Mejorada del Norte Blot Detección de los Pequeños ARN Especies en
1Département de Génomique Fonctionnelle et Cancer, Institut de Génétique et de Biologie Moléculaire et Cellulaire, 2Center for Life NanoScience, Istituto Italiano di Tecnologia

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

El objetivo de esta publicación es visualizar y discutir los pasos operativos de un protocolo de transferencia Northern mejorada en el ARN extraído de Drosophila melanogaster embriones, células y tejidos. Este protocolo es particularmente útil para la detección eficiente de pequeñas especies de ARN.

Cite this Article

Copy Citation | Download Citations

Laneve, P., Giangrande, A. Enhanced Northern Blot Detection of Small RNA Species in Drosophila Melanogaster. J. Vis. Exp. (90), e51814, doi:10.3791/51814 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Las últimas décadas han sido testigos de la explosión del interés científico en torno a los mecanismos de control de la expresión génica a nivel de ARN. Esta rama de la biología molecular ha sido impulsado en gran medida por el descubrimiento de los ARN no codificantes como actores importantes en la regulación post-transcripcional. Tal perspectiva revolucionaria ha estado acompañada y provocada por el desarrollo de tecnologías de gran alcance para crear perfiles de expresión de ARN corto, tanto a nivel de alto rendimiento (identificación de todo el genoma) o como análisis de candidato único (acumulación de estado estacionario de las diferentes especies). Aunque varias estrategias estado-de-arte están disponibles actualmente para la dosificación o la visualización de dichas moléculas que huyen, ensayo de transferencia Northern sigue siendo el enfoque elegibles en biología molecular para la evaluación inmediata y precisa de la expresión del ARN. Representa un primer paso hacia la aplicación de las tecnologías más sofisticadas, costosas y, en muchos casos, sigue siendo un método preferencial para ganar fácilmente ideasen la biología de ARN. Aquí repasamos un protocolo eficiente (Enhanced Northern Blot) para detectar microRNAs débilmente expresadas (u otras especies de pequeños ARN de regulación) de Drosophila melanogaster embriones enteros, diseccionó manualmente tejidos / adultos o larvas en células cultivadas in vitro. Se requiere una cantidad muy limitada de ARN y el uso de material de flujo de células aisladas citometría-pueden ser también considerada.

Introduction

ARN bioquímica ha experimentado avances espectaculares en los últimos años 1. Nuestra comprensión de ARN potencial en el control de la expresión génica ha sido estallar por la identificación de potentes reguladores no codificantes ribo-2, por el descubrimiento de nuevos mecanismos de regulación basados ​​en ARN 3,4 y por una caracterización más profunda de eventos post-transcripcional ya conocidos 5. Toda la biología del ARN en conjunto estos estudios han permitido hacer de manera espectacular la escena, convirtiéndose en un importante tema de investigación en el actual panorama científico. En particular, en los últimos años estamos consiguiendo un sentido de los efectos generalizados del "mundo ARN" en la neurobiología molecular 6, uno de los campos de investigación más dinámicas de ciencias de la vida moderna. En la última década del siglo pasado, el escenario científico en general se ha visto revolucionado por el descubrimiento de la interferencia de ARN 7,8 y de los pequeños RNAs reguladores 9,10con especial atención a microRNAs 11, expresado endógenamente pequeños RNAs no codificantes implicadas en el control de casi todas las funciones celulares como reguladores pleiotrópicos y combinatorias de la expresión génica.

Casi 10 años después de miARN descubrimiento inicial en Caenorhabditis elegans por Ambros y laboratorios de Ruvkun, renovada atención se volvió hacia el campo cuando se identificaron un gran número de miRNAs en Drosophila y en las células humanas, así 12-15. Desde entonces, gracias a los métodos transgénicos versátiles, Drosophila melanogaster se ha destacado como un contexto biológico valioso para profundizar en la biosíntesis y la actividad de los genes miARN. Drosophila miRNAs han revelado distintas funciones en los procesos de insectos específicos o conservadas evolutivamente, que abarca desde el envejecimiento para el metabolismo, las vías de señalización , el comportamiento y, por supuesto, la neurogénesis. A lo largo de esta dirección, que recientemente dio a conocer un nuevo enlace de 16 en la co intriganterrelación que ocurre entre el gen maestro gcm / planeo y la vía ARN. El factor de transcripción mosca Gcm / Glide 17-19 constituye un ejemplo único de determinante el destino celular, que dicta la elección destino neuronal glial vs. en multipotentes vuela precursores neuronales 20. Veinte años de larga investigación sobre este tema ha destacado claramente la aparición de múltiples y superpuestas entradas de regulación de la expresión génica que convergen sobre gcm / deslizarse 21-28 para establecer los niveles de umbral necesarios para el equilibrio de la delicada relación entre contrapartes neuronales y gliales durante el desarrollo neural.

Descubrimos que la regulación a través de DMEL-miR279 focalización representa un nivel de control que contribuye a la post-transcripcional puesta a punto de gcm expresión 16 / deslizarse. Mejoras metodológicas específicas Globalmente, estas líneas de investigación se han requeridas: a lo largo de años, varias tecnologías originalmente desarrolladas para analizar tradRNAs itional han sido convertidos para cuantificar pequeños ARN no codificantes, como como ensayos de protección de ARNasa, arrays de cDNA 29-31, en ​​tiempo real los métodos de PCR y secuenciación 32-35 36,37. Por otro lado, la recalibración de los enfoques técnicos ha propiciado avances continuos en el campo.

Northern Blot de ensayo (NB, o ensayo de transferencia de gel de ARN) constituye un ejemplo representativo: se emplea en gran medida al perfil acumulación de ARN, ya que garantiza tanto a nivel de cuantificación expresión, así como la determinación del tamaño. Sin embargo, la intrínseca pobre sensibilidad del método es limitante cuando se va a aplicar a la baja abundancia de la expresión de genes afinadores, como RNAs cortos. Una consecuencia perjudicial es el requisito de grandes cantidades de ARN total, lo que hace difícil su aplicación a muestras biológicas específicas. Por tales razones, variantes NB específicos para la detección de ARN pequeños se han desarrollado 38-40: nos aprovechamos de un proc NB mejoradoedure 41 (ENB, Mejorada del Norte Blot), mientras que la aclaración de la interacción mencionada entre DMEL-miR279 y gcm / planeo.

Este método se basa en una etapa química de reticulación basado en la actividad de un derivado de carbodiimida [1-etil-3-(3-dimetilaminopropil) carbodiimida, EDC] para fijar el ácido nucleico sobre soportes sólidos. Carbodiimida es un reticulante versátil conocido para catalizar la formación de enlaces amida entre carboxilo o fosfato grupos activados y grupos amina 42. Esta propiedad puede ser explotada para par de pequeños RNAs covalentemente a través de su grupo 5'-hidroxilo mono-fosforilado a grupos amino en la superficie de las membranas de nylon. La configuración de fijación resultante aumenta la accesibilidad del ácido nucleico inmovilizado y, a su vez, la eficiencia de la hibridación sonda-diana, lo que resulta en la mejora de la detección notable 43.

La técnica adquiere una especial relevance en Drosophila estudios moleculares, por el cual la ocurrencia de clases novedosas y distintivas de los pequeños RNAs no codificantes está emergiendo 44. Entre estos, 45,46 rasiRNAs constituyen un subtipo específico de ARN Piwi-interactuar piRNAs (47), que participan en la secuencia específica de silenciamiento génico. Detalles operativos de este método se describen completamente y se visualizaron en lo sucesivo, en relación con el análisis de la microRNAs DMEL-miR279 y miR286 DMEL-y, por primera vez, de una rasiRNA, rasi4. Empujamos a los extremos este método, lo que nos permitió revelar objetivos mal expresados ​​a partir de cantidades mínimas de ARN (menos de 1 mg).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Sample Collection

  1. Separe 2 células semi-adherente de Schneider, (1.5 x 10 6 células por término medio), con la pipeta y cosecharlas por centrifugación (100 xg durante 1 min). En el caso de las células adherentes cultivadas in vitro, trypsinize en condiciones estándar o directamente a partir de placas recogerlas en una cantidad conveniente de reactivo de extracción de ARN, con la ayuda de un rascador de células.
  2. Para la recogida de embriones, crecer cepas de Drosophila en jaulas de moscas y deja embriones se acumulan en las placas de puesta de huevos. Limpie los embriones fuera por un pincel en agua destilada (DH 2 O), desechar los residuos por el tamiz de filtrado, enjuague y recuperar los embriones en un vial 48.
  3. Como una técnica alternativa, diseccionar manualmente tejidos / órganos. Aislar testículos (un sistema preferencial para el análisis piRNA) de Drosophila abdomen en solución salina tamponada con fosfato (PBS) bajo un estereomicroscopio (aumento 20X), mediante el uso de agujas de disección o fórceps como visdividualizado en Sullivan et al 49.
  4. Maja homogeneizar muestras sobre la adicción de 0,5 volúmenes de reactivo de extracción de RNA.

2. Extracción de ARN / Análisis

  1. Siguiendo las instrucciones de los fabricantes realizan el aislamiento de ARN a través de reactivos comerciales. PRECAUCIÓN! Agentes de extracción de ARN suelen ser tóxicos y cáusticos. Alternativamente, aplicar un protocolo basado en proteinasa K para el aislamiento de ARN 50, como sigue:
    1. Diluir las muestras en 400 l de parada Mezclar e incubar a TA durante 15 min.
    2. Recuperar componentes hidrosolubles por estándar de fenol: cloroformo: alcohol isoamílico y cloroformo extracciones y por etanol (EtOH) Precipitación / lavado. Aire secar las muestras y volver a suspender en dietilpirocarbonato (DEPC) tratados con doble destilado (dd) H 2 O.
  2. Evaluar la concentración de ARN mediante medición espectrofotométrica UV. También garantizar la pureza del ARN es alto, cerca de 2.0, based en A 260 / A 280 lectura.
  3. Compruebe preparación de ARN en gel desnaturalizante de agarosa como sigue:
    1. En un vaso de precipitados limpio, disolver 1,2 g de agarosa en 82 ml de DEPC-ddH 2 O, bajo agitación continua. Hervir hasta que se disuelva por completo.
    2. Deje que la solución de gel se enfríe; cuando la temperatura alcanza los 60 ° C Añadir 10 ml de ácido 4-10X morfolinopropanosulfónico (MOPS) buffer de 1X concentración final (FC), y 8 ml de formaldehído al 37% al 3% FC. PRECAUCIÓN! El formaldehído es un carcinógeno.
    3. Verter el gel en una célula de electroforesis horizontal. Deje que el gel se solidifique en una campana durante al menos 1 hora. Después de la solidificación, sumergir el gel en MOPS 1X.
    4. Alícuota 2 g de muestra de ARN y 1 g de Escalera (utilice un marcador de ARN cuando se desea una evaluación precisa). Añadir 3 volúmenes de carga de tintes de agarosa (ALD) para ARN y para escalera. Calentar a 70 ° C durante 5 min e inmediatamente enfriar en hielo. CAUCIÓN! Contenido de ALD (bromuro de etidio y formamida, ver Materiales) son mutágenas y corrosivo, respectivamente.
    5. Cargar las muestras y correr el gel a 50 V durante aproximadamente 1 hora con el reciclaje tampón ocasional. Compruebe el patrón de ARN fraccionamiento mediante visualización UV o de imágenes de gel. Reconocer bandas discretas correspondientes a 28S y 18S ARNr y al ARNt (véase la Figura 1).
  4. Continúe con el Ensayo del Norte o tienda de ARN a -80 ° C.

3. desnaturalización acrilamida Preparación del gel

  1. Use un pequeño aparato vertical de electroforesis para esta etapa de fraccionamiento (tamaño de la placa alrededor de 8 cm x 9 cm, peine espesor 0,75 mm).
  2. Ensamble vasos limpios juntos en una estructura de fundición.
  3. Preparar 10 ml de 10% de acrilamida / bis-acrilamida (19: 1) solución en MOPS 1X, 7 M de urea. Inmediatamente antes de verter, añadir 100 l de persulfato de amonio al 10% y 10 l de TEMED y mezclar rápidamente la solución. PRECAUCIÓN! Acrilamida es neurotóxica y carcinógeno.
  4. Verter el gel entre placas de vidrio e insertar el peine bien cuidado para evitar burbujas. Deje que el gel se polimeriza a temperatura ambiente durante al menos 45 minutos antes de su uso. Alternativamente, guarde el gel S / N, envuelto en papel de filtro empapado con el agua y sellado en papel film.

Preparación 4. Muestra

  1. Alícuota de 0,5-20 g de ARN total para cada muestra. Si el volumen es superior a 4.3 l, de vacío seque la muestra.
  2. Para la determinación del tamaño, ejecutar una alícuota (20-30 cps) de la escala de rango bajo radiomarcado en paralelo a las muestras, como un marcador (ver sección 4.3 y 4.4 para la preparación). Tratarlo en paralelo a las muestras, como se describe en el paso 4.5.
  3. Escalera: creó una reacción directa de fosfato utilizando 0,1 g de una escalera de 10 pb a paso. Incubar a 37 ° C durante 30 min y detener la reacción mediante la adición de ácido etilendiaminotetraacético (EDTA) a 20 mM FC.
  4. Se purifica por precipitación con EtOH / lavado, secar al aire yresuspender en ddH2O (100 l). PRECAUCIÓN! 32P es una fuente radiactiva.
  5. Para cada muestra de añadir un volumen igual de colorante azul acrilamida (ABD). Desnaturaliza por calentamiento a 80 ° C durante 5 minutos y enfriar en hielo hasta su embarque. PRECAUCIÓN! Formamida (contenido en ABD) es corrosivo.

5. electroforética Fraccionamiento

  1. Retire las placas de vidrio del soporte de fundición y ensamblarlos correctamente en la célula de electroforesis. Llenar ambos cámara interior y exterior con suficiente tampón de desarrollo (RB).
  2. Retire suavemente el peine y pre-correr el gel a 200 V durante 10 min. Antes de cargar las muestras, lavar los depósitos de urea de los pozos por chorrear algún RB a través de una jeringa.
  3. Utilice puntas planas para estratificar cuidadosamente las muestras procedentes de la etapa 4.5 en la parte inferior de cada pocillo. Revise las conexiones de ánodo y cátodo para evitar correr invertida. Después de que las muestras de entrar en el gel a 100 V durante 5 min, iaumentar la cant voltaje a 200 V.
  4. Para una longitud de fraccionamiento de unos 7 cm, a 45 min-largo plazo es suficiente. Evite el azul de bromofenol (un pigmento de seguimiento en ABD) para desbordar el gel.
  5. Visualizar en gel los ARNs largos fraccionados por bromuro de etidio (EtBr) tinción, como un paso opcional:
    1. Cortar 2 cm desde la parte superior del gel y enjuague brevemente la rebanada en ddH 2 O.
    2. Incubar la rebanada de gel a temperatura ambiente durante 15 min con shacking suave en RB, EtBr 0,5 g / ml FC.
    3. Destain el gel durante 15 min en RB, visualizar largos rRNAs por irradiación UV o formación de imágenes de gel. Compruebe si hay carga de ARN y la calidad (véase la Figura 1, Panel 7). ATENCIÓN! El bromuro de etidio es un mutágeno.
  6. Mientras tanto proceder secante la parte inferior del gel que contiene pequeñas especies de ARN.

6. Gel Secante

  1. Cortar 6 trozos de papel secante para ajustarse al área secante y una pieza equivalente de uncharged membrana de nylon. Humedecer las hojas de papel, membrana y 2 almohadillas de transferencia en RB. Asegúrese de absorber completamente las almohadillas apretando repetidamente en RB.
  2. Retire el gel del aparato y abrir los vasos por medio de una espátula. Utilice un cortador de limpia para eliminar los pozos. Coloque una hoja de papel Whatman húmedo en el gel y suavemente levántela.
  3. Coloque la membrana de nylon en la cara libre del gel. Marque una esquina para orientar el filtro de acuerdo con la carga de la muestra. Completa el "sandwich" (3 pedazos de papel a cada lado). Rollo de una varilla de plástico en la superficie de transferencia, para eliminar las posibles burbujas de aire.
  4. Coloque la mancha entre dos almohadillas de transferencia y luego en el casete secante. Monte el casete en el módulo secante, llenar la cámara con RB y comprobar la orientación correcta (membrana de nylon debe permanecer entre el gel y el terminal positivo).
  5. Transferir a 20 V durante 20 min. Nota: para garantizar condiciones homogéneas, después de 10 min abrir el módulo secante y rOtate el sándwich por 180 ° antes de completar la transferencia.

7. Membrana reticulación

  1. Preparar 6 ml de solución de reticulación fresco (XLS). Saturar a 10 cm x 10 cm (más grande que la membrana de nylon) trozo de papel secante con XLS. PRECAUCIÓN! HCl (un componente de XLS) es altamente corrosivo.
  2. Desmontar el blot y colocar la membrana sobre el papel de filtro 3MM mojado. Nota: ARN no debe estar en contacto directo con el papel saturado. Coloque el filtro y papel entre dos placas de vidrio y se envuelve en saran-wrap.
  3. Calentar la membrana a 60 ° C durante 2 horas, seguido de un lavado de ddH2O. Almacenar a -20 ° C o proceder a la hibridación.

8. Membrana Prehibridación

  1. Si la carga de ARN se ha comprobado (paso opcional 5.5), vaya directamente a la hibridación. O bien, corte 1 cm de la parte superior del filtro de nylon, para evitar sonda transversal hybridizations a RNAs largos fraccionada.
  2. Precaliente 10 ml de disolución de hibridación (SA) a 37 ° C. Desnaturalizar 1 mg de esperma de salmón a 95 º C durante 5 minutos, enfriar en hielo y añadir a HS.
  3. Incubar el filtro en el SA a 37 ° C durante al menos 1 hora, bajo la rotación en un horno de hibridación. Compruebe que el lado de ARN del filtro enfrenta SA.

9. Síntesis de Sonda

  1. Configurar una reacción directa de fosfato en 10 pmol de oligonucleótido antisentido específico, como se describe en 4.3.
  2. Añadir 5 volúmenes de Tris-EDTA-NaCl (TEN) tampón para la reacción y purificar el cebador marcado los nucleótidos no incorporados mediante cromatografía de exclusión en gel en columnas de Sephadex G-25 (o también por precipitación con EtOH). La actividad de la sonda se puede evaluar mediante contador de centelleo líquido.

10. Membrana de hibridación

  1. Vuelva a colocar el agotado HS con un fresco 10 ml alícuota (preparada y complementado como se describió anteriormente). Calentar la sonda en95 ° C durante 10 minutos, enfriar en hielo y añadir a la novela del SA. Incubar el filtro a 37 ° C ON.

11. Membrana Lavado

  1. Recuperar la solución de hibridación y almacenarla a -20 ° C en una caja de radiactividad-blindaje.
  2. Enjuague el filtro con tampón de lavado (BM) y lavar a fondo durante 10 minutos a temperatura ambiente.
  3. Utilice un detector Geiger Mueller para el control de la radiactividad residual en las esquinas de filtro. Cuando emisión de fondo es de alrededor de 5 cps, proceder a la membrana exposición.

12 Detección de la señal

  1. Exponer el filtro en las películas de autorradiografía o en una pantalla de Encendido de imágenes moleculares. Revelar señales de procesamiento fotográfico o la conversión digital.
  2. Analizar la intensidad de la banda por el software de cuantificación dedicado (ImageJ o Optiquant).

13. Membrana Stripping

  1. Para eliminar señales primarias, sumergir la membrana en 500 ml de solución de reextracción hirviendo, A continuación incubar a TA durante 1 min. Proceda a la novela (pre) hibridación o almacenar el filtro a -20 ° C.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Siguiendo el procedimiento general descrito en el texto y esquemáticamente representado en la Figura 1, se evaluó la expresión de ARNs pequeños de muestras de ARN complejas de diferentes orígenes. En el experimento presentado en la Figura 1, se aisló ARN a partir de 2 células de Drosophila Schneider por extracción con proteinasa K, controladas por la integridad (paso opcional: desnaturalización fraccionamiento en gel de agarosa) y se cargó en doble. Una media de gel se transfirió sobre una membrana neutra y químicamente reticulado por EDC; el segundo medio se transfirió sobre un filtro de nylon cargada positivamente, entonces reticulado-UV (1,2 x 10 5 mu J / cm 2). La expresión endógena de dos microRNAs pertenecientes a la familia DMEL-miR279 (sí DMEL-miR279 y miR286 DMEL-15) se verificó en ambas condiciones. El procedimiento mejorado (ENB) garantiza una mayor sensibilidad respecto al estándar (SNB).

las figuras 2 y 3. La justificación experimental es el mismo que el anterior: aquí reportamos el resultado representativo de detección autorradiográfica transferencia Northern del rasi4 piRNA lo largo de una titulación de ARN total extraído de mosca adulta testículos. ENB ya permite la detección de una banda específica cuando se carga de 0,5 g de ARN. La cuantificación de lado muestra cómo la señal aumenta proporcionalmente con la cantidad de ARN fraccionado, lo que indica que la relación dosis / respuesta se encuentra en el rango lineal de detección. El panel de abajo ratifica la mejora de la sensibilidad de este método en comparación con el SNB. En este caso, se obtiene una señal detectable en el fraccionamiento electroforético de 10 g de ARN al menos por el SNB.

Se obtienen resultados similares con diferentes especies de ARN no codificante, por ejemplo, 5S rRNA, como se informa en la Figura 3 </ Strong>.

Figura 1
Figura 1: Representación esquemática del procedimiento general de transferencia Northern. Principales medidas de procedimiento se enumeran y numeradas progresivamente. Los resultados se compararon entre el Blot mejorada del Norte (ENB) y Standard Northern Blot (SNB), realizado en igualdad de condiciones: el aislamiento de ARN a partir de 2 células de Drosophila Schneider (Panel 1), electroforesis (Grupo 2), transferencia (Panel 3) y la hibridación ( Panel 5). ENB se refiere al procedimiento mejorado descrito en este informe, lo que requiere un filtro neutro (Panel 3, la mitad izquierda de la membrana) y de reticulación basado en EDC (Grupo 4), que establece una unión covalente entre el ARN diana extremo 5 'y la membrana ( puntos rosados ​​en el Panel 4). En SNB, ARN reticulación se obtiene por tratamiento UV (Panel 4) en una carga positiva nylon de la membrana (Panel 3, la mitad derecha de la membrana). Señal específica 5s ARN no es un calibrador en condiciones comparativas, porque también responde a las diferencias entre SNB y el procedimiento del BNT. Por lo tanto, una cantidad (que corresponde a 10 cps) de un marcado 5 '(véanse los puntos 4.3 y 4.4 del protocolo), 50 nt oligonucleótido largo revueltos se añadió a cada muestra antes de la electroforesis, para funcionar como un "pico de" referencia ( Panel 7). La carga puede ser también evaluada por tinción EtBr en gel de rRNAs largos (véase el punto 5.5 del protocolo). L = Escalera. FV = Frontal View, LV = Lateral View, HV = Horizontal Vista. Haga clic aquí para ver una versión más grande de esta figura.

Figura 2
Figura 2. Comparanálisis ativa transferencia Northern de la expresión rasi4. niveles endógenos de la piRNA rasi4 prueba específica se revelan por mayor (ENB) o estándar (SNB) Northern Blot, realizado en el aumento de cantidades de ARN total (indicado por encima de cada carril) extraído de adultos testículos Drosophila , o de abdomen enteros (Abd). Para cada metodología, histogramas lado reportar las cantidades relativas de respeto rasi4 a la misma cantidad de un "pico de" control de carga. Cuantificaciones de los dos métodos se combinan en el gráfico concluyente colocado por debajo de los geles. Por favor haga clic aquí para ver una versión más grande de esta figura.

Figura 3
Figura 3. análisis comparativo de transferencia Northern de 5s rLa expresión del ARN. Como control positivo y calibración experimental, el análisis anterior se extendió a 5S rRNA. Detalles como en la Figura 2. Haga clic aquí para ver una versión más grande de esta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Aunque nuestra apreciación de la sofisticada entrelazando a través del cual el ARN regula la neurogénesis está aumentando continuamente, las implicaciones mecanicistas de circuiterías basados ​​en ARN que afectan a los nervios biología de células madre, diferenciación neuronal / integración funcional, el desarrollo de las patologías neuronales y cánceres permanecen sin explorar. El mantenimiento de este tipo de redes a través de reinos hace que el potencial de los sistemas genéticos como Drosophila melanogaster fundamental para desentrañar las vías celulares inexploradas, en las que los ARN no codificantes corto y factores de transcripción son considerados como los principales actores moleculares. En este punto de vista, la elaboración de perfiles de los pequeños niveles de expresión de ARN candidatos es propedéutica para análisis funcionales precisos: un ejemplo viene de nuestra reciente demostración de que DMEL-miR279 modula el destino determinante gcm / glide in vivo, logrado a través de una versión mejorada del ensayo de transferencia Northern como una herramienta para el análisis de la expresión.

51, NB ha sido considerada como un método de referencia para el análisis de ARN. A pesar de algunas limitaciones intrínsecas de este ensayo, como la conversión difícil para multiplexar formato o posibles errores en la cuantificación de la señal, los recientes avances en la biología molecular de ARN han redescubierto esta técnica convencional como un sistema "rápido y limpio" para ensayar la expresión endógena de pequeña ribonucleico ácidos o para validar la eficacia de ganancia-o enfoques de pérdida de función. Como ejemplo paradigmático, el análisis del Norte pone en la base del descubrimiento original de microRNAs, mientras que el enfoque se mantiene a la vanguardia por su relevancia en la caracterización de cada vez nuevas propiedades de ARN regulador 52.

La variante descrita aquí se basa en una mayor sensibilidad debido a la reticulación química del ARN. Nos believethe método es todavía poco empleados en Drosophila, but cuando explotados condujo a descubrimientos significativos 52, ya que hace posible la expresión de ARN de perfiles de muestras pequeñas (menos de 1 g), con un promedio de 10-30 veces de mejora de la detección de ARN diana 41,43, como hemos obtenido en nuestras condiciones (Figuras 2 y 3).

La integridad del ARN constituye un problema crítico para obtener resultados consistentes y reproducibles. Manipulaciones de ARN requieren precisión y rapidez para limitar la posible degradación de la muestra que se produce entre la extracción y la carga. En esta finalidad, todas las soluciones tienen que ser diethylpyrocarbonate- (DEPC) tratados antes de su uso (incubación de 2 h en presencia de 0,1% DEPC a 37 ° C y luego esterilizado en autoclave) para eludir la actividad de RNasa. Tratamiento de la solución garantiza mejores resultados respecto a la utilización de agua DEPC como disolvente. Todo el equipo será igualmente lavarse con DEPC ddH20, después de la limpieza por un descontaminante superficial-RNasa específica.

(por ejemplo, rasi4, Figura 2) o cuando purificación de ARN no se realiza en muestras frescas (por ejemplo, conservado en almacenamiento de tejidos reactivos). Por experiencia, el aislamiento de ARN a partir de muestras estabilizadas resultó significativamente más dura y requiere condiciones de extracción más drásticas. En condiciones normales, el método basado en proteinasa K descrito garantiza preparaciones de buena calidad, así, (un ejemplo significativo está representado en Figura 1), pero no es la elección óptima para muestras conservadas en los reactivos de almacenamiento.

Finalmente, puesto que este procedimiento tiene como objetivo la detección específica de ARN pequeño, kits de purificación basado-columna dedicada se pueden emplear para el aislamiento directo de ARN pequeño, aunque ªes decir hace más difícil para verificar la integridad del ARN. En alternativa al procedimiento a base de gel clásico para el control de la integridad del ARN se ha descrito anteriormente, la calidad del ARN puede ser evaluada por los instrumentos para el análisis en chip miniaturizado de patrones de ácidos nucleicos.

Buffer Elección: MOPS-NaOH (pH 7) se propuso como un amortiguador preferencial tanto para electroforesis en gel Norte mejorada y transferencia. También se utilizó satisfactoriamente-EDTA Tris-borato de tampón (TBE) en nuestros experimentos. En este caso, ya que la presencia de grupos amino nucleófilos de Tris (hidroximetil) aminometano sería hidrolizar e inactivar DEPC durante el tratamiento en sí, se recomienda la disolución de Tris en agua tratada con DEPC en lugar de tratar tampón TBE ya preparado.

Electroforética Run y ​​Blotting: Pre-correr el gel es esencial para eliminar el exceso de persulfato y eliminando hyperfocusing. Parámetros Pre-ejecución deben mantenerse también durante el fraccionamiento, evitando electropho demasiado rápidorun retic. Antes de cargar, asegúrese de eliminar posibles sedimentos de urea de los pozos, por chorros de búfer en el interior. Esto limitará la muestra spill-over y garantías estratificación ARN precisa, produciendo bandas autorradiográficos resueltos durante la detección de señales. Cualquier membrana de nylon neutro se puede utilizar como un soporte para la transferencia de ácido nucleico. No seque la ARN durante más de 20-30 minutos en las condiciones especificadas.

La reticulación: reticulación química a base de EDC representa el avance metodológico crítico de esta versión mejorada de transferencia de Northern. La posibilidad para reticular especies de ARN corto a superficies neutras por los límites covalentes entre el grupo de ARN 5'mono-fosfato y de nylon aminas primarias hojas de la mayoría de las bases disponibles para la hibridación. Esto mejora la sensibilidad a la reticulación por 10-20xrespect tradicional. Es crucial para preparar nueva cantidad de solución de reticulación para cada transferencia, en cantidad suficiente para la saturación de la membrana adecuada.

Hibridación y lavado: Las sondas deben estar recién etiquetados preferiblemente. Sonda actividad específica (dependiendo de la actividad específica y la cantidad de nucleótido radiomarcado incorporado y también en la cantidad de sonda para la hibridación disponible) determina la sensibilidad de detección del objetivo. Cuando [γ- 32 P] ATP se utiliza con una actividad específica de 3000 Ci / mmol, se espera que 10 6 cpm / pmol de 100% el etiquetado de los 5 'termina.

La solución de hibridación se puede recuperar y volver a utilizar, teniendo en cuenta que, debido a la descomposición P 32, las mitades de la actividad de la sonda en aproximadamente 14 días.

Debido a la neutralidad de la membrana, se espera que bajo ruido de fondo en la hibridación. Si se requieren condiciones de lavado más rigurosas, progresivamente reducir la fuerza iónica de tampón de lavado (hasta 0,2 x SSPE) o añadir cantidades crecientes de detergentes iónicos (hasta 0,5% de SDS) o elevar la temperatura de lavado a 37 ° C.

Norte blot es esencial cuando se requiere la medición del tamaño de ARN. A pesar de que este ensayo puede carecer de la exactitud de qPCR basado en la fluorescencia se acerca para la estimación de pequeños RNAs, una ventaja deriva de fraccionamiento usando desnaturalización / hibridación de la sonda secante y dependiente como pasos único antes de la detección de ARN diana. Por consiguiente, la revelación de las señales específicas de la muestra es directa y no requiere ningún paso adicional de tratamiento enzimático / conversión / amplificación, lo que implicaría el uso de kits comerciales dedicadas. Los niveles de ARN pueden ser cuantificados y comparados entre múltiples muestras en las membranas individuales. Así Northeblot rn se emplea comúnmente como una validación rigurosa de los datos qPCR. Impulsados ​​por las necesidades experimentales específicos, el método ha sido incluso mejorado durante los últimos años, tanto a nivel de sensibilidad y resolución para que cantidad limitada de ARN (ver figuras 2 y 3) se requiere para el éxito del análisis.

El protocolo que presentamos se puede adaptar a una amplia gama de aplicaciones, especialmente donde el material está disponible en cantidades limitadas. La fuente biológica de muestras de ARN pueden ser heterogéneas: por lo que se refiere a Drosophila, embriones u otras etapas de desarrollo son adecuados, pero también tejidos u órganos disecados manualmente, las células individuales de clasificación-aislado citotipos o cultivos celulares.

Por otra parte, a pesar de que los microRNAs son la clase más abundante de ARN regulador cortas en la celda y los temas principales de la investigación en el campo de control de la expresión génica mediada por RNA, que no constituto la única familia de los ARN no codificantes celulares. Muchos grupos de pequeños RNAs funcionan a través de reinos (por ejemplo, siRNAs endógenos, piRNAs, snoRNAs, planta tasiRNAs) y la mayoría de ellos se caracterizan a partir de una 'terminal libre 5 (sin modificar), generalmente se derivan de la transformación-endo ribonucleolítica de precursores de moléculas. Esta característica constituye el requisito estructural único estrictamente necesario para la aplicación de la metodología mejorada específico basado en la reticulación química, a pesar de que el tamaño de ARN tiene que ser considerado, así, cuando se analizan los ARN más largas. En la figura 2 se presenta un análisis de transferencia Northern comparativamente detectar los niveles de rasi4 54 un miembro de una clase de la línea germinal específica pequeños RNAs (ARN o piRNAs Piwi-interactuando.) En las condiciones de los niveles de expresión pobres y específicos, la mayor sensibilidad de este método puede sancionar resultados exitosos, especialmente teniendo en cuenta que el protocolo reportado se puede mejorar aún más por el peinenando con otras implementaciones prácticas ya descritos en la literatura 55,56.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

Este trabajo fue apoyado por el Institut National de la Santé et de la Recherche Medicale, el Centre National de la Recherche Scientifique, la Universidad de Estrasburgo, el Hôpital de Estrasburgo, la Asociación pour la Recherche sur le Cáncer, el Institut National du Cancer, la Agence Nationale de la Recherche y la región de Alsacia.

Pietro Laneve ha recibido el apoyo de la Fondation pour la Recherche Médicale. Actualmente, es un receptor de un Istituto Italiano Tecnologia (IIT) de becas. Costos de publicación son apoyados por la red Neurex (TriNeuron - Programa Interreg IV Alto Rin)

Materials

Name Company Catalog Number Comments
FINAL COMPOSITION/NAME COMPANY CATALOGUE (Stock) COMMENTS
GENERAL REQUIREMENT
Centrifuge, 5418 Eppendorf 5418 000.017
Decontaminant, RNase Away Sigma-Aldrich 83931 Apply on glass/plasticware, wipe and rinse
RNase inhibitor, DEPC Sigma-Aldrich D5758 Hazardous //// 1609-47-8
SAMPLE PREPARATION
Stereo Microscope, M60 Leica 
1X PBS Buffer
137 mM NaCl Sigma-Aldrich S3014 7647-14-5  
2.7 mM KCl Sigma-Aldrich P9541 7447-40-7 
10 mM Na2HPO4 Sigma-Aldrich S3264 7558-79-4 
1.8 mM KH2PO4 Sigma-Aldrich P9791 7778-77-0 
RNA EXTRACTION/ANALYSIS
UV-Vis Spectrophotometer Thermo Scientific Nanodrop 2000
Gel Imager, ChemiDoc XRS+ Biorad 170-8265
Horizontal Electrophoresys, Mini-Sub Cell GT BioRad 170-4487EDU
RNA extraction reagent, TRIzol Reagent Life Technologies 15596026 Hazardous
PCA (25:24:1), 1:1 for extraction Sigma-Aldrich 77617 136112-00-0
Chlorophorm, 1:1 for extraction Sigma-Aldrich C2432 67-66-3  
EtOH, 2.5 vol. for precipitation, 70% for washing Sigma-Aldrich 59844 64-17-5 
Gene Ruler 1Kb DNA Ladder Thermo Scientific SM0311
Stop Mix
300 mM NaOAc, pH 5.5 Sigma-Aldrich S2889 127-09-3
1x RSB Solution
2% sodium dodecyl sulfate (SDS) Sigma-Aldrich 71736 Never cool down SDS to avoid  precipitation //// 151-21-3
2 mg/ml Proteinase K Roche Applied Science 0-3115828001 EC 3.4.21.64 9
10X Reticulocyte Standard Buffer (RSB)
100 mM Tris-Cl, pH 7.4 Sigma-Aldrich T5941 1185-53-1  
100 mM NaCl Sigma-Aldrich S3014 7647-14-5  
30 mM MgCl2 Sigma-Aldrich M8266 7786-30-3
Denaturing Agarose Gel
1.2% Agarose Sigma-Aldrich A9539 Let the gel solidify for at least 1 hr //// 9012-36-2
10X MOPS Buffer
0.2 M MOPS sodium salt, pH 7 Sigma-Aldrich M9381 Do not confuse MOPS sodium salt with MOPS //// 71119-22-7
Agarose Loading Dye
1x MOPS Buffer
3% formaldehyde Sigma-Aldrich F8775 Hazardous //// 50-00-0
50% formamide Sigma-Aldrich 47670 Hazardous //// 75-12-7
Ethidium bromide (EtBr) 30 μg/ml Sigma-Aldrich E1510 Hazardous //// 1239-45-8
Bromophenol blue  Sigma-Aldrich B0126 115-39-9 
SMALL RNA FRACTIONATION
Flat gel loading tips Life Technologies LC1002
Savant SpeedVac Concentrator Thermo Scientific  DNA120
Vertical Electrophoresis, Mini-PROTEAN Tetra Cell  Biorad 165-8000
Denaturing Acrylamide Gel
10% acrylamide/bis-acrylamide (19:1) Sigma-Aldrich A3449 Hazardous. Let the gel polymerize for 45 min before use
1x TBE Buffer (or 1x MOPS Buffer)
7 M urea Sigma-Aldrich U6504 57-13-6
0.1% ammonium persulfate Sigma-Aldrich 215589 7727-54-0 
0.1% TEMED Sigma-Aldrich T9281 110-18-9
Gene Ruler Ultra Low Range DNA Ladder (10 bp-step) Thermo Scientific SM1211 Label 0.1 μg, as described in the "probe labeling" reaction
Acrylamide Blue Dye 
50% formamide Sigma-Aldrich 47670 Hazardous //// 75-12-7
Bromophenol blue Sigma-Aldrich B0126 115-39-9 
Running Buffer (RB)
1x MOPS Buffer 
Alternative RB: 1x TBE Buffer
1x TBE Buffer
5X TBE
445 mM Tris-base Sigma-Aldrich T1503 77-86-1 
445 mM boric acid Sigma-Aldrich B7901 10043-35-3
20 mM EDTA Sigma-Aldrich EDS 60-00-4  
Gel Staining Solution
Ethidium bromide 0.5 μg/ml Sigma-Aldrich E1510 Hazardous //// 1239-45-8
1x RB Stain for 15 min with EtBr, destain for 15 min w/o EtBr
BLOTTING
3MM Whatman paper Sigma-Aldrich Z270849
Neutral Nylon Membrane, Hybond NX GE Healthcare Life Science RPN203T Photosensitive
CROSSLINKING
Crosslinking Solution (XLS)
1% 1-methylimidazole (v/v) Sigma-Aldrich 336092 Always prepare a fresh aliquot of XLS //// 616-47-7
12.5 mM HCl Sigma-Aldrich H1758 Hazardous //// 7647-01-0
3.1% EDC (w/v) Sigma-Aldrich 3450 25952-53-8  
(PRE)-HYBRIDIZATION
Liquid Scintillation Counter  Beckmann LS 6500
Sheared Salmon Sperm, 0.1 mg/ml  Life Technologies AM9680
rasi4 anti-sense probe 5' CGGUGUUCGACAGUUCCUCGGG -3'
5s-rRNA anti-sense probe 5'-CAACACGCGGTGTTCCCAAGCCG-3'
Dmel-miR279 anti-sense probe 5'-TTAATGAGTGTGGATCTAGTCA-3'
Dmel-miR286 anti-sense probe 5'-AGCACGAGTGTTCGGTCTAGTCA-3'
Purification Kit, Illustra MicroSpin G-25 Columns GE Healthcare Life Science 27-5325-01
(Pre)-Hybridization Solution (HS)
0.5% SDS Sigma-Aldrich 71736 151-21-3 
5x Denhardt's Solution
20X SSPE
3.6 M NaCl Sigma-Aldrich S3014 7647-14-5  
0.2 M sodium phosphate Sigma-Aldrich 342483 7601-54-9  
20 mM EDTA (pH 8.0) Sigma-Aldrich EDS  60-00-4  
50x Denhardt's Solution
1% Ficoll 400 (w/v) Sigma-Aldrich F2637 26873-85-8
1% Polyvinylpyrrolidone Sigma-Aldrich PVP40 9003-39-8
1% BSA Sigma-Aldrich A7906 9048-46-8  
1X TEN Buffer
10 mM Tris-Cl (pH 8.0) Sigma-Aldrich T1503 77-86-1 
100 mM NaCl Sigma-Aldrich S3014 7647-14-5  
1 mM EDTA (pH 8.0) Sigma-Aldrich EDS 60-00-4  
Probe Labelling
0.4 μM oligonucleotide
1.5 μl Ci/μl [γ-32P] ATP Perkin Elmer NEG002A Hazardous //// 51963-61-2
1x T4 Polynucleotide Kinase Buffer Biolabs B0201
T4 Polynucleotide Kinase 0.5 units/μl Biolabs M0201 EC 2.7.1.78
WASHING
Geiger Mueller Detectors Canberra Industries MCB2/CPS – EM77021
Washing Buffer (WB), 2x SSPE
Stringent Washing Buffers
0.2x SSPE
2x SSPE, 0.5% SDS
0.2x SSPE, 0.5% SDS
SIGNAL DETECTION
PharosFX Plus System Biorad 170-9460
Image J Freely available
Quantity One Biorad
X-ray films , BioMax XAR Sigma-Aldrich F5888 Photosensitive
Developer for X-ray films Sigma-Aldrich P7042
Fixer for X-ray films Sigma-Aldrich P7167
STRIPPING
Stripping Solution
10 mM Tris-HCl pH 8.8 Sigma-Aldrich T1503 77-86-1 
5 mM EDTA Sigma-Aldrich EDS 60-00-4  
0.1% SDS Sigma-Aldrich 71736 Add SDS after boiling to avoid foaming //// 151-21-3

DOWNLOAD MATERIALS LIST

References

  1. The RNA World. Gesteland, R. F., Cech, T. R., Atkins, J. F. 3rd, Cold Spring Harbor Laboratory Press. (2006).
  2. Mercer, T. R., Dinger, M. E., Mattick, J. S. Long non-coding RNAs: insights into functions. Nat Rev Genet. 10, 155-159 (2009).
  3. Salmena, L., Poliseno, L., Tay, Y., Kats, L., Pandolfi, P. P. A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell. 146, 353-358 (2011).
  4. Cesana, M., et al. A long noncoding RNA controls muscle differentiation by functioning as a competing endogenous RNA. Cell. 147, 358-369 (2011).
  5. Orphanides, G., Reinberg, D. A unified theory of gene expression. Cell. 108, 439-451 (2002).
  6. Mehler, M. F., Mattick, J. S. Noncoding RNAs and RNA editing in brain development, functional diversification, and neurological disease. Physiol Rev. 87, 799-823 (2007).
  7. Fire, A., Xu, S., Montgomery, M., Kostas, S., Driver, S., Mello, C. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature. 391, 806-811 (1998).
  8. Hamilton, A., Baulcombe, D. A species of small antisense RNA in posttranscriptional gene silencing in plants. Science. 286, 950-952 (1999).
  9. Lee, R. C., Feinbaum, R. L., Ambros, V. The C. Elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 75, (1993).
  10. Wightman, B., Ha, I., Ruvkun, G. Posttranscriptional regulation of the heterochronic gene lin-14 by lin-4 mediates temporal pattern formation in C. elegans. Cell. 75, 855-862 (1993).
  11. Fabian, M. R., Sonenberg, N., Filipowicz, W. Regulation of mRNA translation and stability by microRNAs. Annu Rev Biochem. 79, 351-379 (2010).
  12. Pasquinelli, A. E., et al. Conservation of the sequence and temporal expression of let-7 heterochronic regulatory RNA. Nature. 408, 86-89 (2000).
  13. Lagos-Quintana, M., Rauhut, R., Lendeckel, W., Tuschl, T. Identification of novel genes coding for small expressed RNAs. Science. 294, 853-858 (2001).
  14. Lau, N. C., Lim, L. P., Weinstein, E. G., Bartel, D. P. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science. 294, 858-862 (2001).
  15. Lee, R. C., Ambros, V. An extensive class of small RNAs in Caenorhabditis elegans. Science. 294, 862-864 (2001).
  16. Laneve, P., et al. The Gcm/Glide molecular and cellular pathway: new actors and new lineages. Dev Biol. 375, 65-78 (2013).
  17. Hosoya, T., Takizawa, K., Nitta, K., Hotta, Y. Glial cells missing: a binary switch between neuronal and glial determination in Drosophila. Cell. 82, 1025-1036 (1995).
  18. Jones, B. W., Fetter, R. D., Tear, G., Goodman, C. S. Glial cells missing: a genetic switch that controls glial versus neuronal fate. Cell. 82, 1013-1023 (1995).
  19. Vincent, S., Vonesch, J. L., Giangrande, A. Glide directs glial fate commitment and cell fate switch between neurons and glia. Developement. 122, 131-139 (1996).
  20. Cattenoz, P. B., Giangrande, A. Lineage specification in the fly nervous system and evolutionary implications. Cell Cycle. 12, 2753-2759 (2013).
  21. Jones, B. W., Abeysekera, M., Galinska, J., Jolicoeur, E. M. Transcriptional control of glial and blood cell development in Drosophila: cis-regulatory elements of glial cells missing. Dev Biol. 266, 374-387 (2004).
  22. Ragone, G., et al. Transcriptional regulation of glial cell specification. Dev Biol. 255, 138-150 (2003).
  23. Akiyama-Oda, Y., Hosoya, T., Hotta, Y. Asymmetric cell division of thoracic neuroblast 6-4 to bifurcate glial and neuronal lineage in Drosophila. Development. 126, 1967-1974 (1999).
  24. Bernardoni, R., Kammerer, M., Vonesch, J. L., Giangrande, A. Gliogenesis depends on glide/gcm through asymmetric division of neuroglioblasts. Dev Biol. 216, 265-275 (1999).
  25. Ragone, G., Bernardoni, R., Giangrande, A. A novel mode of asymmetric division identifies the fly neuroglioblast 6-4T. Dev Biol. 235, 74-85 (2001).
  26. Soustelle, L., Roy, N., Ragone, G., Giangrande, A. Control of gcm RNA stability is necessary for proper glial cell fate acquisition. Mol Cell Neurosci. 37, 657-662 (2008).
  27. Akiyama, Y., Hosoya, T., Poole, A. M., Hotta, Y. The gcm-motif: a novel DNA-binding motif conserved in Drosophila and mammals. Proc. Natl. Acad. Sci. USA. 25, 14912-14916 (1996).
  28. Miller, A. A., Bernardoni, R., Giangrande, A. Positive autoregulation of the glial promoting factor glide/gcm. EMBO J. 17, 6316-6326 (1998).
  29. Krichevsky, A. M., King, K. S., Donahue, C. P., Khrapko, K., Kosik, K. S. A microRNA array reveals extensive regulation of microRNAs during brain development. RNA. 9, 1274-1281 (2003).
  30. Liu, C. G., et al. An oligonucleotide microchip for genome-wide microRNA profiling in human and mouse tissues. Proc. Natl. Acad. Sci. USA. 101, 9740-9744 (2004).
  31. Yin, J. Q., Zhao, R. C., Morris, K. V. Profiling microRNA expression with microarrays. Trends Biotechnol. 26, 70-76 (2008).
  32. Schmittgen, T. D., Jiang, J., Liu, Q., Yang, L. A high-throughput method to monitor the expression of microRNA precursors. Nucleic Acids Res. 32, E43 (2004).
  33. Chen, C., et al. Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res. 33, e179 (2005).
  34. Shi, R., Chiang, V. L. Facile means for quantifying microRNA expression by real-time PCR. Biotechniques. 39, 519-525 (2005).
  35. Raymond, C. K., Roberts, B. S., Garrett-Engele, P., Lim, L. P., Johnson, J. M. Simple quantitative primer-extension PCR assay for direct monitoring of microRNAs and short-interfering RNAs. RNA. 11, 1737-1744 (2005).
  36. Wang, Z., Gerstein, M., Snyder, M. RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet. 10, 57-63 (2009).
  37. Linsen, S. E., et al. Limitations and possibilities of small RNA digital gene expression profiling. Nat Methods. 6, 474-476 (2009).
  38. Valoczi, A., et al. Sensitive and specific detection of microRNAs by northern blot analysis using LNA-modified oligonucleotide probes. Nucleic Acids Res. 32, e175 (2004).
  39. Varallyay, E., Burgyan, J., Havelda, Z. Detection of microRNAs by Northern blot analyses using LNA probes. Methods. 43, 140-145 (2007).
  40. Kim, S. W., et al. A sensitive non-radioactive northern blot method to detect small RNAs. Nucleic Acids Res. 38, e98 (2010).
  41. Pall, G. S., Hamilton, A. J. Improved northern blot method for enhanced detection of small RNA. Nat Protoc. 3, 1077-1084 (2008).
  42. Hermanson, G. T. Bioconjugate Techniques. 2nd, Academic Press, Inc. (2008).
  43. Pall, G. S., Codony-Servat, C., Byrne, J., Ritchie, L., Hamilton, A. Carbodiimide-mediated cross-linking of RNA to nylon membranes improves the detection of siRNA, miRNA and piRNA by northern blot. Nucleic Acids Res. 35, e60 (2007).
  44. Guzzardo, P. M., Muerdter, F., Hannon, G. J. The piRNA pathway in flies: highlights and future directions. Curr Opin Genet Dev. 23, 44-52 (2013).
  45. Aravin, A. A., et al. Double-stranded RNA-mediated silencing of genomic tandem repeats and transposable elements in the D. melanogaster germline. Curr. Biol. 11, 1017-1027 (2001).
  46. Vagin, V. V., et al. A distinct small RNA pathway silences selfish genetic elements in the germline. Science. 313, 320-324 (2006).
  47. Brennecke, J., et al. Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila. Cell. 128, 1089-1103 (2007).
  48. Sullivan, W., Ashburner, M., Hawley, R. S. Drosophila protocols. Cold Spring Harbor Laboratory Press. (2008).
  49. Zamore, P. D., Ma, S. Isolation of Drosophila melanogaster testes. J. Vis. Exp. (51), e2641 (2011).
  50. Sambrook, J., Fritsch, E. F., Maniatis, T. Molecular cloning : a laboratory manual. 2nd, Cold Spring Harbor Laboratory Press. (1989).
  51. Alwine, J. C., Kemp, D. J., Stark, G. R. Method for detection of specific RNAs in agarose gels by transfer to diazobenzyloxymethyl-paper and hybridisation with DNA probes. Proc. Natl. Acad. Sci. USA. 74, 5350-5354 (1977).
  52. Hansen, T. B., et al. Natural RNA circles function as efficient microRNA sponges. Nature. 495, 384-388 (2013).
  53. Flores-Jasso, C. F., Salomon, W. E., Zamore, P. D. Rapid and specific purification of Argonaute-small RNA complexes from crude cell lysates. RNA. 19, 271-279 (2013).
  54. Specchia, V., et al. Hsp90 prevents phenotypic variation by suppressing the mutagenic activity of transposons. Nature. 463, 662-665 (2010).
  55. Várallyay, E., Burgyán, J., Havelda, Z. MicroRNA detection by northern blotting using locked nucleic acid probes. Nat Protoc. 3, 190-196 (2008).
  56. Koscianska, E., Starega-Roslan, J., Czubala, K., Krzyzosiak, W. J. High-resolution northern blot for a reliable analysis of microRNAs and their precursors. ScientificWorldJournal. 11, 102-117 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics