila melanogaster stod ud som en værdifuld biologisk kontekst for at dykke ned i miRNA biosyntese og aktivitet. Drosophila miRNA har afsløret særskilte funktioner i insekt-specifikke eller evolutionært bevarede processer, der spænder fra aldring til metabolisme, signalveje , adfærd og, selvfølgelig, neurogenese. Langs denne retning, vi for nylig afsløret en hidtil ukendt forbindelse 16 i spændende samarbejderrelation sted mellem master-genet GCM / glide og RNA-vejen. Fluen transskription faktor GCM / Glide 17-19 udgør et enestående eksempel på celle skæbne determinant, som dikterer glial- vs neuronale valg i multipotent flyve neurale forstadier 20. Tyve år lange forskning om dette emne har klart understreget forekomsten af flere og overlappende input af genekspression regulering konvergerende løbet GCM / glide 21-28 at fastslå tærskelværdier, der er nødvendige for at balancere den delikate forhold mellem neuronale og gliale kolleger i løbet af neurale udvikling.

Vi opdagede, at regulering via DMEL-miR279 målretning er en yderligere kontrol, som bidrager til posttranskriptionel finjustering af GCM / glide udtryk 16. Globalt har disse forsknings-linier, der kræves specifikke metodologiske forbedringer: langs år, adskillige teknologier oprindeligt udviklet til at analysere tradtionelle RNA'er er blevet konverteret til kvantificering af små ikke-kodende RNA, ligesom da RNase-beskyttelse assays, cDNA arrays 29-31, real-time PCR-metoder 32-35 og sekvensering 36,37. På den anden side, er kalibrering af tekniske metoder fremmes kontinuerlige skrider på området.

Northern blot assay (NB eller RNA-gel blot assay), udgør et repræsentativt eksempel: Det er i høj grad anvendes til at profilere RNA-ophobning, da det sikrer både udtryk niveau kvantificering samt størrelse beslutsomhed. Imidlertid er den iboende ringe sensitivitet af fremgangsmåden begrænsende, når det skal anvendes til lav-rigelige genekspression fine tunere, ligesom korte RNA'er. En skadelig konsekvens er kravet om store mængder af total RNA, som gør det vanskeligt dens anvendelse i specifikke biologiske prøver. Af disse grunde, specifikke NB varianter for små RNA detektion er blevet udviklet 38-40: vi tog fordel af en forbedret NB procedure 41 (ENB, Enhanced Northern blot), mens belyse ovennævnte samspil mellem DMEL-miR279 og GCM / glid.

Denne metode er baseret på en kemisk tværbindingstrinnet baseret på aktiviteten af ​​et carbodiimid derivat [1-ethyl-3-(3-dimethylaminopropyl) carbodiimid EDC] for at fastsætte nucleinsyre på faste bærere. Carbodiimid er en alsidig tværbinder kendt for at katalysere dannelsen af amidbindinger mellem aktiverede carboxylgrupper eller phosphatgrupper og amingrupper 42. Denne egenskab kan udnyttes til kovalent par små RNA via deres mono-phosphorylerede 5'-hydroxylgruppen til aminogrupper ved overfladen af ​​nylonmembraner. Den resulterende fastgørelse konfiguration forøger tilgængeligheden af den immobiliserede nukleinsyre og igen effektiviteten af probe-mål-hybridisering, hvilket resulterer i en bemærkelsesværdig forøgelse detektion 43.

Teknikken er særlig relevance i Drosophila molekylære undersøgelser, hvorved forekomsten af nye og særprægede klasser af små ikke-kodende RNA er på vej 44. Blandt disse rasiRNAs 45,46 udgør en særlig undertype af piwi-interagerende RNA'er (piRNAs 47), der er involveret i sekvens-specifik gendæmpning. Operative detaljer om denne metode er fuldt beskrevet og visualiseret i det følgende, i forhold til analysen af microRNA'er DMEL-miR279 og DMEL-miR286 og for første gang, på en rasiRNA, rasi4. Vi pressede til ekstremer denne metode, hvilket tillod os at afsløre dårligt udtrykt mål fra minimale mængder af RNA (mindre end 1 ug).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Prøvetagning

  1. Frigør semi-klæbende Schneiders 2 celler, (1-5 x 10 6 celler i gennemsnit), ved pipettering og høste dem ved centrifugering (100 xg i 1 minut). I tilfælde af in vitro dyrkede adhærente celler, Trypsinisér dem standardbetingelser eller direkte indsamle dem fra pladerne i en hensigtsmæssig mængde af RNA-ekstraktion reagens ved hjælp af en celleskraber.
  2. For embryonindsamling vokse Drosophila-stammer i flyve bure og lade embryoner samle sig på æg om plader. Tør embryoner fra ved en pensel i destilleret vand (dH2O), kassere rester af si filtrering, skylles og gendanne embryoner i et hætteglas 48.
  3. Som en alternativ teknik, dissekere væv / organer manuelt. Isoler testikler (en privilegeret system til Pirna analyse) fra Drosophila maven i phosphatbufret saltvand (PBS) under et stereomikroskop (20X forstørrelse), ved hjælp af dissektion nåle eller tang, som overualized i Sullivan m.fl. 49.
  4. Pistil homogenisere prøver ved afhængighed af 0,5 volumener af RNA-ekstraktion reagens.

2. RNA-ekstraktion / Analyse

  1. Efter fabrikantens anvisninger udføre RNA isolation gennem kommercielle reagenser. ADVARSEL! RNA-ekstraktionsmetoder agenter er normalt giftig og ætsende. Alternativt anvende en proteinase K-baseret protokol til RNA-isolering 50, som følger:
    1. Fortyndes prøver til 400 pi Stop Bland og inkuber ved stuetemperatur i 15 min.
    2. Recover vandopløselige komponenter ved standard phenol: chloroform: isoamylalkohol og chloroformekstraktioner og med ethanol (EtOH) bundfældning / vask. Lufttørre prøverne og resuspender i diethylpyrocarbonat (DEPC) -behandlede dobbelt destilleret (dd) H 2 O.
  2. Vurdere RNA-koncentrationen ved UV-spektrofotometrisk måling. Også sikre RNA renheden er høj, tæt på 2,0, Based om A 260 / A 280 læsning.
  3. Tjek RNA-præparat på denaturerende agarosegel som følger:
    1. I et rent bægerglas opløses 1,2 g agarose i 82 ml DEPC-Hedeselskabet 2 O, under konstant omrøring. Kog indtil den er helt opløst.
    2. Lad gelen opløsningen afkøle; når temperaturen når 60 ° C tilsættes 10 ml af 10X 4-morpholinpropansulfonsyre (MOPS) buffer til 1X slutkoncentration (FC), og 8 ml 37% formaldehyd til 3% FC. ADVARSEL! Formaldehyd er kræftfremkaldende.
    3. Hæld gelen i vandret elektroforese celle. Tillad gelen at størkne i et stinkskab i mindst 1 time. Efter størkning Gelen nedsænkes i MOPS 1X.
    4. Alikvot 2 ug af RNA-prøve og 1 ug Ladder (brug en RNA markør, når der nøjagtig evaluering ønskes). Tilsæt 3 volumener agarose påføringsfarvestof (ALD) til RNA og Ladder. Opvarm til 70 ° C i 5 minutter og straks afkøles på is. CAUtion! Indholdet af ALD (ethidiumbromid og formamid, se Materialer) er mutagen og ætsende hhv.
    5. Load prøverne og køre gelen ved 50 V i omkring 1 time med lejlighedsvis buffer genanvendelse. Kontroller RNA fraktionering mønster ved UV visualisering eller gel billeddannelse. Genkende diskrete bånd svarende til 28S og 18S rRNA og tRNA'er (se figur 1).
  4. Fortsæt til Northern analyse eller butik RNA ved -80 ° C.

3. Denatureringen acrylamidgel Fremstilling

  1. Brug en lille lodret elektroforetisk apparat til denne fraktionering trin (pladestørrelse omkring 8 cm x 9 cm, kam tykkelse 0,75 mm).
  2. Saml rene glas sammen i en casting ramme.
  3. Forbered 10 ml 10% acrylamid / bis-acrylamid (19: 1) opløsning i MOPS 1X, 7 M urinstof. Umiddelbart før hælde, tilsættes 100 pi 10% ammoniumpersulfat og 10 pi TEMED og hurtigt blande opløsningen. PAS! Akrylamid er neurotoksisk og kræftfremkaldende.
  4. Hæld gelen mellem glasplader og indsæt godt kam forsigtigt for at undgå bobler. Lad gelen polymerisere ved stuetemperatur i mindst 45 minutter før brug. Alternativt kan gemme gel O / N, pakket ind i vand-gennemblødt filtrerpapirer og forseglet i Saran wrap.

4. Prøveforberedelse

  1. Alikvot 0,5-20 ug af total RNA for hver prøve. Hvis volumen overstiger 3-4 pi, vakuum tørre prøven.
  2. For størrelse beslutsomhed, køre en portion (20-30 CPS) af radioaktivt mærket med lav rækkevidde stige parallelt med prøver, som en markør (se afsnit 4.3 og 4.4 for udarbejdelse). Behandle det parallelt med prøver, som beskrevet i trin 4.5.
  3. Stige: oprette en fosfat fremad reaktion ved hjælp af 0,1 ug af en 10 bp-trappestige. Der inkuberes ved 37 ° C i 30 minutter og reaktionen standse ved tilsætning af ethylendiamintetraeddikesyre (EDTA) til 20 mM FC.
  4. Renses ved EtOH udfældning / vask, lufttørre ogresuspenderes i Hedeselskabet 2 O (ca. 100 ul). ADVARSEL! 32P er en radioaktiv kilde.
  5. Til hver prøve tilsættes et lige volumen af ​​acrylamid blåt farvestof (ABD). Denaturerer ved opvarmning til 80 ° C i 5 min og afkøles på is indtil lastningen. ADVARSEL! Formamide (indhold i ABD) er ætsende.

5. Elektroforetisk Fraktionering

  1. Fjern glaspladerne fra støbning støtte og korrekt samle dem i elektroforese celle. Fyld både indre og ydre kammer med tilstrækkelig Running Buffer (RB).
  2. Fjern forsigtigt kam og pre-run gelen ved 200 V i 10 min. Før isætning af prøver, vaske væk urea indskud fra brøndene ved at sprøjte nogle RB gennem en sprøjte.
  3. Brug flade spidser til omhyggeligt stratificering prøver fra trin 4.5 ved bunden af ​​hver brønd. Kontroller anode og katode-forbindelser for at undgå inverteret drift. Efter at prøverne ind i gelen ved 100 V i 5 minutter, increase spændingen til 200 V.
  4. For en fraktionering længde på omkring 7 cm, en 45 min lange løb er tilstrækkelig. Undgå bromphenolblåt (en tracking pigment i ABD) for at løbe gelen.
  5. Visualisere-gel de fraktionerede lange RNA'er efter ethidiumbromid (EtBr) farvning, som et valgfrit trin:
    1. Skær 2 cm fra toppen af gelen og kortvarigt skylle skive i Hedeselskabet 2 O.
    2. Inkubér gelskiven ved stuetemperatur i 15 minutter med forsigtig shacking i RB EtBr 0,5 ug / ml FC.
    3. Affarves gelen i 15 minutter i RB, visualisere lange rRNA'er ved UV-bestråling eller gel billeddannelse. Check for RNA-lastning og kvalitet (se figur 1, panel 7). FORSIGTIG! Ethidiumbromid er et mutagen.
  6. I mellemtiden fortsæt blotting den nedre del af gelen, der indeholder små RNA arter.

6. Gel Blotting

  1. Klip 6 stykker trækpapir til at passe blotting området, og et tilsvarende stykke af uncharged nylonmembran. Fugt papirark, membran og 2 blotting bolig i RB. Sørg for at helt suge puder ved gentagne gange at presse dem i RB.
  2. Fjern gelen fra apparatet, og åbne glas ved gennemsnit af en spatel. Brug en ren cutter til at fjerne brøndene. Placer et ark af våd Whatman papir på gelen, og løft den forsigtigt op.
  3. Placer nylonmembran af den frie flade af gelen. Markere et hjørne for at orientere filter i henhold til prøve læsning. Gennemfør "sandwich" (3 papir stykker i hver side). Rul en plaststang på blottet overflade, for at fjerne eventuelle luftbobler.
  4. Placer blot mellem to blotting puder og derefter i blotting kassette. Saml kassetten i blotting modulet fylde kammeret med RB og tjek for korrekt orientering (nylon membran skal forblive mellem gelen og den positive endestation).
  5. Overførsel ved 20 V i 20 min. Bemærk: For at sikre ensartede vilkår, efter 10 min åbne blotting modulet og rRoter sandwichen 180 °, før du fuldfører overførslen.

7. Membran Krydsbinding

  1. Forbered 6 ml frisk tværbindingsopløsning (XLS). Mætte en 10 cm x 10 cm (større end nylon membran) stykke trækpapir med XLS. ADVARSEL! HCI (en komponent i XLS) er stærkt ætsende.
  2. Afmonter blot og placere membranen på den våde 3MM filtrerpapir. Bemærk: RNA må ikke være i direkte kontakt med den mættede papir. Filtret og papir mellem to glasplader og wrap i Saran-wrap.
  3. Varm membranen ved 60 ° C i 2 timer, efterfulgt af en Hedeselskabet 2 O vask. Opbevar ved -20 ° C eller fortsæt til hybridisering.

8. Membran Præhybridisering

  1. Hvis RNA-belastning er blevet kontrolleret (valgfrit trin 5.5), direkte videre til hybridisering. Ellers skåret væk 1 cm fra til toppen af ​​nylonfilter at undgå sonde tværs hybridizations til fraktionerede lange RNA'er.
  2. Forvarm 10 ml hybridiseringsopløsning (HS) ved 37 ° C. Denaturer 1 mg laksesperm ved 95 ° C i 5 min, afkøles på is og tilføje HS.
  3. Inkuberes filteret i HS ved 37 ° C i mindst 1 time under rotation i en hybridiseringsovn. Kontroller, at RNA-side af filteret vender HS.

9. probesyntese

  1. Opsætning af en fosfat fremad reaktion på 10 pmol specifik antisenseoligonukleotid, som beskrevet i punkt 4.3.
  2. Tilføj 5 volumener Tris-EDTA-NaCI (TEN) buffer til reaktionsblandingen, og oprense mærket primer fra ikke-inkorporerede nukleotider ved geleksklusionskromatografi på G-25 Sephadex kolonne (eller også af EtOH udfældning). Probe aktivitet kan vurderes ved væskescintillationstæller.

10. Membran hybridisering

  1. Udskift opbrugt HS med en frisk 10 ml portion (fremstillet og suppleret som beskrevet ovenfor). Varm sonden på95 ° C i 10 minutter, afkøles på is og tilføje nye HS. Inkuberes filteret ved 37 ° C ON.

11. Membran Vask

  1. Recover hybridiseringsopløsningen og opbevare det ved -20 ° C i en radioaktivitet-afskærmning kassen.
  2. Filteret skylles i vaskepuffer (WB) og vaskes det grundigt i 10 minutter ved stuetemperatur.
  3. Brug en Geiger Mueller Detektor til kontrol residualradioaktiviteten på filteret hjørner. Når baggrund emissionen er omkring 5 CPS, fortsæt til membran redegørelse.

12. Signalregistrering

  1. Expose filteret autoradiografiundersøgelser film eller på en molekylær imager skærm ON. Reveal signaler ved fotografisk forarbejdning eller digital konvertering.
  2. Analyser båndintensitet ved dedikeret kvantificering software (ImageJ eller Optiquant).

13. Membran Stripping

  1. For at fjerne de primære signaler, nedsænkes membranen i 500 ml kogende Stripping løsning, Derefter inkuberes ved stuetemperatur i 1 min. Fortsæt til romanen (præ) hybridisering eller opbevare filteret ved -20 ° C.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Ved at følge den generelle fremgangsmåde beskrevet i teksten og skematisk i figur 1, vurderede vi små RNA ekspression fra komplekse RNA-prøver fra forskellige oprindelser. I eksperimentet vist i figur 1, blev RNA isoleret fra Drosophila Schneiders 2 celler ved proteinase K udvinding, kontrolleres for integritet (valgfrit trin: denaturerende agarosegel fraktionering) og lagt i dobbelt. Den ene halvdel af gelen blev blottet på en neutral membran og kemisk tværbundet EDC; den anden halvdel blev overført på en positivt ladet nylon filter, så UV-tværbundet (1,2 x 10 5 μJ / cm 2). Den endogene udtryk for to microRNA, der tilhører DMEL-miR279 familie var (DMEL-miR279 selv og DMEL-miR286 15) bekræftet i begge forhold. Den forbedrede procedure (ENB) sørger for højere følsomhed i forhold til den standard, man (SNB).

figur 2 og 3. Den eksperimentelle rationale er den samme som ovenfor: Her rapporterer vi det repræsentativt resultat af Northern Blot autoradiografisk påvisning af Pirna rasi4 langs en ​​titrering af totalt RNA ekstraheret fra voksne flyve testikler. ENB allerede mulighed detektere et bestemt frekvensbånd, når 0,5 ug af RNA er indlæst. Kvantificeringen side viser, hvordan signalet proportionalt stiger med mængden af ​​fraktioneret RNA, hvilket indikerer at dosis / respons-forholdet ligger i lineære område for detektion. Under panelet ratificerer forbedret følsomhed af denne metode i forhold til SNB. I dette tilfælde er et detekterbart signal fås ved elektroforetisk fraktionering af 10 ug af RNA i det mindste for SNB.

Lignende resultater opnås med en anden ikke-kodende RNA-species, fx, 5S rRNA, som rapporteret i figur 3 </ Strong>.

Figur 1
Figur 1. Skematisk repræsentation af den samlede Northern blot procedure. Vigtigste proceduremæssige skridt er opført og progressivt nummererede. Resultaterne er sammenlignet mellem Enhanced Northern blot (ENB) og Standard Northern Blot (SNB), udført i samme betingelser RNA isoleret fra Drosophila Schneiders 2 celler (Panel 1), elektroforese (Panel 2), Overførsel (Panel 3) og hybridisering ( Panel 5). ENB refererer til den forbedrede procedure, der er beskrevet i denne rapport, som kræver et filter med neutral (Panel 3, venstre halvdel af membran) og EDC-baserede krydsbinding (Panel 4), som etablerer en kovalent binding mellem mål-RNA 5'-enden og membran ( lyserøde prikker i Panel 4). I SNB RNA tværbinding opnås ved UV-behandling (panel 4) på ​​en positivt ladet NYLOn membran (panel 3, højre halvdel af membranen). 5s RNA specifikt signal er ikke en kalibrator i sammenlignende vilkår, fordi det reagerer også på forskelle mellem SNB og ENB procedure. Således et beløb (svarende til 10 CPS) af en 5'-mærket (se punkt 4.3 og 4.4 i protokollen), 50 nt lang scrambled oligonukleotid blev tilsat til hver prøve før elektroforese, til at fungere som en "spids i" reference ( Panel 7). Loading kan også vurderes ved på-gel-EtBr-farvning af lange rRNA'er (se punkt 5.5 i protokollen). L = Stige. FV = forfra, LV = Lateral View, HV = Vandret visning. Klik her for at se en større version af dette tal.

Figur 2
Figur 2. Compartiv Northern blot analyse af rasi4 udtryk. endogene niveauer af testiklerne-specifikke Pirna rasi4 er ​​afsløret ved forøget (ENB) eller standard (SNB) Northern blot, udført på stigende mængder af total RNA (angivet ovenfor hver bane), der udvindes fra voksne Drosophila testikler eller fra hele underliv (Abd). For hver metode, histogrammer bort indberette de relative mængder af rasi4 respekt til den samme mængde af en "spids i" lastning kontrol. Kvantificeringer fra de to metoder kombineres i afgørende graf placeret under geler. Klik her for at se en større version af dette tal.

Figur 3
Figur 3. Sammenlignende Northern blot-analyse af 5s rRNA-ekspression. Som en positiv kontrol og eksperimentel kalibrering blev tidligere analyse udvidet til 5s rRNA. Detaljer som i figur 2. Klik her for at se en større version af dette tal.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Selvom vores påskønnelse af sofistikeret sammenflettede hvorigennem RNA regulerer neurogenese er konstant stigende de mekanistiske konsekvenser af RNA-baserede kredsløbssystemer påvirker neurale stamceller biologi, neuronal differentiering / funktionel integration, udvikling af neurale patologier og kræftsygdomme forbliver uudforsket. Opretholdelsen af sådanne net gennem riger gør potentiale genetiske systemer Drosophila melanogaster medvirkende til at udrede uudforskede celleveje, hvor kort-kodende RNA og transkriptionsfaktorer betragtes som store molekylære aktører. I denne visning profileringen af kandidat små RNA-ekspressionsniveauer er propædeutisk til nøjagtige funktionelle analyser: et eksempel kommer fra vores seneste demonstration af, at DMEL-miR279 modulerer GCM / glide skæbne determinant in vivo, opnået gennem en forbedret version af Northern blotting assay som et værktøj til ekspressionsanalyse.

51 NB har været betragtet som en referencemetode til RNA-analyse. På trods af nogle iboende begrænsninger i denne analyse, da den vanskelige omstilling til multiplex format eller mulige fejl med signal kvantificering, har de seneste gennembrud i RNA molekylær biologi genopdaget denne konventionelle teknik som en "hurtig og ren" system til at analysere endogen ekspression af små ribo- syrer eller til validering af effektiviteten af ​​GAIN- eller tab af funktion tilgange. Som paradigmatisk eksempel Northern analyse lægger på grundlag af den oprindelige opdagelse af microRNA, hvorimod den tilgang forbliver på forkant for dets relevans i karakteriseringen af stadigt nye ejendomme regulerende RNA 52.

Den her beskrevne variant er baseret på forøget følsomhed på grund af kemisk tværbinding af RNA. Vi believethe metode er stadig dårligt ansat i Drosophila, But når udnyttes ført til væsentlige opdagelser 52, da det gør det muligt profilering RNA-ekspression fra små prøver (mindre end 1 ug), med en gennemsnitlig 10-30 gange forbedring af RNA måldetektering 41,43, som vi opnåede i vores forhold (Tal 2 og 3).

RNA-integritet udgør et kritisk spørgsmål for at opnå ensartede og reproducerbare resultater. RNA manipulationer kræver præcision og hurtighed til at begrænse eventuel prøve nedbrydning sted mellem udvinding og lastning. På dette formål, alle løsninger skal være diethylpyrocarbonate- (DEPC) behandlet før brug (2 timers inkubation i nærvær af 0,1% DEPC ved 37 ° C og derefter autoklaveres) for at omgå RNase aktivitet. Løsning behandling sikrer bedre resultater i forhold til anvendelse af DEPC vand som opløsningsmiddel. Alt udstyr vil blive lige så skylles i DEPC ddH20, efter rengøring af en RNase-specifik overflade dekontamineringsmiddel.

(f.eks rasi4, Figur 2), eller når RNA-oprensning ikke er udført på friske prøver (for eksempel, konserveret i vævet opbevaring reagenser). Af erfaring, RNA-isolering fra stabiliserede prøver resulterede betydeligt hårdere og krævede mere drastiske ekstraktionsbetingelser. I standardbetingelser, den beskrevne proteinase K-baserede metode sikrer god kvalitet præparater samt, (Et væsentligt eksempel er repræsenteret i Figur 1), men det er ikke det optimale valg for prøver konserveret i opbevaring reagenser.

Endelig, eftersom denne procedure er at små RNA-detektion, dedikeret søjleoprensning-baserede kits kan anvendes til direkte små RNA-isolering, selvom thIS gør sværere at kontrollere RNA-integritet. Som alternativ til den klassiske gel-baserede fremgangsmåde til RNA-integritet kontrol beskrevet ovenfor kan RNA-kvalitet evalueres af instrumenter til on-chip miniaturiserede analyse af nucleinsyre-mønstre.

Buffer Choice: MOPS-NaOH-buffer (pH 7) blev foreslået som en privilegeret buffer til både Enhanced nordlige gelelektroforese og blotting. Vi har også tilfredsstillende anvendes Tris-borat-EDTA (TBE) puffer i vores eksperimenter. I dette tilfælde, da tilstedeværelsen af ​​nucleofile aminogrupper Tris (hydroxymethyl) aminomethan ville hydrolysere og inaktivere DEPC under selve behandlingen, anbefales det at opløse Tris i DEPC-behandlet vand i stedet for behandling af TBE-buffer allerede forberedt.

Elektroforetisk Kør og Blotting: Forløbende gelen er afgørende for at fjerne overskydende Persulfate og eliminere hyperfocusing. Pre-run parametre bør opretholdes også under fraktionering, undgå for hurtigt electrophoRetic løb. Inden lastning, så sørg for at fjerne eventuelle Urea sedimenter fra brønde, ved at sprøjte buffer inde. Dette vil begrænse prøve spill-over og garantier præcis RNA-lagdeling, der producerer løst autoradiografiske bands i løbet af signaler afsløring. Alle neutrale nylonmembran kan anvendes som en støtte for nukleinsyre overførsel. Må ikke skamplet RNA i mere end 20-30 minutter ved de angivne betingelser.

Tværbinding: EDC-baseret kemisk tværbinding repræsenterer den kritiske metodologiske forud for denne forbedrede Northern blot-version. Muligheden for at tværbinde korte RNA-species til neutrale overflader ved kovalente grænser mellem RNA 5'mono-phosphatgruppe og nylon primære aminer forlader størstedelen af ​​baser tilgængelige for hybridisering. Dette øger følsomheden med 10-20xrespect til traditionel tværbinding. Det er afgørende at forberede frisk mængde tværbindingsopløsning for hver blotting i tilstrækkelig mængde til korrekt membran mætning.

Hybridisering og vask: Sonder skal helst være frisk mærkes. Probe specifik aktivitet (afhængig af den specifikke aktivitet og mængden af ​​inkorporeret radiomærket nukleotid og også af mængden af ​​probe til rådighed til hybridisering) bestemmer påvisningsfølsomheden målet. Når [γ- 32P] ATP med en specifik aktivitet på 3000 Ci / mmol anvendes, forventes 10 6 cpm / pmol for 100% mærkning af 5'-enderne.

Hybridiseringsopløsningen kan udvindes og genanvendt, i betragtning, at på grund 32P forfald, sonde aktivitet halvdele i cirka 14 dage.

På grund af membranen neutralitet forventes ved hybridisering lav baggrundsstøj. Hvis strengere vaskebetingelser er nødvendige, gradvis at nedbringe vaskebuffer ionstyrke (op til 0,2 x SSPE) eller tilføje stigende mængder af ioniske detergenter (op til 0,5% SDS), eller øge vasketemperaturen til 37 ° C.

Northern blot-analyse er afgørende, når målingen RNA størrelse er påkrævet. Selvom denne analyse kan mangle nøjagtigheden af ​​fluorescens-baserede qPCR tilgange til estimering af bittesmå RNA, en fordel stammer fra at bruge denatureringen fraktionering / blotting og sonde-afhængige hybridisering som unikke trin før detektion af mål-RNA'er. Derfor åbenbaring af specifikke signaler fra prøven er direkte og kræver ikke nogen yderligere skridt af enzymatisk behandling / konvertering / forstærkning, som ville indebære anvendelse af dedikerede kommercielle kits. RNA-niveauer kan måles og sammenlignes mellem flere prøver på enkelte membraner. Således Northern blot er almindeligt anvendt som en stringent validering qPCR data. Ansporet af særlige eksperimentelle krav er metoden blevet endog forbedret i løbet af de seneste år, både på niveau af følsomhed og opløsning, så begrænset mængde af RNA (se figur 2 og 3) er nødvendige for en vellykket analyse.

Protokollen præsenterede vi kan tilpasses til en bred vifte af applikationer, især hvor materialet findes i begrænsede mængder. Den biologiske kilde til RNA-prøver kan være heterogen: så langt som Drosophila angår, embryoner eller andre udviklingsstadier er egnede, men også manuelt dissekeret væv eller organer, individuelle celler sortering-isolerede cytotypes eller cellekulturer.

Desuden, selv om microRNA er den mest udbredte klasse af korte regulatoriske RNA i cellen og større genstand for en undersøgelse inden for RNA-medieret genekspression kontrol, de ikke ulemper, udgøres den eneste familie af cellulære ikke-kodende RNA. Mange klynger af små RNA fungerer på tværs af kongeriger (f.eks endogene siRNA'er, piRNAs, snoRNAs, plante tasiRNAs) og de ​​fleste af dem er karakteriseret af en fri 5'-terminal (umodificeret), generelt som følge af endo-ribonucleolytic behandling af prækursorer molekyler. Denne funktion er den unikke strukturelle forudsætning strengt nødvendige for anvendelsen af ​​den specifikke forbedret metode baseret på kemisk tværbinding, selv om RNA-størrelse skal betragtes som godt, når længere RNA'er analyseres. I figur 2 rapporterer vi en Northern Blot-analyse forholdsvis detektere niveauet af rasi4 54 et medlem af en klasse af kim-line-specifikke små RNA (Piwi-interagerende RNA eller piRNAs.) Under dårlige og specifikke ekspressionsniveauer, den forbedrede følsomhed af denne metode kan sanktionere gode resultater, især i betragtning af, at den rapporterede protokol kan forbedres yderligere ved kamlingen den med andre praktiske implementeringer allerede er beskrevet i litteraturen 55,56.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

Dette arbejde blev støttet af Institut National de la santé et de la Recherche Médicale, Centre National de la Recherche Scientifique, Université de Strasbourg Hôpital de Strasbourg, Sammenslutningen pour la Recherche sur le Kræft, Institut National du Cancer, Agence Nationale de la Recherche og regionen Alsace.

Pietro LaNeve er blevet støttet af Fondation pour la Recherche Médicale. I øjeblikket er han en modtager af en Istituto Italiano Tecnologia (IIT) fællesskab. Publikationer understøttes af Neurex netværket (TriNeuron - Program Interreg IV Rhin)

Materials

Name Company Catalog Number Comments
FINAL COMPOSITION/NAME COMPANY CATALOGUE (Stock) COMMENTS
GENERAL REQUIREMENT
Centrifuge, 5418 Eppendorf 5418 000.017
Decontaminant, RNase Away Sigma-Aldrich 83931 Apply on glass/plasticware, wipe and rinse
RNase inhibitor, DEPC Sigma-Aldrich D5758 Hazardous //// 1609-47-8
SAMPLE PREPARATION
Stereo Microscope, M60 Leica 
1X PBS Buffer
137 mM NaCl Sigma-Aldrich S3014 7647-14-5  
2.7 mM KCl Sigma-Aldrich P9541 7447-40-7 
10 mM Na2HPO4 Sigma-Aldrich S3264 7558-79-4 
1.8 mM KH2PO4 Sigma-Aldrich P9791 7778-77-0 
RNA EXTRACTION/ANALYSIS
UV-Vis Spectrophotometer Thermo Scientific Nanodrop 2000
Gel Imager, ChemiDoc XRS+ Biorad 170-8265
Horizontal Electrophoresys, Mini-Sub Cell GT BioRad 170-4487EDU
RNA extraction reagent, TRIzol Reagent Life Technologies 15596026 Hazardous
PCA (25:24:1), 1:1 for extraction Sigma-Aldrich 77617 136112-00-0
Chlorophorm, 1:1 for extraction Sigma-Aldrich C2432 67-66-3  
EtOH, 2.5 vol. for precipitation, 70% for washing Sigma-Aldrich 59844 64-17-5 
Gene Ruler 1Kb DNA Ladder Thermo Scientific SM0311
Stop Mix
300 mM NaOAc, pH 5.5 Sigma-Aldrich S2889 127-09-3
1x RSB Solution
2% sodium dodecyl sulfate (SDS) Sigma-Aldrich 71736 Never cool down SDS to avoid  precipitation //// 151-21-3
2 mg/ml Proteinase K Roche Applied Science 0-3115828001 EC 3.4.21.64 9
10X Reticulocyte Standard Buffer (RSB)
100 mM Tris-Cl, pH 7.4 Sigma-Aldrich T5941 1185-53-1  
100 mM NaCl Sigma-Aldrich S3014 7647-14-5  
30 mM MgCl2 Sigma-Aldrich M8266 7786-30-3
Denaturing Agarose Gel
1.2% Agarose Sigma-Aldrich A9539 Let the gel solidify for at least 1 hr //// 9012-36-2
10X MOPS Buffer
0.2 M MOPS sodium salt, pH 7 Sigma-Aldrich M9381 Do not confuse MOPS sodium salt with MOPS //// 71119-22-7
Agarose Loading Dye
1x MOPS Buffer
3% formaldehyde Sigma-Aldrich F8775 Hazardous //// 50-00-0
50% formamide Sigma-Aldrich 47670 Hazardous //// 75-12-7
Ethidium bromide (EtBr) 30 μg/ml Sigma-Aldrich E1510 Hazardous //// 1239-45-8
Bromophenol blue  Sigma-Aldrich B0126 115-39-9 
SMALL RNA FRACTIONATION
Flat gel loading tips Life Technologies LC1002
Savant SpeedVac Concentrator Thermo Scientific  DNA120
Vertical Electrophoresis, Mini-PROTEAN Tetra Cell  Biorad 165-8000
Denaturing Acrylamide Gel
10% acrylamide/bis-acrylamide (19:1) Sigma-Aldrich A3449 Hazardous. Let the gel polymerize for 45 min before use
1x TBE Buffer (or 1x MOPS Buffer)
7 M urea Sigma-Aldrich U6504 57-13-6
0.1% ammonium persulfate Sigma-Aldrich 215589 7727-54-0 
0.1% TEMED Sigma-Aldrich T9281 110-18-9
Gene Ruler Ultra Low Range DNA Ladder (10 bp-step) Thermo Scientific SM1211 Label 0.1 μg, as described in the "probe labeling" reaction
Acrylamide Blue Dye 
50% formamide Sigma-Aldrich 47670 Hazardous //// 75-12-7
Bromophenol blue Sigma-Aldrich B0126 115-39-9 
Running Buffer (RB)
1x MOPS Buffer 
Alternative RB: 1x TBE Buffer
1x TBE Buffer
5X TBE
445 mM Tris-base Sigma-Aldrich T1503 77-86-1 
445 mM boric acid Sigma-Aldrich B7901 10043-35-3
20 mM EDTA Sigma-Aldrich EDS 60-00-4  
Gel Staining Solution
Ethidium bromide 0.5 μg/ml Sigma-Aldrich E1510 Hazardous //// 1239-45-8
1x RB Stain for 15 min with EtBr, destain for 15 min w/o EtBr
BLOTTING
3MM Whatman paper Sigma-Aldrich Z270849
Neutral Nylon Membrane, Hybond NX GE Healthcare Life Science RPN203T Photosensitive
CROSSLINKING
Crosslinking Solution (XLS)
1% 1-methylimidazole (v/v) Sigma-Aldrich 336092 Always prepare a fresh aliquot of XLS //// 616-47-7
12.5 mM HCl Sigma-Aldrich H1758 Hazardous //// 7647-01-0
3.1% EDC (w/v) Sigma-Aldrich 3450 25952-53-8  
(PRE)-HYBRIDIZATION
Liquid Scintillation Counter  Beckmann LS 6500
Sheared Salmon Sperm, 0.1 mg/ml  Life Technologies AM9680
rasi4 anti-sense probe 5' CGGUGUUCGACAGUUCCUCGGG -3'
5s-rRNA anti-sense probe 5'-CAACACGCGGTGTTCCCAAGCCG-3'
Dmel-miR279 anti-sense probe 5'-TTAATGAGTGTGGATCTAGTCA-3'
Dmel-miR286 anti-sense probe 5'-AGCACGAGTGTTCGGTCTAGTCA-3'
Purification Kit, Illustra MicroSpin G-25 Columns GE Healthcare Life Science 27-5325-01
(Pre)-Hybridization Solution (HS)
0.5% SDS Sigma-Aldrich 71736 151-21-3 
5x Denhardt's Solution
20X SSPE
3.6 M NaCl Sigma-Aldrich S3014 7647-14-5  
0.2 M sodium phosphate Sigma-Aldrich 342483 7601-54-9  
20 mM EDTA (pH 8.0) Sigma-Aldrich EDS  60-00-4  
50x Denhardt's Solution
1% Ficoll 400 (w/v) Sigma-Aldrich F2637 26873-85-8
1% Polyvinylpyrrolidone Sigma-Aldrich PVP40 9003-39-8
1% BSA Sigma-Aldrich A7906 9048-46-8  
1X TEN Buffer
10 mM Tris-Cl (pH 8.0) Sigma-Aldrich T1503 77-86-1 
100 mM NaCl Sigma-Aldrich S3014 7647-14-5  
1 mM EDTA (pH 8.0) Sigma-Aldrich EDS 60-00-4  
Probe Labelling
0.4 μM oligonucleotide
1.5 μl Ci/μl [γ-32P] ATP Perkin Elmer NEG002A Hazardous //// 51963-61-2
1x T4 Polynucleotide Kinase Buffer Biolabs B0201
T4 Polynucleotide Kinase 0.5 units/μl Biolabs M0201 EC 2.7.1.78
WASHING
Geiger Mueller Detectors Canberra Industries MCB2/CPS – EM77021
Washing Buffer (WB), 2x SSPE
Stringent Washing Buffers
0.2x SSPE
2x SSPE, 0.5% SDS
0.2x SSPE, 0.5% SDS
SIGNAL DETECTION
PharosFX Plus System Biorad 170-9460
Image J Freely available
Quantity One Biorad
X-ray films , BioMax XAR Sigma-Aldrich F5888 Photosensitive
Developer for X-ray films Sigma-Aldrich P7042
Fixer for X-ray films Sigma-Aldrich P7167
STRIPPING
Stripping Solution
10 mM Tris-HCl pH 8.8 Sigma-Aldrich T1503 77-86-1 
5 mM EDTA Sigma-Aldrich EDS 60-00-4  
0.1% SDS Sigma-Aldrich 71736 Add SDS after boiling to avoid foaming //// 151-21-3

DOWNLOAD MATERIALS LIST

References

  1. The RNA World. Gesteland, R. F., Cech, T. R., Atkins, J. F. 3rd, Cold Spring Harbor Laboratory Press. (2006).
  2. Mercer, T. R., Dinger, M. E., Mattick, J. S. Long non-coding RNAs: insights into functions. Nat Rev Genet. 10, 155-159 (2009).
  3. Salmena, L., Poliseno, L., Tay, Y., Kats, L., Pandolfi, P. P. A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell. 146, 353-358 (2011).
  4. Cesana, M., et al. A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA. Cell. 147, 358-369 (2011).
  5. Orphanides, G., Reinberg, D. A unified theory of gene expression. Cell. 108, 439-451 (2002).
  6. Mehler, M. F., Mattick, J. S. Noncoding RNAs and RNA editing in brain development, functional diversification, and neurological disease. Physiol Rev. 87, 799-823 (2007).
  7. Fire, A., Xu, S., Montgomery, M., Kostas, S., Driver, S., Mello, C. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391, 806-811 (1998).
  8. Hamilton, A., Baulcombe, D. A species of small antisense RNA in posttranscriptional gene silencing in plants. Science. 286, 950-952 (1999).
  9. Lee, R. C., Feinbaum, R. L., Ambros, V. The C. Elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 75, (1993).
  10. Wightman, B., Ha, I., Ruvkun, G. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell. 75, 855-862 (1993).
  11. Fabian, M. R., Sonenberg, N., Filipowicz, W. Regulation of mRNA translation and stability by microRNAs. Annu Rev Biochem. 79, 351-379 (2010).
  12. Pasquinelli, A. E., et al. Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature. 408, 86-89 (2000).
  13. Lagos-Quintana, M., Rauhut, R., Lendeckel, W., Tuschl, T. Identification of novel genes coding for small expressed RNAs. Science. 294, 853-858 (2001).
  14. Lau, N. C., Lim, L. P., Weinstein, E. G., Bartel, D. P. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science. 294, 858-862 (2001).
  15. Lee, R. C., Ambros, V. An extensive class of small RNAs in Caenorhabditis elegans. Science. 294, 862-864 (2001).
  16. Laneve, P., et al. The Gcm/Glide molecular and cellular pathway: new actors and new lineages. Dev Biol. 375, 65-78 (2013).
  17. Hosoya, T., Takizawa, K., Nitta, K., Hotta, Y. Glial cells missing: a binary switch between neuronal and glial determination in Drosophila. Cell. 82, 1025-1036 (1995).
  18. Jones, B. W., Fetter, R. D., Tear, G., Goodman, C. S. Glial cells missing: a genetic switch that controls glial versus neuronal fate. Cell. 82, 1013-1023 (1995).
  19. Vincent, S., Vonesch, J. L., Giangrande, A. Glide directs glial fate commitment and cell fate switch between neurons and glia. Developement. 122, 131-139 (1996).
  20. Cattenoz, P. B., Giangrande, A. Lineage specification in the fly nervous system and evolutionary implications. Cell Cycle. 12, 2753-2759 (2013).
  21. Jones, B. W., Abeysekera, M., Galinska, J., Jolicoeur, E. M. Transcriptional control of glial and blood cell development in Drosophila: cis-regulatory elements of glial cells missing. Dev Biol. 266, 374-387 (2004).
  22. Ragone, G., et al. Transcriptional regulation of glial cell specification. Dev Biol. 255, 138-150 (2003).
  23. Akiyama-Oda, Y., Hosoya, T., Hotta, Y. Asymmetric cell division of thoracic neuroblast 6-4 to bifurcate glial and neuronal lineage in Drosophila. Development. 126, 1967-1974 (1999).
  24. Bernardoni, R., Kammerer, M., Vonesch, J. L., Giangrande, A. Gliogenesis depends on glide/gcm through asymmetric division of neuroglioblasts. Dev Biol. 216, 265-275 (1999).
  25. Ragone, G., Bernardoni, R., Giangrande, A. A novel mode of asymmetric division identifies the fly neuroglioblast 6-4T. Dev Biol. 235, 74-85 (2001).
  26. Soustelle, L., Roy, N., Ragone, G., Giangrande, A. Control of gcm RNA stability is necessary for proper glial cell fate acquisition. Mol Cell Neurosci. 37, 657-662 (2008).
  27. Akiyama, Y., Hosoya, T., Poole, A. M., Hotta, Y. The gcm-motif: a novel DNA-binding motif conserved in Drosophila and mammals. Proc. Natl. Acad. Sci. USA. 25, 14912-14916 (1996).
  28. Miller, A. A., Bernardoni, R., Giangrande, A. Positive autoregulation of the glial promoting factor glide/gcm. EMBO J. 17, 6316-6326 (1998).
  29. Krichevsky, A. M., King, K. S., Donahue, C. P., Khrapko, K., Kosik, K. S. A microRNA array reveals extensive regulation of microRNAs during brain development. RNA. 9, 1274-1281 (2003).
  30. Liu, C. G., et al. An oligonucleotide microchip for genome-wide microRNA profiling in human and mouse tissues. Proc. Natl. Acad. Sci. USA. 101, 9740-9744 (2004).
  31. Yin, J. Q., Zhao, R. C., Morris, K. V. Profiling microRNA expression with microarrays. Trends Biotechnol. 26, 70-76 (2008).
  32. Schmittgen, T. D., Jiang, J., Liu, Q., Yang, L. A high-throughput method to monitor the expression of microRNA precursors. Nucleic Acids Res. 32, E43 (2004).
  33. Chen, C., et al. Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res. 33, e179 (2005).
  34. Shi, R., Chiang, V. L. Facile means for quantifying microRNA expression by real-time PCR. Biotechniques. 39, 519-525 (2005).
  35. Raymond, C. K., Roberts, B. S., Garrett-Engele, P., Lim, L. P., Johnson, J. M. Simple quantitative primer-extension PCR assay for direct monitoring of microRNAs and short-interfering RNAs. RNA. 11, 1737-1744 (2005).
  36. Wang, Z., Gerstein, M., Snyder, M. RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet. 10, 57-63 (2009).
  37. Linsen, S. E., et al. Limitations and possibilities of small RNA digital gene expression profiling. Nat Methods. 6, 474-476 (2009).
  38. Valoczi, A., et al. Sensitive and specific detection of microRNAs by northern blot analysis using LNA-modified oligonucleotide probes. Nucleic Acids Res. 32, e175 (2004).
  39. Varallyay, E., Burgyan, J., Havelda, Z. Detection of microRNAs by Northern blot analyses using LNA probes. Methods. 43, 140-145 (2007).
  40. Kim, S. W., et al. A sensitive non-radioactive northern blot method to detect small RNAs. Nucleic Acids Res. 38, e98 (2010).
  41. Pall, G. S., Hamilton, A. J. Improved northern blot method for enhanced detection of small RNA. Nat Protoc. 3, 1077-1084 (2008).
  42. Hermanson, G. T. Bioconjugate Techniques. 2nd, Academic Press, Inc. (2008).
  43. Pall, G. S., Codony-Servat, C., Byrne, J., Ritchie, L., Hamilton, A. Carbodiimide-mediated cross-linking of RNA to nylon membranes improves the detection of siRNA, miRNA and piRNA by northern blot. Nucleic Acids Res. 35, e60 (2007).
  44. Guzzardo, P. M., Muerdter, F., Hannon, G. J. The piRNA pathway in flies: highlights and future directions. Curr Opin Genet Dev. 23, 44-52 (2013).
  45. Aravin, A. A., et al. Double-stranded RNA-mediated silencing of genomic tandem repeats and transposable elements in the D. melanogaster germline. Curr. Biol. 11, 1017-1027 (2001).
  46. Vagin, V. V., et al. A distinct small RNA pathway silences selfish genetic elements in the germline. Science. 313, 320-324 (2006).
  47. Brennecke, J., et al. Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila. Cell. 128, 1089-1103 (2007).
  48. Sullivan, W., Ashburner, M., Hawley, R. S. Drosophila protocols. Cold Spring Harbor Laboratory Press. (2008).
  49. Zamore, P. D., Ma, S. Isolation of Drosophila melanogaster testes. J. Vis. Exp. (51), e2641 (2011).
  50. Sambrook, J., Fritsch, E. F., Maniatis, T. Molecular cloning : a laboratory manual. 2nd, Cold Spring Harbor Laboratory Press. (1989).
  51. Alwine, J. C., Kemp, D. J., Stark, G. R. Method for detection of specific RNAs in agarose gels by transfer to diazobenzyloxymethyl-paper and hybridisation with DNA probes. Proc. Natl. Acad. Sci. USA. 74, 5350-5354 (1977).
  52. Hansen, T. B., et al. Natural RNA circles function as efficient microRNA sponges. Nature. 495, 384-388 (2013).
  53. Flores-Jasso, C. F., Salomon, W. E., Zamore, P. D. Rapid and specific purification of Argonaute-small RNA complexes from crude cell lysates. RNA. 19, 271-279 (2013).
  54. Specchia, V., et al. Hsp90 prevents phenotypic variation by suppressing the mutagenic activity of transposons. Nature. 463, 662-665 (2010).
  55. Várallyay, E., Burgyán, J., Havelda, Z. MicroRNA detection by northern blotting using locked nucleic acid probes. Nat Protoc. 3, 190-196 (2008).
  56. Koscianska, E., Starega-Roslan, J., Czubala, K., Krzyzosiak, W. J. High-resolution northern blot for a reliable analysis of microRNAs and their precursors. ScientificWorldJournal. 11, 102-117 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics