전신 세균 감염 및 면역 방어 표현형에

Immunology and Infection
 

Cite this Article

Copy Citation | Download Citations

Khalil, S., Jacobson, E., Chambers, M. C., Lazzaro, B. P. Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster. J. Vis. Exp. (99), e52613, doi:10.3791/52613 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

열매는 초파리 melanogaster의 면역 방어의 기능과 진화 연구를위한 최고의 모델 생물 중 하나입니다 비행. 선천성 면역의 여러 측면은 곤충 및 포유 동물 사이에서 보존되고, 초파리 용이 유전자 및 실험적으로 조작 할 수 있기 때문에, 이들은 면역계 기능과 질병의 생리적 영향을 연구하기위한 강력하다. 여기에 입증 절차는 상피 장벽과 방어의 수동적 인 형태를 무시하고 전신 감염에 초점을 허용, 직접 체강에 박테리아의 도입에 의해 파리의 감염을 수 있습니다. 절차는 호스트 사망, 전신 병원체 부하와 호스트 면역 체계의 유도 정도의 측정 속도에 대한 프로토콜을 포함한다. 감염이 절차는 저렴하고 튼튼하고 정량적으로 반복하고, 기능적 유전학, 진화 생활사 및 생리학 연구에 사용될 수있다.

Introduction

과일 초파리 비행은 실험 조작에 매우 의무가 있으며, 넓은을 개발했다 광범위한 과학계에 의해 백업됩니다 기능과 면역 방어. 초파리의 진화 저렴하고 뒤쪽으로 쉽게 공부를위한 최고의 모델 생물 중 하나입니다 연구 도구의 배열. 선천성 면역의 여러 측면은 수신자 같은 수용체와 NF-kB의 가족 전사 인자, JAK / STAT 신호 및 JNK 경로의 반응에 의해 매개 신호 전달을 포함, 곤충, 포유류 사이에 보존되어있다. 1,2 이들 유전자 및 경로 수의 기능 D에 조회 할 melanogaster의 돌연변이를 사용하여 또는 RNAi의 그 증감 경로 활동 knockdowns 3 -. 또한 6 초파리 진화 생활사 이론의 맥락에서 비롯한 감염 질환의 생리적 영향을 연구하기 위해 사용될 수있다 (7).- 9 모든 그러한 연구는, 그러나, 확실하게 정의 된 처리 조건 하에서 실험 파리 감염 능력에 의존한다. 여기에 설명 된 절차는 초파리에 강력하고 반복적 인 세균 감염을 제공하고 이후 감염의 심각도를 측정하고 호스트 면역 반응을 정량화하기위한 방법 론적 프레임 워크를 제공합니다.

초파리는 자연과 실험적으로 세균, 곰팡이, 바이러스, 선충과 포식 기생자 말벌을 포함 기생충과 병원균의 다양한에 감염 될 수있다. 현재의 프로토콜은 전신 세균 감염을 제공에 초점을 맞추고 있습니다. 많은 다른 세균 감염 파리 사용될 수 있으며, 실험자의 선택은 요구되는 정밀한 과학 질문에 기초한다. 예를 들어, 인간 임상 분리가 박테리아 병원성 메카니즘 (10)을 연구하기 위해 이용 될 수 있거나, 생태 학적으로 중요한 균주 preferre 수있다진화 연구를위한 D. 11 일부 박테리아는 D의 유능한 병원균은 melanogaster의, 감염에 증식 및 호스트 질병 또는 사망의 원인. 다른 박테리아를 효과적으로 호스트의 면역 시스템에 의해 관리하고 몇 일 이내에 삭제됩니다. 이 예제에서, 비던 레트 게리 호스트 사망을 야기하고 생존 호스트에 계속. 대장균이 숙주 면역계에 의해 클리어되지 않은 병원체로 사용될 수있는 증식 성 병원체로서 사용될 것이다.

감염은 직접 플라이의 체강 내에 세균의 도입에 의해 확립 될 것이다. 이러한 접근 방식에 관계없이 송신 고유 모드의 전신 감염의 조사를 허용 상피 장벽 보호 동작을 우회. 실험적으로 전신 감염을 설정하기위한 두 가지 주요 방법이 있습니다. 첫 번째에서 nanoinjector하고 뽑아 유리 모세관 바늘의 정확한 수를 주입하는 데 사용됩니다파리에 박테리아. 이 방법은 감염 투여 량의 넓은 동적 범위를 허용하고 매우 정량적으로 반복되는 장점을 갖는다. 두 번째 방법은 오수 바늘로 한 번 찌르기 감염을 제공하는 것입니다. 이러한 접근 방식은 빠른 인 및 특별한 장치를 필요로하지 않는 장점을 갖는다. 감염이 성립되면, 이는 전신 병원체 부하 호스트 사망률 및 유도 성 면역계 활성을 측정하는 것이 가능해진다. 물론, 추가로 임의의 개수의 표현형을 생각할 감염된 D. 측정 될 수있다 후 감염 번식력 (12), 학습 능력 (13), 신진 대사 상태 (14), 또는 상상 할 수 있습니다 거의 모든 다른 특성을 포함 melanogaster의,.

Protocol

1. 수집하고 파리를 준비

  1. 후면 D. 원하는 실험 조건에서 melanogaster의. 양육 동안 파리를 혼잡하게하고 애벌레 단계에서 환경 조건 뿌리깊은 성인 단계에서 면역 방어의 표현형에 영향을 미칠 수 있기 때문에 유충의 밀도, 치료에서 일관성이 있는지 확인하지 않도록주의하십시오. (15)
  2. 번데기 케이스에서 우화 후 3 일 신선한 매체에 전송할 - 실험 파리 0를 수집합니다.
  3. 이후 우화 칠일 - 그들은 5 세 때까지 집 원하는 온도에서 수집 된 파리 (22 ° C와 28 ° C 사이의 온도는 일반적으로 적합하다).
    참고 :이 성숙한 성인 변태를 완료하고 될 수있는 파리 충분한 시간을 허용하지만, 노화가 시작되기 전에 잘.
  4. 다시 혼잡을 피하기 위해주의하면서 감염 이전에 별도의 유리 병에 파리의 수를 정렬합니다.
    참고 : 엄마레는이 데모에 감염하지만, 설명 된 절차를 사용하여 여성을 감염 똑같이 수 있습니다.

2. 문화와 박테리아를 준비

  1. 감염에 최소 2 일 전에 선택한 박테리아의 마스터 플레이트를 준비합니다. 킬 -80 ° C에서 무기한 저장 15 % 글리세롤 재고 박테리아. 최대 2 주 동안 4 ° C에서 마스터 판을 보관하십시오. 냉동 글리세롤 재고 마스터 플레이트 직접 항상 행진. 문화 반복 통로 박테리아가 감쇠 독성을 발전시킬 수있는, 판에 판에서 박테리아의 시리얼 통과하지 마십시오.
    참고 :이 예는 프로 비던 시아 레트 게리과 대장균을 사용한다.
  2. 주입 세균 현탁액을 준비하려면 다음 절차를 사용합니다.
    1. 마스터 플레이트에서 분리 된 하나의 식민지로 멸균 매체를 접종하여 균의 2 ml의 문화를 성장. 정지상에 박테리아 성장 (예 : 참고 : 두 P. 부드러운 흔들림와 37 ° C - 레트 게리와 대장균은 20에서 온도에서 루리아 국물에서 잘 성장한다.
    2. 문화는 고정 단계에 도달하면, 부드럽게 약에서 세포 펠렛. 탁상 원심 분리기 (5,000 XG에 3 분)의 문화 600 μL는, 상층 액을 제거하고, 약에 박테리아를 재현 탁. 멸균 인산 완충 생리 식염수 1,000 μL (PBS; 137 mM의 NaCl을, 2.7 mM의 KCl을 10 mM의 나 2 PO 4, 1.8 mM의 KH 2 PO 4, 산도 = 7.4).
    3. 600 nm에서의 흡광도를 분광 광도계 등의 측정에 사용되는 세균에 적합한 광학 밀도 (OD)를 달성하기 위해 멸균 PBS에 재현 탁하고 세포를 희석. 파리를 감염이 서스펜션을 사용합니다.
      참고 : 600 = 0.1 또는 1.0은 약 10 8 10 9 프로 비던 시아 레트 게리 또는 E를 각각 대응 ml의 당 대장균. 모두가 살기 때문에ND 사균 광학 밀도, 그것이 세균 시체 축적 전에 초기 정지상의 배양 및 수확 광학 밀도 및 감염 동안 도입 된 생존 균수의 관계를 왜곡하는 중요한 기여한다.

3. 파리를 감염

주 : 초파리 내성이 일주기 리듬의 영향에 따라, 그 복제 실험 일에 걸쳐 비슷한 시간에 감염을 수행하는 것이 중요하다 (16).

3.1) Nanoinjector 사용

  1. 감염 유리 바늘을 준비합니다.
    1. 마이크로 피펫 풀러를 사용하여 보로 실리케이트 유리 모세관 당기는 유리 바늘을 준비한다.
    2. 약 50 ㎛의 직경의 개구를 만들 바늘의 선단을 끊어, 집게를 사용하면 액체의 토출을 허용하도록.
  2. 인젝터를 조립합니다.
    1. 밀봉 O 링 한 다음 흰색 SP 배치에이서는 금속 플런저에 (큰 딤플이 바깥쪽으로 향하도록).
    2. 30 G 바늘과 주사기를 사용하여 미네랄 오일 유리 바늘을 입력합니다.
    3. 바늘의 뭉툭한 끝에서 약 1mm, 그것의 기초 주위에 큰 O 링을 배치 한 다음 콜릿을 통해 채워진 유리 바늘을 넣고.
    4. 금속 플런저에 바늘을 밀어 보안까지 콜릿에 나사를 부드럽게.
    5. 인젝터에서 미네랄 오일의 대부분을 꺼내기 만, 여전히 인젝터와 세균 서스펜션 사이에 장벽 역할을 바늘에 기름의 작은 볼륨이 있는지 확인하십시오. 공기의 미네랄 오일 또는 세균 현탁액 내에서 기포, 또는이 두 액체 사이가 없는지 확인합니다.
    6. (9 NL 50 NL 사이에) 주입을위한 원하는 볼륨으로 인젝터를 설정합니다.
  3. 컨트롤을 부상 생성합니다.
    1. 신중 미디어 pressi의 튜브에 모세관 바늘의 선단부를 삽입하여 멸균 PBS와 주사 바늘을 채우기인젝터의 "작성"버튼을 ng를.
      주 :이 실험들은 성장 배지에 현탁 박테리아 주입이 필요한 경우 멸균 박테리아 성장 배지는 또한 부상 제어를 사용할 수있다. 박테리아 성장 배지의 면역 체계를 자극 또는 호스트에 다른 효과를 가질 수 성분이 포함되어 있기 때문에, 이러한 PBS 등의 불활성 담체가 바람직하다.
    2. CO 2의 광 흐름하에 파리의 수를 마취.
    3. 멸균 PBS와 ventrolateral 표면에 전방 복부에 파리를 주입한다.
      그러한 흉부 sternopleural 판으로서 다른 사이트에서 파리를 주입하는 것도 가능하지만, 각 실험 내의 일관성 주사 부위를 유지하는 것이 중요 17 : 메모.
    4. 파리의 모든 때까지 측면에 튜브를 놓고, 새로운 매체와 신선한 유리 병에 주입 파리를 장소는 식품에 부착되는 것을 파리를 방지하기 위해 마취에서 회복. <BR /> 주 : 같은 바늘이 모두 치료에 사용할 수 있도록 실험 파리에 박테리아를 주입하기 전에 PBS 제어 파리를 주입하는 것이 좋습니다. 항상 전체 실험에​​ 대해 동일한 바늘을 사용하는 것이 가능하지 않을 것이다. 그 경우에, 그것은 날아간로 사용하고, 통계적 분석 실험 인자로서 니들 ID를 포함하는 바늘 기록하는 것이 바람직 할 수있다.
  4. 세균성 병원균을 주입.
    1. 인젝터에서 나머지 멸균 미디어를 꺼내고 세균 정지와 같은 바늘을 보충.
    2. 지금 절차 2.2에서 제조 된 세균 서스펜션 파리를 주입 위의 절차 (3.1.3)를 반복합니다.

3.2) 정화조 바늘로 한 번 찌르기로

  1. 샤프트의 바늘을 준비합니다.
    1. 200 μL 마이크로 피펫 팁의 끝을 용융 용융 플라스틱으로 0.15 mm의 곤충 minutien 핀을 삽입합니다. 플라스틱 SU를 공고히 할 수 있도록 허용핀은 플라스틱으로 연장되는 핀의 약 0.5 cm로 고정되어 CH.
  2. 컨트롤을 부상 생성합니다.
    1. CO 2의 광 흐름하에 파리의 수를 마취.
    2. 날개와 다리의 부착 위치를 피하고, 바늘로 가슴의 sternopleural 판에 파리를 찌르. 필요한 경우, 부드럽게 부드러운 집게를 사용 minutien 핀에서 파리를 제거합니다.
      주 :. 복부의 표피를 통해 절개 그러한 ventrolateral 표면상의 전방 복부 등의 다른 부위에서 파리를 찌르하는 것도 가능하지만, 각 실험 내의 일관성 주사 부위를 유지하는 것이 중요하다 (17)는 더 많은 경향이있다 흉부의 따끔 따끔하기 때문에 덜 일반적입니다보다 어렵다.
    3. 파리의 모든 때까지 옆에 병을 놓고, 새로운 비행 매체와 신선한 유리 병에 찔려 파리를 놓고는 BE에서 파리를 방지하기 위해 마취에서 회복음식에 집착 오심.
  3. 세균 감염을 소개합니다.
    1. CO 2의 광 흐름하에 파리의 수를 마취.
    2. 각 플라이 샤프트 전에 절차 2.2 제조 세균 현탁액에 핀의 팁을 담그고, 각 미디어 컨트롤과 같은 위치에 티 찌.
    3. 파리의 모든 식품에 부착되는 것을 파리를 방지하기 위해 마취에서 회복 될 때까지 옆에 병을 놓고, 새로운 비행 매체와 신선한 유리 병에 찔려 파리를 놓습니다.

3.3) 감염성 투여 량 배달 평가

  1. 각 얼음에 microcentrifuge 관에 비행 장소 만 대신 마취에서 회복 식품 유리 병에 파리를 반환하는 절차 중 하나를 3.1 또는 3.2에서 상술 한 바와 같이 파리의 세트를 감염.
  2. 각각의 튜브에 PBS μL (250)을 추가하고 유봉 또는 비드 비터를 사용하여 파리를 균질화. </ 리>
  3. LB 한천 플레이트에 균질 플레이트 중 나선 플레이 터 또는 일련의 희석을 사용.
    1. 일련의 희석을 사용하여 판에, 96 웰 플레이트의 첫 번째 행으로 각 플라이 균질 옮긴다.
    2. PBS의 90 μL와 나머지 행의 각 웰을 입력합니다.
    3. 멀티 채널 피펫을 사용하여, 균질 비행과 두 번째 행에 분배가 포함 된 첫 번째 행에서 10 μl를 가져 가라.
    4. 피펫은 위아래로 최소 10 배는 철저하게 혼합하고, 다음 10 μl를 타고 세 번째 행에 전송합니다. 나머지 행을 사용하여이 절차를 반복합니다.
    5. 맨 아래 행 (대부분의 박테리아 현탁액을 희석)에서 시작, 샘플이 서로 접촉하지 않는 별도의 명소로 분배된다 돌보는, LB 플레이트에 각 웰과 예금에서 10 μl를 적용하려면 멀티 채널 피펫을 사용합니다. 모든 우물 LB 플레이트에 희석 내림차순을 분배, 각 행에서 샘플링 될 때까지 반복합니다. 반점이 완전히 LB 플레이트에 배어 때까지 실온에서 접시를 남겨주세요.
      주의 : 사용 전 실온에서 며칠 동안 LB 플레이트를 건조 시료 스폿 간의 접촉 사고의 가능성을 최소화 액체가 용이하게 흡수되도록 권장된다.
  4. 식민지가 작은 및 이산 남아 있도록 판을 자라다 않도록주의하면서, O / N 번호판을 품어.
    참고 : 사용 된 박테리아 성장 배지와 배양 온도에 따라, 파리의 내생 장내 미생물에서 유래 식민지 결국 접시에 나타날 수 있습니다. 그러나, 병원성 감염에 사용되는 대부분의 박테리아는 37 ° C에서 LB 한천의 장내 미생물보다 훨씬 빠르게 성장한다.
  5. 실험 세균이 눈에 보이는 식민지를 성장시 인큐베이터에서 접시를 제거 (일반적으로 8-12 시간)를,하지만 초파리 장내 미생물의 식민지 (약 36 시간)를 표시하기 전에. 느린 성장 실험 박테리아, 선택적을 사용LB 한천 항생제는 장내 미생물에서 모든 식민지를 제거합니다.
  6. 각각의 균질에 대한 식민지의 수를 계산합니다.
    1. 나선형 플레이트, 플레이트에 콜로니의 개수 및 위치에 기초하여 균질 1 ㎖ 당 세균 부하를 추정 할 수있다 자동 콜로니 계수기를 사용하여 성장 콜로니를 카운트.
      주 : 세균성 mL의 농도가 5 × 10 2 10 4 5 × 박테리아의 범위에있을 때 나선 수가 가장 정확하다.
    2. 자리 판의 경우, 수동으로 희석 (30)가 포함되어 중 각 비행에 대한 식민지 수 - 300 식민지를 원래 균질 1 ㎖ 당 세균의 수를 계산합니다.

감염 4. 특성화 생존자

  1. 분석 사망률 포스트 분사.
    1. 12시 12분 LIG와 (25 ° C를 신선한 유리 병에 감염된 파리 상처 컨트롤을 놓고 원하는 온도에서 인큐베이터에서 유지HT : 어두운주기 권장). 그것은 15 개 이상의 생활 파리를 계산하는 것이 어렵게된다으로 단일 유리 병에 15 개 이상의 파리를 넣지 마십시오.
    2. 매일 생활과 죽은 파리의 수를 계산, 또는 더 자주 해당되는 경우.
    3. 식품의 품질을 유지 정기적으로 새로운 음식에 파리를 반전하기 위해.
      1. 유리 병은 남성이 포함되어있는 경우, 3 일마다 신선한 유리 병에 전송할 수 있습니다. 유리 병은 여성이 포함 된 경우 애벌레 자손이 음식을 액화 때문에, 그 성인 파리가 붙어 인해 감염 사망의 과대 평가 요금의 결과로 얻을 수있는 위험이 증가 이틀 신선한 유리 병에 전송할 수 있습니다.
  2. 통계적 데이터를 분석한다.
    1. 개인이 로그 - 순위 (T)를 사용하여 쌍대 비교를, 교차하지 않는 생존 곡선 (18). 측정 시간 포인트 포스트 분사에 살아남을 수행 할 확률을 나타내는 카플란 - 마이어 곡선, 같은 플롯 생존(또한 벽난로 콕스 테스트라고도 함) 또는 여러 가지 요인과의 상호 작용을 통합 할 수 있습니다 콕스 비례 위험 모델을 사용하여보다 복잡한 분석을 수행 EST. 교차 생존 곡선, 계층화 콕스 분석을 수행한다. (17)

5. 분석 세균 후 감염을로드

  1. 박테리아 부하를 측정한다.
    1. 소정의 시간 후 분사에서, 감염에 걸쳐 세균 부하를 결정하는 감염성 투여 량을 평가하기 위해 사용 된 절차를 반복한다 (프로토콜 3.3 참조).
      주 : 나선형 도금 공을 사용하면 세균 현탁액 1,000의 범위 내에 들도록, 균질 물을 희석 - 10 ml의 세균 당.
  2. 데이터를 분석 할 수 있습니다.
    1. 세균 부하가 비정규이면, 더 정규 분포에 근사하거나 비모수 통계 분석 (예 만코 휘트니 U 시험)를 사용하여 데이터를 분석하는 데이터를 변환하거나. F에 박스 콕스 분석을 사용하여최적의 변환을 산업사; 자연 로그 또는베이스 -10 로그 변환은 종종 효과적이다. (19)
    2. 데이터가 충분히 정규 분포와 대조되는 두 치료법이 존재하는 경우, 두 가지 치료법은 평균 세균 부하 발생 여부를 확인하는 t -test를 수행. 여러 실험 변수 나 기타 잠재적으로 예측 인자가있는 경우, 분산 분석 (ANOVA)이 세균 부하의 중요한 예측 인자가되는 요인을 결정하는 데 사용합니다. (19)

면역 시스템의 유전자 6. 분석 전사 활성화

  1. 조악 전술 한 바와 같이 항균 펩타이드 유전자의 프로모터의 통제하에 녹색 형광 단백질 (GFP)을 표현하는 유전자 변형 파리를 감염, 감염 후 면역 활성화를 시각화합니다. (18)
  2. 형광 가능한 현미경에 감염된 파리를보기; GFP 유도는 visib이되어야감염 후 10 시간 - 첫 6 내의 지방이 몸에 제작.
  3. 면역 활성화의보다 정확한 정량, 항균 펩타이드 유전자 전 사체의 풍요 로움을 측정하기 위해 cDNA를 템플릿 (QRT-PCR)에 정량 PCR을 사용합니다.
    주 : 면역 유전자의 발현 (또는 이전) 감염 후 언제라도 측정 될 수있다. 일반적으로, 면역 유전자 발현의 유도는 다음 24 시간에 걸쳐 주입하고 증가 후 약 4 시간을 시작한다.
    1. CO 2를 사용하여 파리를 마취.
    2. 각각의 RNA 추출을위한 미세 원심 분리 관에 15 파리를 놓습니다.
      주 : 각 처리 조건에 대해 최소한 세 개의 복제 샘플을 수집하는 것이 좋습니다.
    3. 파리에서 RNA를 추출하고 표준 절차 또는 상업적 키트의 숫자 중 하나를 사용하여 첫 번째 가닥의 cDNA를 생성합니다. -80 ° C에서 저장 RNA. 몇 주일의 기간 동안 -20 ℃에서 및 장기 저장을 위해 -80 ℃에서 보관 된 cDNA. RNA 추출에 앞서, 점포 F-80 ° C에서 자리 잡고 있습니다.
    4. 템플릿으로의 cDNA를 사용하여 관심의 대상 유전자 정량 PCR (qPCR에)을 수행합니다. 항균 펩타이드 유전자 Diptericin, Drosomycin, Defensin, AttacinMetchnikowin뿐만 아니라 (또한 rpL32라고도 함) 가사 제어 유전자 rp49를 증폭 프라이머 서열은 표 1을 참조하십시오.
      참고 : 항균 펩타이드 Diptericin과 Drosomycin를 코딩하는 유전자는 D의 아주 좋은 판독을 제공 각각 IMD 및 수신자 경로를 통해 주로 유도 된 면역 활동을 melanogaster의. 샘플 간 RNA 수율의 변화 및 역전사의 효율을 제어하기 위해, 발현 등 rp49 (또한 RPL으로 알려져 감염 변하지 않을 것으로 예상되는 기준 키핑 유전자에 대해 대상 유전자의 기록 발현 표준화 32).
    5. 데이터를 분석 할 수 있습니다. <OL>
    6. 발현 차이의 거친 근사를 들어, 테스트 유전자로부터 얻어지는 초기 량 (SQ) 값의 비를 계산한다 (예를 들면, Diptericin A) 참조 유전자로부터 얻어지는 SQ 값에 대하여 (예를 들어, rp49) 각 샘플은 (환산 SQ - DPTA / SQ - rp49). 이러한 감염되지 않은 대조군으로서 취급 기준 제어 처리를 이러한 비율을 규모. 임의로 1.0 동일한 제어 발현 수준을 설정하고 상대 배 변화와 같은 실험 치료를 시각화. 알려진 양의 cDNA의 희석 시리즈에서 생성 된 표준 곡선에 대한 각각의 유전자에 대한 SQ 값을 추정한다.
      참고 : 비율의 통계 분석은 복잡 할 수 있으므로이 방법은 엄격한 분석을위한보다 빠른 접근을 위해 더 낫다. PCR 효율이 낮은 경우, 가능하면 PCR 반응 속도를 향상시키기 위해 새로운 프라이머를 설계한다. 완벽에 가까운 효율 (광고와 qPCR의 반응에 대한PCR 생성물 매 사이클)의 oubling는 임계 사이클 (C T)는 SQ 값으로 치환 될 수있다.
    7. 최적의 효율적인 증폭 간단한 실험을 위해, 데이터는 ΔΔC T 방법을 사용하여 분석 될 수있다. (19)를 각 샘플에 대해, 시험 유전자의 C T (예., Diptericin에서 참조 유전자의 C T 값 (예를 들면, rp49)를 빼기 A) ΔC (T)를 얻었다. 그런 다음 각 샘플에 대한 ΔΔC T 값을 산출하기 위해 각 실험 샘플에 대한 ΔC T에서 기준 제어의 ΔC (T)를 빼기; 이 ΔΔC T 2 (-ΔΔCT)는 식의 배 변화에 근접 치료, 사이의 유전자 발현 수준의 상대적 차이를 나타낸다.
      참고 : 표적 유전자의 발현이 분석이 잘못 평가할 심하게 할 수 접이식 변경하는 경우 테스트 유전자 또는 기준 중 하나의 PCR유전자는 낮은 효율을 갖는다.
    8. 가장 엄격한 분석을 위해 반응 변수로 시험 유전자 (예 Diptericin A)의 추정 식 및 설명 변수로서 제어 유전자 (예 rp49) 및 기타 실험 인자의 추정 식을 사용하여 변동 (ANOVA)의 분석을 수행.
      참고 :이 방법은 PCR 증폭의 비 효율성에 상대적으로 강력하고 더 복잡한 실험 설계의 분석을 할 수 있습니다.

Representative Results

이 섹션은 1 감염 투여 량은 주사에 사용되는 박테리아 현탁액의 광학 밀도 변화 것을 보여준다. 초파리의 세균 감염 후에 얻을 수있다 결과를 도시하고, 확실하게 균질화 및 도금에 의해 추정 될 수 전달 용량은 주사 후 곧바로 날아 . 도 2에 도시 된 바와 같이, 다른 병원체는 용량 의존적 (도 2B)가 될 수있는 호스트 사망률 (도 2A) 및 호스트 사망률 상이한 레벨을 일으킬 수있다. 중요한 것은,이 프로토콜은 감염의 다른 유형이 달성 될 수 있습니다 : 프로 비던 시아 레트 게리 20 일 이상 (그림 3A) 동안 지속 만성, 하위 치명적인 감염을 일으킬 수 있습니다. 그러나 Escerichia 대장균 같은 다른 박테리아는 대부분 육시간 후 감염 (그림 3B)에서 호스트 플라이에 의해 삭제됩니다. 면역 SYS의 유도TEM은 항균 펩티드 사체 (도 4A 및 B)의 RNA 분리 및 후속 QRT-PCR을 통해 추정 할 수있다. 유사하지만 덜 정량적, 항균 펩타이드 유전자 프로모터의 조절하에 GFP를 발현하는 면역 시스템 (도 4C)의 유도를 가시화하는 데 사용될 수 날아간다.

그림 1
. 그림 1 : 감염성 투여 량을 결정 파리 광학 밀도 (0.0001-0.05)의 범위를 커버하는 세균 현탁액의 50 NL 주사 하였다. 파리 바로 균질화되었고 주입에 의해 도입 된 박테리아의 수를 결정하는 도금. 초기 박테리아 하중이 강하게 초기 OD 주입과 상관 (R 2 = 0.96)

그림 2
(A) 야생형 날아간 세 종 중 하나로부터 약 5,000 박테리아 주사 하였다. 호스트 사망률의 비율은 감염에 사용되는 박테리아 종에 크게 의존한다. 50, 500, 5,000 및 플라이 박테리아 - (B) 야생형 초파리는 Enterococcous 칼리스 세 가지 투여 량으로 주사 하였다. 면역계 돌연변이 및 야생형 동종 제어 라인은 약 500 부르크 홀데 리아 cepacia 주사 하였다 높은 감염성 투여 량 (C)로 감염된 경우 파리는 더 빨리 죽지. 페어 로그 - 순위 비교 야생형 비행 돌연변이보다 훨씬 더 잘 감염 (χ 2 = 59.02, DF = 1, P <0.0001) 남아 있음을 보여준다.


그림 3 :. 사출 파리 후 세균 하중은(A) 5,000 주사 하였다 레트 게리 (B) 3400 E. 대장균. 세균 부하는 주사 후 즉시 후속 다양한 시점에서 측정되었다. 각 데이터 포인트는 하나의 플라이의 박테리아 하중을 나타낸다. E.을 대장균 신속하게 피하면서 도전 호스트에서 지워집니다 레트 게리는 호스트의 삶의 나머지를 위해 계속 ,.

그림 4
그림 4 : 주사 후 면역 유전자 발현의 유도. (A)는 파리 P. 50 NL 주사했다 복부 또는 흉부 중 하나에 레트 게리 또는 멸균 PBS, 또는 CO 제외하고 조작되지 남았다 Diptericin RNA의 분리 및 발현을 위해 수집 하였다. (A) 발현 수준은 Diptericin의 비로 rp49 사체에 전사를 그래프 화하고, N (CO 2 컨트롤 바는 각각의 상태로부터 비의 평균 및 표준 오차를 나타낸다 (1)의 발현 수준을 가지는 것으로 정의되도록 스케일링 = 4). (B) 발현 수준은 표준 유도되지 않은 상태로 사용 CO 2 aesthesia 제어 파리에서 평균 C T 값이 ΔΔCT 그래프로된다. 막대는 각 조건에서 ΔΔC T의 평균과 표준 오차를 나타낸다 (N = 4). 주입으로 인해 사이트의 전사 유도의 차이 없지만, 패널 및 B의 비교 ΔΔC T 방식은 잠재적으로 유도 수준을 과대 평가하는 방법을 보여준다. (C)는 프로모터 P. 50 NL 주사 하였다 Diptericin의 통제하에 GFP를 발현 날아간 레트 게리 (OD = 0.1) 후 7 일 후에 군데. GFP 패널은 Diptericin의 활성화 세균에 감염된 파리에서 발기인하지만 미디어 주입 컨트롤을 나타내는 감염된 파리의 복부 지방 본문에 GFP의 발현을 보여줍니다.

유전자 앞으로
rp49 (또한 rpL32라고도 함) 5 'AGGCCCAAGATCGTGAAGAA 3' 5 'GACGCACTCTGTTGTCGATACC 3'
Diptericin 5 'GCGGCGATGGTTTTGG 3' 5 'CGCTGGTCCACACCTTCTG 3'
Drosomycin 5 'CTGCCTGTCCGGAAGATACAA 3 ' 5 'TCCCTCCTCCTTGCACACA 3'
Defensin 5 'GAGGATCATGTCCTGGTGCAT 3' 5 'TCGCTTCTGGCGGCTATG 3'
Attacin 5 'CGTTTGGATCTGACCAAGG 3' 5 'AAAGTTCCGCCAGGTGTGAC 3'
Metchnikowan 5 'AACTTAATCTTGGAGCGATTTTTCTG 3' 5 'ACGGCCTCGTATCGAAAATG 3'

표 1 : QRT-PCR 프라이머.

Discussion

여기에 설명 된 절차는 초파리의 엄격하고 높은 품질의 감염을 산출한다. 도시 된 예는 주로 비던 레트 게리와 E 감염에 초점을 맞추고 대장균하지만 프로토콜 적응력이며 호스트 사육 및 관리 조건의 범위에서 다양한 세균 감염에 적용될 수있다.

최적의 실험 방법의 세부 사항은 감염에 사용되는 세균 숙주의 유전자형, 전반적인 실험 조건에 의존 할 것이다. 그것은 강력하게 새로운 실험 조건 더 야심 찬 프로젝트를 시작하기 전에 파일럿 테스트하는 것이 좋습니다. 좋은 출발점은 100 배의 범위에서 세 감염 량을 테스트하는 것이다. 플라이 100 균체 - 매우 독성이 강한 병원균은 종종 최상의 10 정도의 매우 낮은 감염성 투여 량으로 도입된다. 더 온건 한 병원균은 FL 당 약 1,000 박테리아의 높은 용량으로 주입 될 수있다y 및 비 병원균은 박테리아 플라이 10,000만큼 높은 용량으로 주입 될 수있다. 그것은 세로 시계열상에서 병원균 부하 호스트 사망률 면역계 활성을 추적하여 새로운 감염의 역학을 정의하는 것이 유익하다. 병원체로드 및 호스트 유전자 발현의 측정이 파괴 분석이기 때문에, 그것을 측정 할 때마다 포인트에 대한 실험의 초기에 뚜렷한 파리를 감염시킬 필요가있다.

바늘로 한 번 찌르기 또는 마이크로 모세관 기반 주입을 사용할지 여부를 결정할 때, 이것은 장점과 한계 각 접근법에 존재 주목하는 것이 중요하다. 모세관 주입 모두 적당한 팽압을 증가시키고 염 또는 현탁 또는 담체에 용해 된 다른 분자를 도입 플라이으로 액체의 부피를 도입한다. 모세관 주입은 필요한 장비의 주입 시설 또는 구매에 액세스 할 수 있어야합니다. 정화조 바늘로 한 번 찌르기가 더 특별 장비 및 소개가 필요하지 않습니다무시할 플라이에 용지와는 일반적으로 날아간 다수의 감염에 더 효율적이다. 그러나 바늘로 한 번 찌르기 감염은 모세관 주입 달성 할 수 감염 량을 통해 정밀하게 제어 할 수 없습니다. 본 프로토콜은 기계적 주입량을 조절 사출 장치에 집중하지만, 가압 된 공기의 이산 펄스에 기초하여 주입 시스템도있다. (20, 21)이 일반적으로 장치가 여기에 추천보다 비싸며 각 공기 펄스의 보정을 필요 순서대로 바늘 일관된 주입 볼륨을 확인합니다.

파리는 야생에서 박테리아와 체계적으로 감염 될 방법에 대한 상당한 논쟁하지만 약간의 데이터가 있습니다. 일부 연구자들은 초파리가 병원성 박테리아를 섭취 할 때 자연 감염의 대부분이 발생 박테리아 이후 전신 감염을 설정하기 위해 장을 탈출 할 수있는 멋 부리다. 그러나, FE 매우있다알려진 W 박테리아는 D의 장을 통과 할 수 있도록 melanogaster의,이 기능을 수행하는 사람들은 파리 (22, 23)에 매우 치명적이다. 또 다른 이론은 실패 포식 시도 나 ectoparasitic 진드기의 공격으로부터 탈출을 통해 cuticular 부상을 유지 정기적으로 운항하는 것입니다. 이 가설은 야생 D의 빈번한 수집에 의해 지원됩니다 치유 상처 (게시되지 않은 관찰)을 가리킨다 melanization 명소 베어링 melanogaster의. 진드기 초파리 24 세균 감염을 송신하는 것으로 나타났다 진드기 남긴 상처 이차적 꿀벌 25 세균에 의해 감염 될 수있다. 그러나 D의 중심 진드기 또는 기타 기회 감염의 자연 주파수 표피 침해 통해 melanogaster의는 알려져 있지 않다. 여기에 설명 된 프로토콜은 직접 상피 장벽 또는 행동 면역 글로불린을 무시 정량 주입을 통해 체액에 박테리아의 도입을 허용NITY. D.에 병원성 박테리아를 공급하기위한 방법 Vodovar melanogaster의 외. 22 Nehme 외. (23)에 기재되어있다.

많은 곤충 병원성 박테리아는 연구자들이 편안하게 그들과 함께 작업 할 수 있도록, 거의 또는 전혀 인간의 건강에 위험을 초래할. 또한, 소수의 세균 실험의 개입없이 접촉에 초파리를 감염 할 수있는 능력 때문에 오염 된 표면을 통해 실험을 통해 세균 감염의 "전염병"확산의 위험이 있거나 일반적으로 매우 낮은 파리를 탈출했다. 그럼에도 불구하고, 적절한 봉쇄 조치가 탈출 감염된 파리를 방지하기 위해 장소에서 어떤이 파리를 탈출 탈환을 위해 있는지 확인하는 것이 좋습니다. 실험실에서 사용되는 병원균의에 상응하는 생물학적 안전 수준이 장착되어야하며, 미생물학 표준 모범 사례를 채용해야한다.

실험 infecti여기에 설명 된 방법에 임의의 박테리아의 용량을 가진 초파리 melanogaster의 감염 수 있습니다. 감염이 확립되면, 세균 증식이나 간극의 동역학을 측정하는 호스트 사망률을 추적하고, 숙주 면역계의 유도를 분석하기 쉽다. 감염된 초파리 용이하게 형성되거나 또는 감염에 의해 형성되는 생리 기능의 테스트를 포함하는 다른 표현형 분석을 거치게 될 수있다. 설명 된 절차는 저렴 상대적으로 적은 특수 장비를 필요로하고, 쉽게 연구 및 교육 연구소의 폭에 걸쳐 다양한 프로젝트에 사용하기에 순종하고, 알게된다.

Materials

Name Company Catalog Number Comments
Incubator Powers Scientific, Inc DROS52SD
Paintbrush
CO2 Flypads FlyStuff 59-114
CO2 Airgas CD FG50
Drosophila rearing mix 
6 oz Square Bottom Bottles, polypropylene Genesee Scientific 32-130
Nosterile Extra Large Cotton Balls Fisher brand 22-456-882
Microscope Olympus Corporation SZ51
Drosophila Vials polystyrene VWR international 89092-720
Nosterile Large Cotton Balls Fisher brand 22-456-883
2 L flask VWR international 89000-370
Petri Dishes with Clear Lids, Raised Ridge; 100 x 15 mm; VWR international 25384-302
LB Agar, Miller Difco 244520
Innoculing Loop VWR international 80094-488
Rainin Clasic Pipettes in various sizes
0.1 µl to 2 µl,
2 µl to 20 µl,
20 µl to 200 µl,
100 µl to 1,000 µl
Rainin PR-2
PR-20
PR-200
PR-1000
Micropipette tips (assorted sizes) VWR international 30128-376
53503-810
16466-008
Luria Broth Base, Miller Difco 241420
Disposable Culture Tubes Borosilicate Glass VWR international 47729-576
S-500 Orbital Shaker VWR international 14005-830
Centrifuge VWR international 37001-300
PBS pH 7.4 10X Invitrogen 70011044
SmartSpec 3000 Spectrophotometer Bio-Rad 170-2501
Semimicrovolume Cuvettes Bio-Rad 223-9955
Vertical Capillary Puller Kopf Needle Pipette Puller
3.5'' Replacement glass Capillaries for Nanojet II Drummond Sientific Company 3-000-203-G/X
Nanoject II Drummond Sientific Company 3-000-204
Forceps Fine Science Tools 11255-20
10 ml Syringe BD 309604
Mineral Oil, White, light Macron Fine Chemicals 6358-10
Minutein pins Fine Science Tools 26002-10
1.5 ml  Microcentrifuge tubes; Seal Rite USA Scientific Inc. 1615-5500
Motorized Pestle; Talboys Laboratory Stirrer Troemner 103
Talboys High Throughput Homogenizer OPS Diagnostics 930145
5/32'' Grinding Balls OPS Diagnostics GBSS 156-5000-01
Vortex Genie Scientific indurstries inc. G560
Multichannel Pipettor (10 μl - 300 μl) Sartorius 730360
WASP2 Whitley Automated Spiral Plater Microbiology International
ProtoCOL automated colony counter / plate counter/ plate reader  Microbiology International
TRIzol Life Technologies 15596-026
qPCR tubes; Low-Profile 0.2 ml 8-Tube Strips Bio-Rad TLS0801
qPCR caps; Optical Flat 8-Cap Strips Bio-Rad TCS0803
RQ1 RNase-Free DNase Promega m610a
M-MLV Reverse Transcriptase Promega m170b
dNTPs Promega U1240
Oligo-dT IDT
 SsoAdvanced SYBR Green Supermix Bio-Rad 172-5260
CFX Connect Real-Time PCR Detection System Bio-Rad 185-5200
RNasin Ribonuclease Inhibitor Promega N2115

DOWNLOAD MATERIALS LIST

References

  1. Lemaitre, B., Hoffmann, J. The host defense of Drosophila melanogaster. Annual review of immunology. 25, 697-743 (2007).
  2. Dionne, M. S., Schneider, D. S. Models of infectious diseases in the fruit fly Drosophila melanogaster. Disease models & mechanisms. 1, (1), 43-9 (2008).
  3. Rutschmann, S., Jung, A. C., Hetru, C., Reichhart, J. M., Hoffmann, J. A., Ferrandon, D. The Rel protein DIF mediates the antifungal but not the antibacterial host defense in Drosophila. Immunity. 12, (5), 569-580 (2000).
  4. Ayres, J. S., Freitag, N., Schneider, D. S. Identification of Drosophila mutants altering defense of and endurance to Listeria monocytogenes infection. Genetics. 178, (3), 1807-1815 (2008).
  5. Cronin, S. J. F., et al. Genome-wide RNAi screen identifies genes involved in intestinal pathogenic bacterial infection. Science. 325, (5938), 340-343 (2009).
  6. Neyen, C., Bretscher, A. J., Binggeli, O., Lemaitre, B. Methods to study Drosophila immunity. Methods. (2014).
  7. Dionne, M. S., Pham, L. N., Shirasu-Hiza, M., Schneider, D. S. Akt and FOXO dysregulation contribute to infection-induced wasting in Drosophila. Current biology CB. 16, (20), 1977-1985 (2006).
  8. McKean, K. a, Yourth, C. P., Lazzaro, B. P., Clark, A. G. The evolutionary costs of immunological maintenance and deployment. BMC evolutionary biology. 8, (1), 76 (2008).
  9. Kuo, T. -H., Pike, D. H., Beizaeipour, Z., Williams, J. A. Sleep triggered by an immune response in Drosophila is regulated by the circadian clock and requires the NFkappaB Relish. BMC neuroscience. 11, 17 (2010).
  10. Panayidou, S., Ioannidou, E., Apidianakis, Y. Human pathogenic bacteria, fungi, and viruses in Drosophila: disease modeling, lessons, and shortcomings. Virulence. 5, (2), 253-269 (2014).
  11. Keebaugh, E. S., Schlenke, T. A. Insights from natural host–parasite interactions: The Drosophila model. Developmental & Comparative Immunology. 42, (1), 111-123 (2014).
  12. Howick, V. M., Lazzaro, B. P. Genotype and diet shape resistance and tolerance across distinct phases of bacterial infection. BMC evolutionary biology. 14, (1), 56 (2014).
  13. Babin, A., Kolly, S., Kawecki, T. J. Virulent bacterial infection improves aversive learning performance in Drosophila. Brain, behavior, and immunity. (2014).
  14. Chambers, M. C., Song, K. H., Schneider, D. S. Listeria monocytogenes infection causes metabolic shifts in Drosophila melanogaster. PLoS ONE. 7, (12), e50679 (2012).
  15. Fellous, S., Lazzaro, B. P. Larval food quality affects adult (but not larval) immune gene expression independent of effects on general condition. Molecular ecology. 19, (7), 1462-1468 (2010).
  16. Stone, E. F., Fulton, B. O., Ayres, J. S., Pham, L. N., Ziauddin, J., Shirasu-Hiza, M. M. The circadian clock protein timeless regulates phagocytosis of bacteria in Drosophila. PLoS pathogens. 8, (1), e1002445 (2012).
  17. Chambers, M. C., Jacobson, E., Khalil, S., Lazzaro, B. P. Thorax injury lowers resistance to infection in Drosophila melanogaster. Infection and immunity. (2014).
  18. Rich, J. T., Neely, J. G., Paniello, R. C., Voelker, C. C. J., Nussenbaum, B., Wang, E. W. A practical guide to understanding Kaplan-Meier curves. Otolaryngology--head and neck surgery official journal of American Academy of Otolaryngology-Head and Neck Surgery. 143, (3), 331-336 (2010).
  19. Freeman, W. H. Biometry. (1995).
  20. Frydman, H. Wolbachia bacterial infection in Drosophila. Journal of visualized experiments JoVE. (2), 158 (2007).
  21. Kuo, T. -H., Handa, A., Williams, J. A. Quantitative measurement of the immune response and sleep in Drosophila. Journal of visualized experiments JoVE. (70), e4355 (2012).
  22. Vodovar, N., et al. Drosophila host defense after oral infection by an entomopathogenic Pseudomonas species. Proceedings of the National Academy of Sciences of the United States of America. 102, (32), 11414-11419 (2005).
  23. Nehme, N. T., et al. A model of bacterial intestinal infections in Drosophila melanogaster. PLoS pathogens. 3, (11), e173 (2007).
  24. Jaenike, J., Polak, M., Fiskin, A., Helou, M., Minhas, M. Interspecific transmission of endosymbiotic Spiroplasma by mites. Biology. 3, (1), 23-25 (2007).
  25. Kanbar, G., Engels, W. Ultrastructure and bacterial infection of wounds in honey bee ( Apis mellifera) pupae punctured by Varroa mites. Parasitology research. 90, (5), 349-354 (2003).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics