Içinde Yara Yanıtları Cilt yaralayarak Yöntemleri ve Testler

Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Xu, S., Chisholm, A. D. Methods for Skin Wounding and Assays for Wound Responses in C. elegans. J. Vis. Exp. (94), e51959, doi:10.3791/51959 (2014).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

C. elegans epidermis ve manikür yaralama kaynaklanan lokalize hasarı onarmak basit ama sofistike deri tabakası oluşturur. Bu modelde, yara cevaplarını ve onarım çalışmaları sitoskeletal ve doku hasarına genomik yanıtların anlamamıza ışıklı var. En sık kullanılan iki yöntemler C. yara elegans yetişkin deri mikroenjeksiyon iğneler, ve yerel laserler ile azabı vardır. Yerel yaralama İğne manikür, epidermis ve ilişkili dışı matriks bozan ve aynı zamanda iç dokularına zarar verebilir. Daha lokalize hasara lazer ışınlama ile sonuçlanır. Yaralama yüksek epidermal Ca 2+ (saniye-dakika), oluşumu ve yara yerinde (1-2 saat), antimikrobiyal peptit genlerin yüksek transkripsiyon bir aktin içeren halkanın kapatılması da dahil olmak üzere kolayca tahlil tepkilerin bir arkaya (2-24 tetikler saat), ve skar oluşumu. Esasen bütün vahşi tip yetişkin hayvanlar, nerede yaralama hayattayara onarımı veya diğer cevaplar kusurlu mutantlar olarak hayatta kalma azalma göstermektedir. Detaylı iğne ve lazer yaraladığı protokoller ve kantitatif ve yara tepkiler ve onarım süreçleri (Ca dinamikleri, aktin dinamikleri, antimikrobiyal peptit indüksiyon ve hayatta kalma) görselleştirme için testler sunulmaktadır.

Introduction

Cilt yara iyileşmesi mekanizmaları temel biyolojik ilgi ve insan sağlığına uygun. Omurgalılar ve memelilerde yara iyileşmesi düzenli yanıt birçok dokuda ve 1 sinyal karmaşık bir dizi ihtiva eder. Birçok basit bir genetik model organizmalar da cilt yaraları 2 şifa yeteneğine sahiptir. Bu cilt yara onarım genetik uysal modellerini analiz nedenle ilgi olduğunu. Biz ve diğerleri cilt yara için yeni model 3,4 şifa olarak Caenorhabditis elegans kullanmaya başlamışlardır. Bu protokolün amacı C kullanmak için araştırmacıların geniş bir dizi sağlamaktır bir araç olarak elegans epidermal yara iyileşmesinin moleküler ve hücresel mekanizmaları araştırmak.

C. elegans cilt (ayrıca hipodermiste olarak da bilinir) epidermis ve dışı manikür 5 içermektedir. Yetişkin Epidermis büyük sinsityum k olan çok çekirdekli sinsitiyumların az sayıda oluşturulmaktadırnown olarak hyp7. Epidermis kendi apikal yüzeyinde manikür salgılar basit epitel olduğunu. Cilt aktif cilt-delici patojenlere karşı savunmak ve küçük yaralar 4 onarabilir. C yara onarımı elegans cilt tüm vahşi tip hayvanların iğne veya lazer radyasyonun sebep olduğu lokal deri hasarı nedeniyle küçük delici yaraları hayatta hayatta neredeyse, sağlamdır. C elegans cilt yaralama epidermal doğuştan gelen bağışıklık yanıtı, yara kapama ve skar oluşumu 4 olmak üzere tepkilerin bir paketi, tetikler. Yetişkin Epidermis post-mitotik ve yara iyileşmesi, epidermal proliferasyonu veya hücre göçü karşı lokal hücresel yanıtları içerir. O cilt yaralanma membran TRPM kanal GTL-2 ve iç Ca 2 + mağaza 3 gerektiren, Ca 2 + epidermal büyük ve devamlı bir artış tetikler göstermiştir. Epidermal Ca 2 + sinyal F-aktin halkalarının oluşumuna ve kapatma wo için gerekli olanund sitesi. Yaralama ayrıca nlp-29 gibi amper transkripsiyonunu aktive doğuştan gelen bağışıklık yanıtları uyarır. amper yaralama kaynaklı transkripsiyon, bir TIR-1 epidermis 4 özerk hareket / PMK-1 p38 MAP kinaz kaskad bağlıdır. Ya Ca 2 + sinyal yolu ya da doğuştan gelen bağışıklık yanıtının kusurlar düşük sağkalım sonrası yaralama yol açacaktır. C nispeten basit bir yapı elegans epidermis, in vivo görüntüleme için genetik tractability ve avantajları yara onarım birden yönlerini incelemek için o mükemmel bir sistem yapmak.

Iğne yaralama ve lazer yaralama: Burada yaralama iki ortak yöntemleri için protokolleri sunuyoruz. İğne yaralama (iğne çektirmenin dışında) hiçbir özel ekipman gerektirir ve tecrübesi ile günde solucanlar yüzlerce yapılabilir. İğne yaralanma agar plakaları üzerinde büyüyen hayvanlar üzerinde gerçekleştirilmiştir. Bunun aksine, lazer yaralama Anes gerçekleştiriliranestezisi sağlanır hayvanlar bir lamel altında ped agar üzerine monte edilmiş ve hasara karşı hücresel yanıtların canlı görüntüleme için uygundur.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Aşağıdaki protokoller C. ayrıntılı prosedürü tarif elegans cilt yaralama ve yara yanıtları tahlil için.

1. İğne Yaralama 3,4

  1. Standart NGM (nematod büyüme ortamı) E. ile plakalar üzerinde sağlıklı unstarved solucanlar büyütün bir 20 ° C kuluçka makinesi içinde tutulmuştur gıda E. coli OP50 bakteridir.
    Not: NGM agar plakaları ve C rutin ekimi için yöntemler elegans www.wormbook.org 6 bulunabilir.
  2. 20 ° CO / N de yaralama ve kültür önce taze numaralı seribaşı plaka 1 gün 25 L4 aşamada solucanlar seçin.
  3. Yaralama önce, bir iğne çektirmenin kullanarak kılcal iğneleri çekin. yaralama kullanılan iğneler C mikroenjeksiyon için kullanılan oranlarla aynı olduğu; elegans.
  4. Tüm solucanlar genç yetişkin aşamasında olduğundan emin olun. Yaklaşık 30 dakika boyunca buz üzerinde solucanların plaka koyun. Soğutma hayvanlar iğne yaralama kolaylaştırılması, halsiz neden olur.
  5. Diseksiyon stereomikroskopta için buz agar plakasını sökün. Bir solucan seçim kullanarak, agar plaka merkezi haline 25 solucanlar taşıyın.
  6. Daha kolay iğne tutmak için 100 ul pipet içine iğne yerleştirin. Gonad kaçınarak, iğne ile solucanın vücudun ön veya arka kısmını delinme. Genel olarak, arka farenks ve anterior gonad arasında, ya da arka gonad ve rektum arasındaki yara çalışmayın. Yeniden kullanım iğneler birçok kez, kırılıncaya kadar.
    NOT: hayvana ~ 5-10 mikron delici, yaralar manikür ve cilt delinme kısa, nazik azabı olduğundan emin olun. İğne anim girmelidirderiye ark yaklaşık dik bir açı. yaralar, iç organlarda hasara açık, ya da vücudun hemen rüptürü neden olmamalıdır. Sitoplazma yaralanmasından sonra bir kaç saniye için dışarı sızmaya küçük bir miktar gözlemleyin; hücresel içeriği uzun bir zaman içinde sızarsa, ancak hayvanlar hayatta olmaz. Optimum görüntüleme için, yanal epidermal syncytium (hyp7) veya lateral dikiş yara.
    NOT: Bu işlem, bir cam iğne kullanılmasını içerir.
  7. Solucanlar 20 ° C'de daha sonra oda sıcaklığında kültüre geri izin verin. Aşağıda tarif edilen deneylerde, bir dizi iğne yaralanma başarısını değerlendirin. Vahşi tip hayvanların% 95'den daha fazla iğne genç yetişkin safhasında yaralama sonrası 24 saat hayatta. larva veya yaşlı yetişkinlerde yaralama etkisi henüz yaygın olarak analiz edilmemiştir.

2. Lazer Yaralama 3

Daha kesin yaralama gerçekleştirmek için femtosaniye lazer ışınlama (800 nm) kullanın.

  1. Agar p hazırlayınerimiş% 2 agar 7 ile bir cam slayt reklamlar. Pedleri C. canlı görüntüleme için kullanılan agar pedleri benzer olun elegans.
  2. Solucan kıracağıyla agaroz ped üzerine 10 genç erişkin solucanlar aktarın ve 12 mM Levamisole solüsyonu 2 ul damla ekleyin. Hayvanlar ve bir kapak kayma ile sıvı örtün. Solucanlar felç için 1-2 dakika bekleyin.
  3. Dönen bir disk konfokal mikroskop üzerine cam slayt yerleştirin. Solucanlar bulmak ve 100X amacı ile yanal ön veya arka sinsityal epidermis (NA 1,4-1,46) odaklanmak sahne taşıyın.
  4. 140 mW femtosaniye lazerin gücünü ayarlayın (objektif önce ölçülür). 80 MHz tekrarlama oranı femtosaniye lazer kullanın.
    NOT: (20 msn ile ayrılmış) 200 msn, her iki bakliyat elimizde yaralama için yeterlidir.
  5. Epidermal hücre apikal yüzeyinde odaklanın ve epidermisi yara. Sitoplazma (kabarcıklarla) yerel bozulması, veya yerel ağartma o gözlemleyinkullanılan herhangi bir floresan markör, f.
    NOT: femtosaniye lazer kullanarak, uygun lazer güvenlik prosedürleri uygulayın. Böyle iki foton mikroskoplar gibi femtosaniye lazerler kullanarak Hattı veya nokta taramaları lazer yaralama için yeterli güç vermelidir.
    NOT: diğer lazerler kullanarak doğrudan deneyimi yok iken, ilke yaralama içinde (C hücre ablasyon elegans kullanıldığı gibi) geleneksel UV lazerler kullanarak mümkün olmalıdır. İsteğe bağlı olarak, epidermis (N. Pujol, kişisel iletişim) yara disk konfokal eğirme (sıkı bağlamak) modülünü Photobleaching sonra Floresan Kurtarma kullanın.

Yaralama Epidermal Ca 2+ Cevaplarının 3. Görselleştirme

  1. Transgenik C kullanın Yetişkin, epidermal spesifik promotör sütun-19 (Şekil 1A kontrolü altında epidermis (örneğin GCaMP serisi gibi) Ca + 2 sensörleri ifade elegans suşu, transgenler listelenen NOT: Epidermal tdTomato floresan nispeten sabit olduğu gibi transgen ifadesi için bir iç kontrol olarak tdTomato kullanmış ve GCaMP görüntüleme ile karışmaz.
  2. Epidermis tetikleyici Ca 2 + yükseklik yaralama iğne ve lazer Hem. İğne yaralama kolayca dönen bir disk konfokal gerçekleştirilemez Ancak, lazer yaralama Ca 2 + tepki (Şekil 1) kantitatif analiz için tercih edilir.
  3. Bir 100X amacı ile dönen disk konfokal (NA 1,4-1,46) ve uygun filtre setleri kullanılarak çok boyutlu edinim modu (zaman aralığı 114 msn uyarma lazer maruz 2 sn) zaman atlamalı görüntü elde (GFP filtreler GCaMP3 için çalışacak).
    NOT: Ca 2+ resp incelemek için yaklaşık 2 saat zaman atlamalı görüntüleri her 30 sn Edinmeuzun bir zaman boyunca yaralama için onse.
  4. Görüntü analiz yazılımı kullanarak arka planda epidermal hücre sitoplazmada ve beş merkezli beş olan ilgi (ROI) on eşdeğer bölgelerinde, ortalama GCaMP floresan ölçmek.
  5. Sonra yaralanma öncesi arka planda 5 İB'nin ortalama çıkarılarak epidermis 5 ROI floresan ortalama bazal floresan (F 0) edinin. Başlangıca [(F t -F 0) / F 0] göre değişim oranı olarak floresan mesafe kadar taşınmış değişikliği ifade eder.

Yaralama sonra F-aktin Dynamics 4. Görselleştirme

  1. NOT: İğne yaralama yanıt olarak, yavaş yavaş yara etrafında kapatır yara yerinde bir aktin halka gözlemlemek. Bu protokol bölüm deneyleri aktin halka çapı ölçerek kapatılması yara.
  2. Böyle kaynaşmış Drosophila moesin aktin bağlayıcı etki alanı olarak bir F-aktin işaretleyici ifade transgenik solucanlar oluşturunGFP, örneğin (transgen juIs352) sütun-19 (Şekil 2A) ve epidermal özel bir promoterin kontrolü altında ifade edilmiştir.
    NOT: Biz LifeAct veya F-tractin (yayınlanmamış sonuçlar) gibi etki alanı belirteçler bağlayıcı diğer aktin kullanılarak benzer sonuçlar elde ettik.
  3. P col-19- GFP-moesin transgenik solucanlar üzerinde yaralama iğne yapın. İğne yaralama sonra, ~ 5 dakika ile yara site çevresinde GFP-moesin bir halka gözlemlemek. aktin halka çapı küçülür ve en sonunda vahşi tip hayvanlara (Şekil 2A) yaralama 2-3 saat sonra kapatır.
  4. Bir cam slayt üzerinde% 2 agar dolgusunu hazırlayın ve 2 ul 12 mM Levamisole çözeltisi içinde ped üzerine 10 solucanlar aktarmak. Geleneksel konfokal mikroskopi kullanılarak yaralama sonra görüntü GFP-moesin halkaları 1 saat.
    NOT: konfokal mikroskopi 1 saat yaralama sonra aktin halkaları z-yığınları (13 x 0,5 mm) elde etmek.
  5. Yaralama sonra aktin halka çapını ölçün. Epidermal G ölçmek içinFP-moesin, ilk z-yığınının maksimum yoğunluk projeksiyonu yapmak ve daha sonra 4 hat taramaları çizmek GFP-moesin halkası üzerinde (birbirine 45 °). Halka çapı dört hat taramaları (Şekil 2B) arasında tepeden tepeye mesafe, ortalama pik olarak tanımlanır. Zaten kapalı olan halkalar için, çapı 0 mikron olarak tanımlanır.
    NOT: Bu vahşi tip yara kapama sürecinde yaklaşık yarım yoludur F-aktin halkalar rahatlıkla yaralama 1 saat direkte ölçülür. F-aktin halkalar aynı zamanda bir yara kapatma zaman içindeki gelişimini elde etmek için çok sayıda zaman noktasında ölçülebilir. Yara kapanması Zaman atlamalı filmleri Levamizol-immobilize solucanlar kullanarak ve disk konfokal mikroskopi iplik elde edilebilir.

Epidermal Antimikrobiyal Peptitler 5. Deney İndüksiyon

NOT: Yaralama da C. doğuştan gelen bağışıklık yanıtlarını tetikler elegans cilt. Antimikrobiyal peptidler (amper) kodlayan genlerin transkripsiyonu ind olduğunuEpidermiste uced. NLP-29 (nöropeptid benzeri protein) AMP güçlü 4 yaralama ile indüklenir. Epidermis yaralama sonra AMP ifade nasıl kontrol bireysel AMP transkript seviyelerini tespit etmek için transgenik gazetecilere ya da real-time PCR kullanmak, tahlil için.

  1. 4 yaralama doğuştan gelen bağışıklık yanıtı için transgenik muhabiri tahlil.
  2. Bir iç kontrol olarak P nlp-29- GFP ve P col-12- DsRed içeren transgenik muhabiri frIs7, ifade yetişkin hayvanlar üzerinde (protokol 1 gibi) iğne yaralama gerçekleştirin. GFP uzun geçiş filtresi olarak koyu kırmızı veya turuncu yarasız yetişkin hayvanlar gözlemleyin.
    NOT: yaralanması vahşi tip solucanlar P nlp-29 GFP ifadesini neden olacaktır ama GFP uzun bir pas aydınlatma altında turuncu, sarı, yeşil veya görünen solucan sonuçlanan, P col-12 -dsRed etkilemez. Böyle PMK-1 veya p38 MAPK yolundaki genlerin fonksiyonlarının kaybı sy-1 engeller NLP-29 GFP4 yaralama sonra indüksiyon. P NLP-29- GFP larva aşamalarında yüksek seviyelerde ifade edilir
  3. Genç yetişkin hayvanlarda AMP indüksiyon tahlilleri gerçekleştirin. Yarasız kontrol hayvanları GFP düşük seviyelerde olduğundan emin olun.
    Not: p NLP-29- GFP tanımı da ozmotik stres 8 ile sağlanır ve diğer çevresel strese duyarlı olabilir.
  4. Yaralama sonra 6 saat, GFP uzun geçiş filtresi ile kapsamını diseksiyon bir floresan kullanılarak P nlp-29 GFP indüksiyon (Şekil 3) 9 sahip solucanlar numaralarını puan.
    NOT: 1 saat sonrası yaralama P nlp-29- GFP gözle görülür bağlı olduğu anda, daha sonra 6 saat sonrası yaralama hakkında zirveye ulaşan ve 24 saat sonrası yaralama kadar yükselmiş kalan. Görsel puanlama 4,9 ile ifade niceliğini. Alternatif olarak, bir floresan aktive solucan sıralayıcı 4 kullanarak ifade seviyelerini ölçmek. Solucan sıralayıcı için, en az 50 hayvan yaralı gerekir.
  5. Nereye Real-time PCR deneyiBireysel AMP genlerin transkript seviyelerini ntitating. Birkaç genler için deney transkript düzeyleri: nlp-29, nlp-30, cnc-1, ve cnc-5.
  6. Yabani tip ya da mutant solucanlar üzerinde yaralama iğne yapın (protokolü 1)
  7. İstenilen zamanlarda 50 yaralı solucanlar ve 50 yarasız solucanları (örneğin 3, 6, 24 saat) sonrası yaralama toplayın.
  8. RNA, imalatçının talimatları izlenerek bir ticari kit kullanılarak ekstrakte edin.
  9. Ticari ters transkriptaz kiti kullanılarak toplam 20 ul cDNA almak için ters transkripsiyon gerçekleştirin.
  10. RT-PCR için, yeşil flüoresan ile Supermix ve 0.2 uM primerleri ile kombinasyon halinde her bir örnek 0.2 ul cDNA (1/40) kullanılır. RNA kalitesini karşılaştırmak için referans olarak ama,-1 veya SNB-1 RT-PCR kullanın; iç kontrol (ama-1 veya SNB-1) ile normalize tarafından AMP göreceli ifade seviyesini karşılaştırmak, veya norm (yaralı solucanlar / yarasız solucanlar AMP indüksiyon) kat indüksiyon sonrası yaralama karşılaştırmakİç kontrole alizing.
    NOT: cnc-1 ve cnc-5 olan transkripsiyon 10 yaralama aktive aile antimikrobiyal peptidler caenacin vardır. Tipik olarak, iğne yaralama ekspresyonunu indükler (~ CNC-1 için 500 kat), 4 saat 10 bir zaman boyunca. Yayınlanan çalışmalarında kullanılan primerler Tablo 2'de listelenmiştir.

6. Deney Survival sonra Yaralama

  1. Not: Ca2 + bağımlıdır yara onarım yolağı ve doğal bağışıklık tepki yolunu: yaralanması epidermis içinde en azından iki bağımsız sinyal yolaklarını aktive eder. Her iki yollar steril yaralama tam yaşam için gereklidir. Bir mutant veya RNAi tedavi yara iyileşmesini etkileyen olup olmadığını sınamak için, 24-48 saat sonrası yaralama de hayatta ölçün. İsteğe bağlı olarak, uzun ömürlü 4,9 tarihinde yaralama etkisini belirlemek için geleneksel ömrü deneyleri kullanın.
  2. (Genç yetişkin (L4 + 24 saat) solucanlar üzerinde 50 solucanlar yaralama iğne yapın, tekrar seveYukarıdaki protokol 1 Aşağıdaki ral kez). Kontrol olarak yarasız solucanlar eşdeğer sayıda koruyun.
  3. Survival (Yeni ağar plaka her 24 saatte transfer yaralı solucanlar) her 24 saat kontrol edin. Böyle GTL-2 veya tir-1, normalize yarasız kontrol hayvanlara olarak yara tamir kusurlu mutantlar yaralama sonra% 50 sağkalım ~ 24 saat gözlemleyin. Ölüm solucan çekme ile dokunmak lokomotor yanıt eksikliği olarak tanımlanır.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Böyle GCaMPs gibi Ca sensörleri (Şekil 1) ile görüntülendi lazer veya iğne yaralama, epidermal Ca düzeylerinde hızlı ve sürekli yükseklik tetikleyecektir. Ca yükseklik saniye içinde oluşur ve birkaç dakika onlarca yükseltilmiş olarak kalır. Çoğaltılabilir yaralama İğne Yaralı sitelerde (Şekil 2), F-aktin halkaların oluşumu ile sonuçlanır; Bu dakika içinde görünür ve yaralama sonra yavaş yavaş yakın 1-2 saat üzerinde. Aktin halkaları daha az sıklıkta daha hassas lazer yaralama sonra oluşur. Hem iğne ve lazer yaralama transkripsiyonel gazetecilere (Şekil 3) ile tespit epidermal antimikrobiyal peptidler gibi nlp-29 gibi (AMP'lerin), ifadesini neden. AMP indüksiyon yaralama sonra 2-4 saat içinde görülür ve yaklaşık 24 saat sürer. Vahşi tip İğne yaralama anlamlı (yaralama 24 saat sonra ölçülen) canlılığı ya da ömrünü etkilemez.

Şekil 1,
Şekil 1. Lazer yaralama C. Ca 2+ yanıtı tetikler elegans epidermis. (A) Epidermal GCaMP3 floresan (P col-19 -GCaMP3 (juIs319)) femtosaniye lazer yaralama sonra seviyeleri. Ön-vücutta epidermis Yanal görünümü; x lazer yara; N, epidermal çekirdeği. İplik Disk konfokal görüntüleri, yoğunluk kodu. UW: yarasız, W:. / F 0 GCaMP3 mesafe kadar taşınmış yaralı (B) kantitasyonu 20, 40, ve yara siteden 60 um de; temsilcisi iz. Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 2,
Şekil 2. İğne yaralama yara site çevresinde aktin polimerizasyonu tetikler. (A) col-19- GFP-moesin (juIs352) ile görüntülendi yara kenarında aktin yüzük, oluşumunu tetikler. Ölçek: 10 um. UW: yarasız, W:.. Hat taramaları aktin halka çapı yaralı (B) kantitasyonu, hayvan başına 4 hat taramaları (panelde kırmızı çizgiler noktalı (A), WT) Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.

Şekil 3,
Şekil 3. Epidermal yaralama doğuştan gelen bağışıklık yanıtı aktive eder. Temsilci görüntüleri iğne yaralama sonrası P nlp-29 GFP (frIs7) indüksiyon (WT yarasız, WT + 3 saat yaralı). Ölçek:. 200 mikron bir görüntülemek için buraya tıklayınızBu rakamın büyük versiyonu.

Muhabir Transgen Floresan Alel
Kalsiyum PCOL-19-GCaMP3; PCOL-19-tdTomato GFP / tdTomato juIs319 X
Aktin PCOL-19-GFP :: moesin GFP juIs352 I
nlp-29 Pnlp-29-GFP / PCOL-12-DsRed GFP / DsRed frIs7 IV

Yara tepki deneylerinde kullanılan Tablo 1. Transgenler. Bu tablo kromozomal Caenorhabditis Genetik Merkezi (http://www.cbs.umn.edu/research/resources/cgc) mevcut transgenleri entegre listeler.

Gen adı Dizi
nlp-29 F: cttctcgcctgcttcatggc
R: gtccgtatccaccatatcctcc
nlp-30 F: TTCTTCTCGCCTGCTTCATGG
R: CATAACCTCTACCATATCCACCG
cnc-1 F: gccattgtcgccatttcctc
R: cctccatacattggatatcctc
cnc-5 F: CTTCTTCTAGCAATGCTCGCTC
R: GTATCCTCCACCATACCCTCC
ama-1 F: ACTCAGATGACACTCAACAC
R: GAATACAGTCAACGACGGAG
SNB-1 F: tccagcagacacaagctcagg
R: gagacaacttctgatcacgctc

AMP transkriptlerinin RT-PCR için kullanılan primerler Tablo 2.. Konsantrasyon Çalışma 0.2 uM. SNB-1, iç kontrol olarak hizmet vermektedir.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

iğne ve lazer yaraladığı Burada sunulan yöntemler hasarı onarmak için epidermal epitel yeteneğini değerlendirmek için tamamlayıcı yaklaşımlar sağlamak. Iğne yaralama epidermis, manikür, ve büyük olasılıkla iç bodrum zarlarını bozan ise Lazer yaralama, epidermise sınırlı olabilir nispeten lokalize ve (lazer konfigürasyonuna bağlı olarak) 'dir. İğne yaralama daha doğru patojenlerin veya doğal ortamda mekanik hasar sebebiyle ortaya çıkan yaraların benzeyebilir. Bir kural olarak, iğne yaralama hayvan yaşam ile uyumlu kesin yaraları ulaşmak için daha fazla pratik gerektirir. İğne ve lazer yaralama ekran birçok benzerlikler hücresel yanıtları. Bununla birlikte, aktin halkanın oluşumu yeniden üretilebilir femtosaniye lazer yaralama sonrası görülen olmadığı not edilmelidir.

Ayrıca iğne katkıları solucan hasarlar iç dokular: İğne bir sınırlaması kesin yara olmadığıdırsağkalım araştırılmamıştır. Bu protokolün bir olası değişiklik daha hassas fiziksel yaralama gerçekleştirmek için mikroakışkan tabanlı mikroenjeksiyon sistemi 11 ve floresan gazetecilere birleştirmek olacaktır.

Burada ayrıntılı iğne ve lazer yaralama yöntemler zorlu yara yanıt karakterizasyonu genomik veya biyokimyasal yaklaşımları kullanmak için yapım, henüz oldukça emek yoğun ve en iyi orta hacimli basit. Bu tür mantarlar veya protozoaların 12,13 olarak manikür nüfuz patojenler hayvanların büyük nüfusa teslim edilebilir, ve yaralama yanıt ile üst üste tepkileri tetiklemek, henüz patojen spesifik yanıtların ek karmaşıklığı tanıtmak olabilir. Fazla çalışma gibi balistik bombardımanı 14 veya mikromekanik delici yapıların 15 diziler gibi diğer abiyotik yöntemler büyük ölçekli yaralama için adapte edilebilir olup olmadığını araştırmak için gerekli olacaktır.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Agarose Denville Scientific CA3510-8
Plastic Petri plate Tritech Research T3308 60 mm
Levamisole Sigma L9756 12 mM
Borosilicate glass capillary World Precision Instruments 1B100F-4
Needle puller Sutter Instrument  P-2000
Worm pick (platinum wire) Tritech Research PT-9010
M9 solution Home-made 3 g KH2PO4, 6 g Na2HPO4, 5 g NaCl, 1 ml 1 M MgSO4, H2O to 1 liter. Sterilize by autoclaving
Trizol Invitrogen 15596026 Use 500 ml for 50 worms
iQ SYBR Green Bio-Rad 1708882
SuperScript III Invitrogen 18080-051
PCR machine Bio-Rad C1000/CFX96
96-well PCR tubes Bio-Rad MLL9601
Image analysis software Molecular Devices Metamorph

DOWNLOAD MATERIALS LIST

References

  1. Gurtner, G. C., Werner, S., Barrandon, Y., Longaker, M. T. Wound repair and regeneration. Nature. 453, 314-321 (2008).
  2. Sonnemann, K. J., Bement, W. M. Wound repair: toward understanding and integration of single-cell and multicellular wound responses. Annu Rev Cell Dev Biol. 27, 237-263 (2011).
  3. Xu, S., Chisholm, A. D. A Gαq-Ca2+ signaling pathway promotes actin-mediated epidermal wound closure in C. elegans. Curr Biol. 21, 1960-1967 (2011).
  4. Pujol, N., et al. Distinct innate immune responses to infection and wounding in the C. elegans epidermis. Curr Biol. 18, 481-489 (2008).
  5. Chisholm, A. D., Xu, S. The Caenorhabditis elegans epidermis as a model skin. II: differentiation and physiological roles. Wiley Interdiscip Rev Dev Biol. 1, 879-902 (2012).
  6. Stiernagle, T. Maintenance of C. elegans. WormBook : the online review of C. elegans biology. 1-11 Forthcoming.
  7. Bargmann, C. I., Avery, L. Laser killing of cells in Caenorhabditis elegans. Methods in cell biology. 48, 225-250 Forthcoming.
  8. Pujol, N., et al. Anti-fungal innate immunity in C. elegans is enhanced by evolutionary diversification of antimicrobial peptides. PLoS Pathog. 4, (2008).
  9. Tong, A., et al. Negative regulation of Caenorhabditis elegans epidermal damage responses by death-associated protein kinase. Proc Natl Acad Sci U S A. 106, 1457-1461 (2009).
  10. Zugasti, O., Ewbank, J. J. Neuroimmune regulation of antimicrobial peptide expression by a noncanonical TGF-beta signaling pathway in Caenorhabditis elegans epidermis. Nat Immunol. 10, 249-256 (2009).
  11. Zhao, X., et al. Microfluidic chip-based C. elegans microinjection system for investigating cell-cell communication in vivo. Biosensor., & Bioelectronics. 50, 28-34 (2013).
  12. Jansson, H. B. Adhesion of Conidia of Drechmeria coniospora to Caenorhabditis elegans Wild Type and Mutants. J Nematol. 26, 430-435 (1994).
  13. Hodgkin, J., Kuwabara, P. E., Corneliussen, B. A novel bacterial pathogen, Microbacterium nematophilum, induces morphological change in the nematode C. elegans. Curr Biol. 10, 1615-1618 (2000).
  14. Hochbaum, D., Ferguson, A. A., Fisher, A. L. Generation of transgenic C. elegans by biolistic transformation. J Vis Exp. (42), (2010).
  15. Hashmi, S., et al. Genetic transformation of nematodes using arrays of micromechanical piercing structures. BioTechniques. 19, 766-770 (1995).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics