Loop-medieret Isotermisk Amplification (lampe) assays til Art-specifik påvisning af

Immunology and Infection
 

Cite this Article

Copy Citation | Download Citations

Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated Isothermal Amplification (LAMP) Assays for the Species-specific Detection of Eimeria that Infect Chickens. J. Vis. Exp. (96), e52552, doi:10.3791/52552 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Global kylling produktion er tidoblet i løbet af de sidste 50 år med udviklingslandene hosting næsten fire gange udvidelsen vidne i den udviklede verden (www.faostat.org) . Da relevansen af ​​kylling produktion til fødevaresikkerheden på verdensplan er vokset så også har profilen af ​​patogener, som kan forårsage alvorlig sygdom hos kyllinger. Et godt eksempel er de Eimeria arter, allestedsnærværende protozoparasitter der kan forårsage den enteriske sygdom coccidiose 1. Hvor kyllinger opdrættes en eller flere Eimeria-arter er sandsynligvis være fælles 2-4. I den udviklede verden Eimeria er primært styret af kemoprofylakse, beskæftiger shuttle eller rotation programmer til at minimere konsekvenserne af resistens 5. Levende vacciner bruges også i systemer, hvor fugl værdi er tilstrækkelig til at retfærdiggøre udgifterne (f.eks avlsdyr, lag og nogle slagtekyllinger 5). Som result af disse foranstaltninger klinisk coccidiose ofte velkontrollerede, selvom subklinisk infektion er almindelig 5. I udviklingslandene vaccination er sjælden og narkotika ansøgning ofte mindre godt informeret. Som en konsekvens subklinisk og klinisk coccidiose er mere almindelig og udøver en betydelig økonomisk virkning 3.

Diagnose af eimerian infektion har traditionelt påberåbt læsion scorer post mortem, selvom selv de forfattere mest udbredte pointsystem kommenterede, at for nogle arter "er det tvivlsomt, om en sådan procedure bør forsøges i enhver men moderat svære infektioner" 6. Supplerende dokumentation kan samles ved en mikroskopisk påvisning af den miljømæssigt resistente oocyst livscyklus etape i gødningsprøver eller kuld prøver, selv om overlappende morfologi kan forvirre alle, men eksperten 6,7. Molekylære alternativer ved hjælp af polymerasekædereaktion (PCR), tilfældig amplification af polymorfe DNA PCR (RAPD-PCR) og kvantitative PCR-teknologier har været tilgængelige i op til 20 år 8-10, men til dato de har undladt at blive populær. Relativ regning og kravet om specialiseret laboratorieudstyr eller forarbejdning har begrænset deres optagelse på trods af ofte subjektive og teknisk krævende karakter ældre pathology- og mikroskopi tilgange 10,11. Sådanne begrænsninger kan være overdrevet i mange af de fattigere regioner i verden, såsom Sydøstasien, hvor virkningen af coccidiose på fattigdommen kan være forholdsmæssigt større 12. Som svar er der et klart behov for nye ligetil og følsom, men omkostningseffektive, Eimeria Artsspecifikke diagnostiske analyser.

Loop-medieret isotermisk amplifikation (lampe) er en nem at fremstille DNA-polymerase-driven teknik, der er i stand til at amplificere store mængder DNA. Vigtigst bruger LAMP et Bst DNA polymeraSE stedet for Taq-DNA-polymerase er almindeligt anvendt i PCR, hvilket letter DNA-amplifikation ved en enkelt konstant temperatur uden kravet om termisk cykling 13,14. Lampen kan gøres til genstand for ansøgning i selv de mest rudimentære laboratorium eller i felten. Karakteriseret ved relativ resistens over for mange PCR-inhibitorer, høj følsomhed og specificitet, er blevet udviklet LAMP assays for en bred vifte af patogener, herunder infektiøs bursal disease virus, Clostridium perfringens og Cryptosporidium 15-17. Som svar på efterspørgslen efter nye omkostningseffektive Eimeria Artsspecifikke diagnostik et panel af LAMP assays er specifikke for hver af de syv Eimeria arter, der inficerer kyllinger er udviklet 18. Ansøgninger om de nye analyser omfatte overvågning parasit forekomst, af særlig værdi i betragtning af den sammenslutning af arter som Eimeria maxima eller Eimeria necatrix med dårlige økonomiske performance 3,4. Andre anvendelsesområder omfatter vurdering af effektiviteten af en bedrifts anticoccidial strategi, diagnosticering af subklinisk infektion eller klinisk sygdom og evaluering af risiko, som Eimeria til en gård.

Protocol

1. Skabelon Forberedelse

BEMÆRK: genomisk DNA template mistænkes for at indeholde DNA afledt fra en af de syv Eimeria arter, som inficerer kyllinger kan anvendes som template for LAMP-baserede Eimeria artsidentifikation. Tarmvævet prøver til felt diagnostisk analyse skal indsamles under rutinemæssig post mortem, som beskrevet her.

  1. Vælg sektion (eller sektioner) af tarmen, der skal testes. Se Tabel 1 for en vejledning til prøve valg af lokalitet og Eimeria arter mest sandsynlige til at være til stede 18 og figur 1 for artsspecifikke vifte af distribution og placering af prøveudtagningssteder.
    BEMÆRK: Dette er af afgørende betydning, da Eimeria er især vært stedspecifikke. Hver art, der inficerer kyllinger er defineret af den intestinale region, at det er rettet mod 19. Beslutningen kan være påvirket af tidligere erfaringer af gården, interesse i en eller more specifikke Eimeria arter eller andre diagnostiske indikatorer 6.
  2. Forbrugsafgifter 5 cm eller længere længder af tarmstykke (r) udvalgt til at teste for Eimeria sterile saks eller en skalpel. Eventuelt opbevare prøver til efterfølgende analyse i et fiksativ, såsom for eksempel i RNAlater 18 eller 95% ethanol.
    BEMÆRK: Hvis lagring i ethanol prøven skal vaskes grundigt i sterilt tris-ethylendiamintetraeddikesyre (TE) buffer før brug.
  3. Prøven åben på langs, fjerne de fleste tarmindhold (hvis til stede) og skrabe cellerne fra slimhindelaget fri ved hjælp af enten kanten af ​​en steril objektglas eller en ethanol / flamme steriliseret saks klinge. Eventuelt til en samleprøve omfatter celler fra alle fire artsspecifikke tarm steder i et enkelt rør.
  4. Sæt skrabet materiale i en steril 1,5 ml skruelåg mikrocentrifugerør indeholdende 100 pi sterilt TE-buffer med 10% (w / v) Chelex 100 harpiks.
  5. Ryst hver prøve kraftigt i 1 min. Sørg for at skrue top er helt lukket, og derefter inkuberes i et kogende vandbad i 10 min.
  6. Efter kogning tillade hver prøve til at afkøle ved stuetemperatur i 1-2 minutter.
  7. Centrifuger hver prøve under anvendelse af en mikrocentrifuge ved tophastighed (f.eks ~ 10.000 xg) i 1 min.
  8. Saml 2 pi af den resulterende supernatant til at være skabelon i hver lygte assay, der skal iværksættes. Eventuelt pool mere end én intestinal sted i et enkelt rør for at tilvejebringe en multi-site assay.

2. Eimeria LAMP Primer Preparation (Pre-assay)

  1. Forbered Eimeria LAMP primer lagre tilstrækkelige til 100 analyser:
    1. Rekonstituer hvert frysetørret Eimeria LAMP primer ved at tilføje vand af molekylærbiologisk kvalitet til en koncentration på 100 uM (som specificeret af fabrikanten). Hvis ikke angivet, beregne mængden af ​​vand af molekylærbiologisk kvalitet kræves using fysiske og molekylvægten af ​​hver primer.
    2. Pipette 60 pi vand af molekylærbiologisk kvalitet i et separat 0,5 ml flip-top mikrocentrifugerør for hver Eimeria art, der skal analyseres.
    3. Tilføj primere FIP, BIP, F3, B3, LF og LB specifikke target Eimeria arter til vandet ved hjælp af de i tabel 2 viste bind, hvilket skaber en række af syv artsspecifikke primerblandinger.
    4. Kort vortex blande primer løsning, så puls mikrofuge og fryse indtil anvendelse.
  2. Forbered en LAMP reaktion mastermiksens for hver Eimeria art, der skal analyseres. Multiplicer de i tabel 3 viste mængder ved antallet af prøver og tilsæt tre til en positiv kontrol, negativ kontrol og pipettering reservedele. Tilsæt til en 0,5 eller 1,5 ml flip-top mikrocentrifugerør.

3. Eimeria LAMP Assay

  1. Pipette 23 pi Eimeria artsspecifikke Bst DNA-polymerase / LAMP MasterMix i en 0.5 ml mikrocentrifugerør.
  2. Tilsæt 2 pi DNA template (fremstillet i afsnit 1), træffes en endelig reaktion volumen på 25 pi.
  3. Tilsæt 2 pi Eimeria artsspecifik genomisk DNA til en reaktion (positiv kontrol). Tilsæt 2 pi vand af molekylærbiologisk kvalitet reaktion (negativ kontrol).
    BEMÆRK: Hvis artsspecifik genomisk DNA ikke er tilgængelig en tidligere positiv LAMP eller standard PCR-produkt kan anvendes i stedet.
  4. Inkuber i et vandbad eller varmeblok ved 62 ° C i 30 min. Eventuelt de-aktivere Bst DNA-polymerase ved opvarmning til 80 ° C i 10 minutter, hvis reaktionen ikke vil aflæses straks.

4. LAMP Assay Udlæsning

  1. Ved afslutningen af ​​inkubationen vurdere farven af ​​hver reaktion ved øjet under indendørs lys. Negative resultater synes rosa til violet farve, positive resultater vises himmelblå 20.
  2. Eventuelt bekræfte LAMP analyseresultatet i en laboratrisk ved at blande 5 pi LAMP reaktionsprodukt med 1 pi DNA gel loading buffer til agarosegelelektroforese under anvendelse af en 2% agarosegel i 1 x Tris / borat / EDTA (TBE) buffer, præ-farvet under anvendelse af en nucleinsyrefarve (5 pi per 50 ml agarose). Tilsæt 5 pi af en 1 kb molekylstørrelse DNA-stige til bane 1 af gelen til at tillade beregning fragment størrelse.

Representative Results

Assay validering

Under validering hver Eimeria artsspecifik LAMP assay blev testet under anvendelse af et panel af rene DNA-prøver, der repræsenterer alle syv Eimeria arter, der inficerer kylling, samt kylling genomisk DNA som en masse kontrol. Agarosegelelektroforese blev anvendt til at løse hvert assay og viste absolut artsspecificitet med ingen vært krydsreaktivitet 18. Dernæst en ti-fold seriefortynding serie fremstillet ved anvendelse af renset Eimeria tenella genomisk DNA afslørede en analyse følsomhed grænse på mellem en og ti genom kopier 18. Ingen øvre grænse blev bestemt med positive resultater til og med den højeste koncentration (100.000 genom kopier) 18.

Ansøgning med feltprøver

Prøver indsamles til Eimeria test vil sandsynligvis stamme fra kyllinger fundet døde, aflivet som følge af poor sundhed eller udsat for sentinel helbredskontrol, hvilket indikerer en sandsynlighed stikprøvestørrelse på mellem et og tre, når en del af en rutine. Test tre fugle indsamlet fra en amerikansk slagtekyllinger gård som en del af et overvågningsprogram gav tre sæt tarmprøver. Målrettet anvendelse af artsspecifikke LAMP assays, prioritere de foretrukne tarm websteder for hver Eimeria arter (tabel 1), tillod visuel identifikation af eimerian infektion i alle fugle testet ved hjælp hydroxynaphthol blå som indikator (figur 2A). Det opnås med en negativ LAMP reaktion ved brug hydroxynaphthol blå farve kan variere fra violet til pink, men er altid forskellig fra blå opnås ved et positivt resultat. Bekræftelse ved agarosegelelektroforese billede sammenlignelige resultater (figur 2B). Under feltet ansøgning kan brugeren vælge at anvende fuld skærm mod alle syv arter, eller målrette kun de arter prioriteret somvigtigt eller vides at være i omløb på bedriften eller omgivelserne.

Den manglende PCR-baserede metoder til at blive etableret som diagnostik for forekomsten af Eimeria understreger kravet om enkelhed i en ny test. Mens LAMP tilbyder enklere fremstilling og forarbejdning end PCR, kravet om at teste flere tarm steder pr fugl forbliver nedslående. Fremstilling af en enkelt poolet DNA prøve pr fugl, som derefter kan testes med en eller flere LAMP assays, vil sandsynligvis være mere tiltalende. Behandling én samleprøve pr fugl, der repræsenterer materiale indsamlet fra hver af de specifikke tarm lokaliteter beskrevet i tabel 1 og pulje før DNA forberedelse, til prøvning med alle syv LAMP analyser forudsat det samme resultat som når hver tarm websted blev behandlet særskilt (figur 2 sammenlignet med figur 3).

Figur 1 Figur 1. Intestinale prøvetagningssteder for LAMP påvisning af Eimeria arter parasitter, der inficerer kyllinger. Tarmens regioner er mål for hver Eimeria art fremhæves af de farvede linjer, med de foretrukne steder for prøveudtagning angivet ved tallet mellem de stiplede sorte streger (E. acervulina: gul / 1, E. Brunetti: pink / 2, E. maxima: blå / 3, E. mitis: orange / 4, E. necatrix: rød / 5, E. praecox: grøn / 6 og E. tenella: grå / 7). Klik her for at se en større udgave af dette tal.

Figur 2
Figur 2. LAMP diagnose af eimerian infektion from tre kommercielle slagtekyllinger. LAMP reaktioner løses ved hjælp af (A) hydroxynaphthol blå, hvor en sky blue reaktion var positiv og en violet til lyserød reaktion var negativ, og (B) agarosegelelektroforese. De intestinale sites stikprøven var som vist i tabel 1 for hver parasitart. A = E. acervulina, B = E. Brunetti, Ma = E. maksima, Mi = E. mitis, N = E. necatrix, P = E. praecox og T = E. tenella. Bane 1 indeholdt GeneRuler 1 kb DNA-stige. Klik her for at se en større udgave af dette tal.

Figur 3
Figur 3. LAMP diagnose af eimerian infektion anvender fælles prøver fra tre forskellige kommercielle slagtekyllinger. LAMP reaktioner løses ved hjælp hydroxynaphthol blå, hvor en himmelblå reaktion var positiv og violet til lyserød reaktion var negativ. A = E. acervulina, B = E. Brunetti, Ma = E. maksima, Mi = E. mitis, N = E. necatrix, P = E. praecox og T = E. tenella. Klik her for at se en større udgave af dette tal.

Prøvested Eimeria arter assay (mest sandsynligt)
Duodenum (D) E. acervulina, E. praecox
Jejunum / ileum * (J / I) E. maxima, E. necatrix
Caecum (C) E. necatrix, E. tenella
Terminale ileum (TI) E. Brunetti, E. mitis Samleprøve (P) E. acervulina, E. Brunetti, E. maxima, E. mitis, E. necatrix, E. praecox, E. tenella

Tabel 1. Intestinal områdespecifik udvælgelse af kandidat Eimeria arter assays. Valget af område, der skal udtages prøver varierer for hver Eimeria arter som illustreret i figur 1. Puljede prøver omfatter materiale indsamlet fra alle fire bestemte websteder, som derefter blev kombineret til DNA-forberedelse.

Primer * Stock koncentration (uM) Volume (ul)
Vand - 60
Forward Inner Primer (FIP) 100 40
Baglæns Inner Primer (BIP) 100 40
Forward Outer Primer (F3) 100 10
Baglæns Outer Primer (B3) 100 10
Loop Forward (LF) 100 20
Loop tilbage (LB) 100 20
Total 200

Tabel 2. Forberedelse af en lampe primer premix. Komponenterne og proportioner, der er nødvendige for at forberede en primer premix til lampe. Mængderne vises er for 100 LAMP reaktioner. * Primer identiteter som vist i Materialer og Barkway et al (2011) 18.

Stock conc n Final reaktion conc n Volumen pr reaktion (pi)
DDW - - 10.1
THERMOPOL buffer 10 x 1 x 2.5
MgSO4 100 mM 2 mM 0,5
Primer mix * Tabel 2 2.5
dNTPs 25 mM 400 uM 0.4
Betain 5 M 1 M 5
Hydroxynaphthol blå 3 mM 120 uM 1
Bst DNA-polymerase 8000 U / ml 8 U 1
Total 23

Tabel 3. Udarbejdelse af en LAMP reaktion mastermiksens. * Eimeria artsspecifik.

Materials

Name Company Catalog Number Comments
RNAlater Ambion AM7024
Ethanol VWR Chemicals 20821.321 Caution, highly flammable
100 x Tris-EDTA (TE) buffer concentrate Sigma-Aldrich T9285
Chelex 100 resin Bio-Rad 142-1253
Molecular grade water Invitrogen 10977035
E. acervulina F3 Sigma-Aldrich VC00021 *CCTAACATTTCGCTTCACGGAC
E. acervulina B3 Sigma-Aldrich VC00021 *ATGAGCAAGTGGAACACCTTG
E. acervulina FIP Sigma-Aldrich VC00021 *AGAGCACAGTGGCAGTGC-AGCAGACAGCATGGCTTACCT
E. acervulina BIP Sigma-Aldrich VC00021 *GAAGACCCTCTGAAGAACGGA-CCTTCTCACCGCTTACCGG
E. acervulina LB Sigma-Aldrich VC00021 *TAAGGTTACACCCGTGGAGG
E. acervulina LF Sigma-Aldrich VC00021 *GCCATGCACAAAGCGACTT
E. brunetti F3 Sigma-Aldrich VC00021 *GGCCATCAAGTTCCATGAGC
E. brunetti B3 Sigma-Aldrich VC00021 *TCAACCTCCTGAGTGTGGTT
E. brunetti FIP Sigma-Aldrich VC00021 *GAAAATGCCTTCGTAGCTGCT-GCTGGGTACGGAGCGTCTT
E. brunetti BIP Sigma-Aldrich VC00021 *TACTTCCTAGGATCCATCCTCGC-AGTTTCGCTGCCGCCTC
E. brunetti LB Sigma-Aldrich VC00021 *GAAACGCTCGAACATGGC
E. brunetti LF Sigma-Aldrich VC00021 *CTTCTCCACAGACCCAGAGGT
E. maxima F3 Sigma-Aldrich VC00021 *ACTACGGAAAAGTGCGTAGCT
E. maxima B3 Sigma-Aldrich VC00021 *CCTTCCTCCCTTCTGAAAACTG
E. maxima FIP Sigma-Aldrich VC00021 *GAGTCACTGCTGATGTACCAAA
AG-GAACTATGCCGCTTTCCCCTG
E. maxima BIP Sigma-Aldrich VC00021 *AGAATGCGGATTTGTTAGCAGC-AGCAAGTCCAAGGTGTGTGTA
E. maxima LB Sigma-Aldrich VC00021 *CAAGCCTACGCGGACATC
E. maxima LF Sigma-Aldrich VC00021 *TTATGCAGCTGGGTCAACG
E. mitis F3 Sigma-Aldrich VC00021 *ACGATAGCCAAGACACGTAAGG
E. mitis B3 Sigma-Aldrich VC00021 *CCCCGTGATAAGAGTAGGAACA
E. mitis FIP Sigma-Aldrich VC00021 *CGCGGGTCGTGAGATTTAAATT
AT-GGAAGATCAGGACGGGCACT
E. mitis BIP Sigma-Aldrich VC00021 *GTTTCAGTTGATGAACAAGCGA
GA-TGCGCCTCTAGAATCAAGACG
E. mitis LB Sigma-Aldrich VC00021 *TCCATGCATCCCCTTGTT
E. mitis LF Sigma-Aldrich VC00021 *CGTGGGCACAGATTGATTC
E. necatrix F3 Sigma-Aldrich VC00021 *TGGCTTTCCCGCGTACC
E. necatrix B3 Sigma-Aldrich VC00021 *CGGCCCAACACAAAGACTG
E. necatrix FIP Sigma-Aldrich VC00021 *CGCTTGAGTTTTAAGCTATGCA
CA-GACCCAAGCAGCTCACCAA
E. necatrix BIP Sigma-Aldrich VC00021 *CGCCATGCCATTCAATGAACG-*GAGGCATACCGGCGTTGTC
E. necatrix LB Sigma-Aldrich VC00021 *GTCTGTAACTTGGGACGTTGT
E. necatrix LF Sigma-Aldrich VC00021 *GAACAGCCGGAGCCTCTC
E. praecox F3 Sigma-Aldrich VC00021 *GCCCTTGTATGTTGCTGTTTCT
E. praecox B3 Sigma-Aldrich VC00021 *GCGCACGAATCTGAATCACAC
E. praecox FIP Sigma-Aldrich VC00021 *ATCTCCTCAAAGACTTTCGCGT
A-GCGCTTGGCTATATCCATAGG
E. praecox BIP Sigma-Aldrich VC00021 *GCTCTCGTGGCATACTTGC-GCCAGGAGCCACTGATTGT
E. praecox LB Sigma-Aldrich VC00021 *GAATAGCATTGCCAGGTGG
E. praecox LF Sigma-Aldrich VC00021 *GTCCACTGTCATTAATATTGC
TGC
E. tenella F3 Sigma-Aldrich VC00021 *GCTTGTGAAGGTCAGCGTG
E. tenella B3 Sigma-Aldrich VC00021 *GCTGAGTCCATACGTACTTCCT
E. tenella FIP Sigma-Aldrich VC00021 *GCCACTGCTATGGAAAGTCAC
AC-CATAACTGGCATGCAGGGGT
E. tenella BIP Sigma-Aldrich VC00021 *GTTTGGCCCGAAAGTTGTGAA
GA-CGTCAGAAATTGCTGCCCAAT
E. tenella LB Sigma-Aldrich VC00021 *CGCATGTGCAGTTGAAGACA
E. tenella LF Sigma-Aldrich VC00021 *CCAAATGTATCTGCTAGTTATA
TTAACAAG
10 x ThermoPol reaction buffer New England Biolabs B9004S
MgSO4 Sigma-Aldrich M7506
dNTPs Promega U1330
Betaine solution (5 M) Sigma-Aldrich B0300
Bst polymerase New England Biolabs M0275S
Hydroxynaphthol blue Sigma-Aldrich 33936 Dissolved in molecular grade water.
UltraPure agarose Invitrogen 16500-500
10 x Tris/Borate/EDTA (TBE) buffer Invitrogen AM9863
Blue/Orange DNA loading dye (x6) Promega G1881
GeneRuler 1Kb DNA ladder Thermo Scientific SM0313
SafeView nucleic acid stain NBS Biologicals NBS-SV

DOWNLOAD MATERIALS LIST

References

  1. Chapman, H. D., et al. A selective review of advances in coccidiosis research. Adv Parasitol. 83, 93-171 (2013).
  2. Shirley, M. W., Smith, A. L., Tomley, F. M. The biology of avian Eimeria with an emphasis on their control by vaccination. Adv Parasitol. 60, 285-330 (2005).
  3. Fornace, K. M., et al. Occurrence of Eimeria species parasites on small-scale commercial chicken farms in Africa and indication of economic profitability. PLoS ONE. 8, (12), e84254 (2013).
  4. Schwarz, R. S., Jenkins, M. C., Klopp, S., Miska, K. B. Genomic analysis of Eimeria spp. populations in relation to performance levels of broiler chicken farms in Arkansas and North Carolina. J Parasitol. 95, (4), 871-880 (2009).
  5. Peek, H. W., Landman, W. J. Coccidiosis in poultry: anticoccidial products, vaccines and other prevention strategies. Vet Q. 31, (3), 143-161 (2011).
  6. Johnson, J., Reid, W. M. Anticoccidial drugs: lesion scoring techniques in battery and floor-pen experiments with chickens. Exp Parasitol. 28, (1), 30-36 (1970).
  7. Haug, A., Gjevre, A. G., Skjerve, E., Kaldhusdal, M. A survey of the economic impact of subclinical Eimeria infections in broiler chickens in Norway. Avian Pathol. 37, (3), 333-341 (2008).
  8. Procunier, J., Fernando, M., Barta, J. Species and strain differentiation of Eimeria spp. of the domestic fowl using DNA polymorphisms amplified by arbitrary primers. Parasitology Research. 79, (2), 98-102 (1993).
  9. Schnitzler, B. E., Thebo, P. L., Mattsson, J. G., Tomley, F. M., Shirley, M. W. Development of a diagnostic PCR assay for the detection and discrimination of four pathogenic Eimeria species of the chicken. Avian Pathol. 27, (5), 490-497 (1998).
  10. Vrba, V., Blake, D. P., Poplstein, M. Quantitative real-time PCR assays for detection and quantification of all seven Eimeria species that infect the chicken. Vet Parasitol. 174, (3-4), 183-190 (2010).
  11. Morris, G. M., Gasser, R. B. Biotechnological advances in the diagnosis of avian coccidiosis and the analysis of genetic variation in Eimeria. Biotechnol Adv. 24, (6), 590-603 (2006).
  12. Perry, B., Randolph, T., McDermott, J., Sones, K., Thornton, P. Investing in animal health research to alleviate poverty. ILRI (International Livestock Research Institute). Nairobi, Kenya. (2002).
  13. Nagamine, K., Hase, T., Notomi, T. Accelerated reaction by loop-mediated isothermal amplification using loop primers). Mol Cell Probes. 16, (3), 223-229 (2002).
  14. Notomi, T., et al. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, (12), E63 (2000).
  15. Kaneko, I., et al. Detection of enterotoxigenic Clostridium perfringens in meat samples by using molecular methods. Appl Environ Microbiol. 77, (21), 7526-7532 (2011).
  16. Karanis, P., et al. Development and preliminary evaluation of a loop-mediated isothermal amplification procedure for sensitive detection of cryptosporidium oocysts in fecal and water samples. Appl Environ Microbiol. 73, (17), 5660-5662 (2007).
  17. Xue, C., et al. Rapid detection of Infectious bursal disease virus by reverse transcription loop-mediated isothermal amplification assay. J Vet Diagn Invest. 21, (6), 841-843 (2009).
  18. Barkway, C. P., Pocock, R. L., Vrba, V., Blake, D. P. Loop-mediated isothermal amplification (LAMP) assays for the species-specific detection of Eimeria that infect chickens. BMC Vet Res. 7, (1), 67 (2011).
  19. Long, P., Joyner, L., Millard, B., Norton, C. A guide to laboratory techniques used in the study and diagnosis of avian coccidiosis. Folia Veterinaria Latina. 6, (3), 201-217 (1976).
  20. Goto, M., Honda, E., Ogura, A., Nomoto, A., Hanaki, K. Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue. BioTechniques. 46, (3), 167-172 (2009).
  21. Arakawa, A., Baba, E., Fukata, T. Eimeria tenella infection enhances Salmonella typhimurium infection in chickens. Poult Sci. 60, (10), 2203-2209 (1981).
  22. Blake, D. P., Smith, A. L., Shirley, M. W. Amplified fragment length polymorphism analyses of Eimeria spp.: an improved process for genetic studies of recombinant parasites. Parasitol Res. 90, (6), 473-475 (2003).
  23. Lund, M., Nordentoft, S., Pedersen, K., Madsen, M. Detection of Campylobacter spp. in chicken fecal samples by real-time PCR. J Clin Microbiol. 42, (11), 5125-5132 (2004).
  24. Raj, G. D., et al. Real-time PCR-based quantification of Eimeria genomes: a method to outweigh underestimation of genome numbers due to PCR inhibition. Avian Pathol. 42, (4), 304-308 (2013).
  25. Blake, D. P., Hesketh, P., Archer, A., Shirley, M. W., Smith, A. L. Eimeria maxima: the influence of host genotype on parasite reproduction as revealed by quantitative real-time PCR. Int J Parasitol. 36, (1), 97-105 (2006).
  26. Beck, H. P., et al. Molecular approaches to diversity of populations of apicomplexan parasites. Int J Parasitol. 39, (2), 175-189 (2009).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics