Plasmid-avledet DNA Strand Displacement Gates for Implementing kjemisk reaksjon Networks

Biology
 

Cite this Article

Copy Citation | Download Citations

Chen, Y. J., Rao, S. D., Seelig, G. Plasmid-derived DNA Strand Displacement Gates for Implementing Chemical Reaction Networks. J. Vis. Exp. (105), e53087, doi:10.3791/53087 (2015).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Forutsigbarheten Watson-Crick baseparing har tillatt dynamisk DNA nanoteknologi til å fremstå som en programmerbar måte å designe molekylære enheter med dynamiske egenskaper 1,2. Spesielt DNA tråd forskyvning - en programmerbar, konkurranse hybridisering reaksjon - har vist seg å være en effektiv mekanisme for å konstruere dynamiske DNA-systemer. I en DNA tråd forskyvning reaksjon, fortrenger en innkommende oligonukleotid en tidligere bundet "output" tråd fra en utfyllende bindende partner. Flere slike reaksjoner kan være lenket sammen i flere trinn reaksjons kaskader med en høy grad av kontroll over rekkefølgen og tidspunktet for individuell reaksjon trinn 3. DNA-tråd fortrengning kaskader har blitt brukt til å lage digitale og analoge molekylære kretser 4-7, valgbar nanostrukturer 8-10, autonome molekylære motorer 11-15, og ikke-kovalente katalytiske forsterkere 13,16-21. Videre DNA enheter ved hjelp av trådfortrengningsreaksjoner kan simuleres og designet for ulike applikasjoner ved hjelp av dataassistert design software 22-24.

Foreløpig kjemisk syntetiserte DNA fungerer som det viktigste materialet for DNA nanoteknologi. Imidlertid feil i DNA-synteseprosessen, og de resulterende imperfect oligonukleotider, antas å begrense ytelsen av dynamiske DNA-enheter ved å forårsake feilaktige bireaksjoner. For eksempel "lekkasje" reaksjoner kan resultere i frigjøring av en utgang oligonukleotid selv i fravær av en reaksjon utløser. Slike effekter er mest åpenbare i autokatalytiske reaksjon kaskader, hvor til og med en minimal mengde av initial lekkasje vil til slutt resultere i full aktivering av kaskaden 19,20. Omvendt, reaksjoner ofte mislykkes i å nå forventet nivå på aktiverings fordi enkelte komponenter ikke utløser selv i nærvær av den tiltenkte inngangs 7,25. For å gjøre resultatene av DNA-basertenanodevices sammenlignbare med deres biologiske proteinbaserte motstykker, slike feilmodi må bli dramatisk redusert.

Bakterielle plasmider eller annet biologisk DNA kan tjene som en forholdsvis billig kilde til høyrent DNA for nanoteknologi. Store mengder DNA kan genereres ved replikasjonen i bakterier, og de iboende korrektur evnene til levende systemer sikrer renheten av det resulterende DNA. Faktisk har flere nyere papirer anerkjent potensialet nytten av biologisk DNA for nanoteknologi programmer 21,26-28. Imidlertid har det fullstendig dobbelt-trådet plasmid DNA natur hittil forbudt å bruke som materiale for fremstilling av dynamiske DNA-enheter, som vanligvis består av flere oligonukleotider og inneholder både dobbelt-trådet og enkelt-trådede domener. I en nyere artikkel 29 dette problemet ble adressert og en ny DNA gate arkitektur som består i hovedsak av bretter dobbelttrådet DNA (ndsDNA) var introdusered.

Viktigere, kan systemer av ndsDNA porter være utformet som skjønner dynamikken spesifisert av noen formell kjemisk reaksjon nettverk (CRN) 29. ndsDNA porter kan således anvendes, i prinsippet, å skape dynamiske systemer som utviser svingninger og kaos, bistabilitet og hukommelse, boolsk logikk eller algoritmiske atferd 30-38. For eksempel, Ref. 29 vist en tre-reaksjon CRN som ga en molekyl gjennomføring av en "konsensus" protokoll, en type distribuert beregningsalgoritme 29,39,40. Dette arbeidet først demonstrert en ny bruk for CRN formalisme som en "programmeringsspråk" for raskt å syntetisere funksjonelle molekylære systemer (figur 1A).

Her er en detaljert protokoll for å utlede ndsDNA porter fra plasmid DNA tilgjengelig. Først er en gjennomgang av sekvensen designprosessen. Deretter følger en forklaring på hvordan syntetiske oligonukleotider som inneholderport sekvensene er klonet inn plasmider og sekvens verifisert og forsterkes via bakteriekultur. Deretter blir det vist hvordan ndsDNA porter kan være avledet fra plasmidene ved enzymatisk behandling (se figur 2). Til slutt blir en fremgangsmåte for testing av porten ved hjelp av fluorescens-kinetiske oppførsel assays skissert.

Reaksjonsmekanisme
Som et eksempel, fokuserer protokollen på den katalytiske kjemiske reaksjonen A + B-> B + C. Arten A, B og C ("signaler", figur 1B) alle svarer til en annen enkeltkjedet DNA-molekyl. Sekvensene til disse molekylene er fullstendig uavhengige og trådene ikke reagerer med hverandre direkte. Sekvensene av alle signaler har to forskjellige funksjonelle domener, dvs. subsekvenser som fungerer sammen i tråd fortrengningsreaksjoner: 1) en kort toehold domene (etiketter ta, tb, tc) som brukes for oppstart av strand forskyvning reaction, og 2) en lang domene (etiketter a, b, c) som bestemmer signal identitet.

Interaksjoner mellom signal tilnærmingene er mediert av bretter doble DNA (ndsDNA) gate komplekser (kalt Delta AB og Fork BC) og hjelpe enkelttrådete arter (<tr r>, <b tr>, <c tb> og <i tc >). Den formelle Reaksjonen A + B-> B + C blir kjørt gjennom en serie av trådforskyvningsreaksjonstrinn, hvor hvert reaksjonstrinn utsetter fotfeste for en etterfølgende reaksjon (figur 1B). I dette eksempelet er signalene A og B er i utgangspunktet er fritt i løsning, mens signalet C er bundet til gaffelen porten. Ved slutten av reaksjonen B og C er i løsning. Mer generelt signaler som er bundet til en gate er inaktive, mens signaler som er fri i løsning er aktive, det vil si, de kan delta i en trådforskyvningsreaksjon somen inngang. Tidsforløpet av reaksjonen blir fulgt ved hjelp av en fluorescerende reporter strategi (figur 1C). I tidligere arbeid 29, ble det vist at denne reaksjonsmekanisme ikke bare realiserer den korrekte støkiometri, men også kinetikken til target-reaksjonen.

Protocol

1. Sequence Design

Merk: Sequence utforming oversikt: I denne delen, er strategien for å designe plasmid-avledet DNA porter beskrevet. Enzymseter plassert på hver sin ende av portene for å tillate utgivelsen av fullt doble strandet porter etter fordøyelse. Knekk nettsteder er så plassert slik at enzymer skape kutt på toppen tråd for å skape de endelige ndsDNA porter. Til slutt blir de gjenværende sekvensene velges slik at uavhengige domener er ortogonale til hverandre og oppviser ikke sekundærstruktur.

  1. Plasser Nt.BstNBI sammenpressing området fire nukleotider fra den 3'-enden av hver lang domene (a, b, c, r, og i). Plasser Nb.BsrDI sammenpressing området på 5 'enden av hver lang domene (a, b, c og r. Legg merke til at domenet ikke jeg ikke har noen Nb.BsrDI nicking stedet). Figur 2C viser detaljert sekvens visning av Bli med AB og Fork BC porter.
  2. Plasser PvuII restriksjonssetet på begge ender av ndsDNA portene, slik at PvuII fordøyelsen kan slippe portene fra plasmidene (se Figur 2C).
  3. Designe andre ubegrensede sekvenser ved å følge to prinsipper: (a) tråder bør ikke oppvise sekundære strukturer (DNA-strukturer kan forutsies ved hjelp av Nupack 41), og (b) alle domener bør være ortogonale for å redusere krysstale.
  4. Plasser ndsDNA sekvenser i sentrum av en port-mal. Plasser 30-40 bp tilfeldige avstands sekvenser på begge sider av porten mal, betjener hver avstands som en unik bindingssete for den følgende Polymerase Chain Reaction (PCR).

2. Kloning av NdsDNA Gates inn Plasmider

Merk: Denne delen beskriver Gibson kloning metode for å sette inn 4 eksemplarer av porten i et plasmid ryggrad.

  1. Bestill ndsDNA gate maler som dobbel-strandet genomiske kvartaler fra en DNA produsent (gate mal sekvenser visesi Tabell 1; trådene forekommer i ndsDNA porter er vist i tabell 2; domene nivå sekvenser er vist i tabell 3).
  2. Etter å ha mottatt den ordnede DNA, spinne rør inneholdende genomiske blokker på 10,000-14,000 xg i 1 min for å sikre at alle tørket DNA er på bunnen av røret.
  3. Resuspender de tørkede genomiske blokkene i DNase-fritt vann for å oppnå en sluttkonsentrasjon på 10 ng / mL.
    Merk: Alternativt kan DNA resuspenderes ved hjelp 1x Tris etylendiamintetraeddiksyre (EDTA) buffer (TE-buffer: 10 mM Tris og 1 mM EDTA, pH 8,0). Imidlertid er EDTA et chelateringsmiddel for toverdige kationer og kan hemme PCR.
  4. Generere 4 gate fragmenter med ulike overlappings regioner gjennom en standard PCR med en High-Fidelity DNA polymerase (se figur 3A). Primersekvensene er beskrevet i Tabell 4 (smeltetemperatur av disse primere er 62 ° C).
  5. Kjør en 2% agarosegel ved en40 V i 30 minutter ved romtemperatur (for en detaljert agarosegelelektroforese protokoll se 42), og kutte bånd tilsvarende hver PCR-amplifiserte fragment ut av gelen. Deretter rense gel skiver ved hjelp av en gel utvinning kit (se Materialet) etter produsentens anvisninger.
  6. Fordøye et høyt kopitall plasmid ryggraden (se materialer) med PvuII-PstI-HF og HF ved 37 ° C i 1 time (se tabell 5) i henhold til produsentens protokoll. PvuII-HF og Pstl-HF er høy fidelity restriksjonsenzymer, som dramatisk reduserer uspesifikke kutt.
  7. Kjør en 1,5% agarosegel og kutte linearized ryggrad (typisk kjøre gelen ved 140 V for 30-40 min ved RT). Deretter trekke ut DNA fra gelstykket bruker gel utvinning kit følge produsentens instruksjoner.
  8. Utføre Gibson sammenstilling 43 med den lineariserte vektor og rensede PCR-fragmenter (se tabell 6 og figur 3B
  9. Transform Gibson enheten produktet fra trinn 2.8 inn i Escherichia coli (E. coli) og en plate på lysogeni Broth (LB) agar plate inneholdende ampicillin antibiotika (ved en konsentrasjon på 100 ug / ml). Utføre transformasjon gjennom elektroporering eller et varmesjokk metode 44,45, og bruk riktig E. coli-stamme. Bruk for eksempel E. coli stamme JM109 for varme sjokk transformasjon, og bruke DH5a elektrokompetente E. coli-celler for elektroporering.
    Merk: plasmid ryggrad brukes inneholder en Ampicillinresistens kassett. Hvis du bruker en annen seleksjonsmarkør, bruke de riktige antibiotika i stedet for Ampicillin.

3. bakteriekultur Amplification og kvalitetskontroll

Merk: Denne delen beskriver masseproduksjon og isolering av plasmider som inneholder DNA-portene etter kvalitetskontroll.

  1. Plukk en enkelt kolonifra Ampicillin selektive plate fra trinn 2.9 og inkuberes en kultur av 3 ml anriket medium inneholdende ampicillin antibiotika (ved en konsentrasjon på 100 ug / ml). Marker kolonien, slik at den kan utnyttes igjen i senere eksperimentelle trinn. Grow kulturen ved 37 ° CO / N med kraftig risting (200-300 rpm). Vanligvis inkuberes i 16-24 timer.
  2. Pakk ut plasmid DNA fra bakteriekultur ved hjelp av en Mini-prep kit følge produsentens instruksjoner.
  3. Mål renset plasmid DNA ved hjelp av et spektrofotometer følge produsentens instruksjoner. Typiske avkastning varierer fra 50-1,000 ng / mL.
  4. Få den ekstraherte plasmid-DNA sekvensert ved å sende prøven til et DNA-sekvense selskap. Sekvenseringsprimere bør ligge omtrent 100 nukleotider oppstrøms og nedstrøms for regionen som skal sekvenseres; sekvenseringsprimeren for plasmidet (se materialer for plasmid) har den følgende sekvens: ATTACCGCCTTTGAGTGAGC.
    Neite: Hvis det er sekvens feil eller rekombinasjon i den innsatte ndsDNA porter, velger du en annen koloni fra platen fra trinn 2.9. Følg trinn 3,1-3,4 å verifisere at sekvensene av de innsatte portene er riktige.
  5. Etter å ha kontrollert at sekvensene er riktige, velge den tilsvarende koloni fra Ampicillin selektiv plate (fra trinn 2.9), og inkuber en kultur på 800 ml Terrific Broth (TB) inneholdende ampicillin antibiotika (ved en konsentrasjon på 100 ug / ml). Dyrk kulturen ved 37 ° C i 16-24 timer med kraftig risting (200-300 rpm). TB er spesielt godt egnet for høyt utbytte plasmid produksjon.
    Merk: Alternativt LB kan også anvendes for å dyrke bakterier, selv om utbyttet plasmid kan være et problem.
  6. Rense DNA ved hjelp av en Maxi-prep kit følge produsentens instruksjoner.
  7. Følg trinn 03.03 til 03.04 for å sjekke om sekvensene er riktige. Hvis noen rekombinasjon skjedd, se følgende merknad. Ellers, gå videre til trinn 4. <br /> Merk: Et mulig problem her er at flere kopier av innsatte portene i plasmidet kan rekombinere grunn av DNA-reparasjon. For å løse dette problemet ved å bruke en E. coli-stamme som mangler recA-protein (et protein relatert til DNA-reparasjon) som JM109 eller DH5a å transformere en tidligere sekvens-verifisert plasmid (dvs. uten noen sekvensfeil og rekombinasjon). Deretter plukke en koloni fra denne platen, og kontroller plasmidet sekvensen ved å sende prøven til en DNA-sekvensering selskap.

4. Enzymatisk Processing

Merk: Dette kapitlet beskriver prosessen for bearbeider plasmidene slik at de er kuttet og bretter i de riktige stedene, og klar til å bli brukt for kinetikk eksperimenter.

  1. Fordøye det rensede plasmid-DNA fra trinn 3.7 med restriksjonsenzymet PvuII-HF i 1 time ved 37 ° C (se tabell 7). Typisk fordøye plasmid med 4 enheter av PvuII-HF per 1 mg plasmid. Høy fidelity restriksjonsenzymer anbefales til bruk fordi de dramatisk redusere uspesifikke kutt.
  2. Utføre etanolutfelling på prøven.
    1. Tilsett 2 ekvivalente volumer av iskald absolutt etanol til prøven.
    2. Inkuber blandingen ved -80 ° C i minst 1 time (denne blandingen kan også sitte ved -80 ° C i O / N).
    3. Sentrifuger ved 10,000-14,000 xg ved 0 ° C i 30 min.
    4. Fjern supernatanten.
    5. Legg 1,000 mL av RT 95% etanol til prøven, og invertere 10-15 ganger.
    6. Sentrifuger ved 10,000-14,000 xg ved 4 ° C i 10 min.
    7. Fjern supernatanten og lufttørke på benken i 10-20 min.
    8. Resuspender DNA-pelletene i et egnet volum av Nuclease fri H 2 O (typisk 100-200 ul). Tilsetning av mer enn 200 ul vil generelt gjøre prøven for tynn for bruk ved kinetiske eksperimenter.
  3. Mål resuspendert DNA ved hjelp av et spektrofotometer følge manufacturer anvisninger.
  4. Digest bli porter med sammenpressing enzym Nb.BsrDI ved 65 ° C i 1 time med 4 enheter enzym pr 1 pg plasmid (se tabell 8); fordøye gaffel porter med sammenpressing enzym Nt.BstNBI ved 55 ° C i 1 time ved bruk av 8 enheter av enzym pr 1 pg plasmid (se tabell 9).
    Merk: Trinn 4,2 fjerner enzym fordøyelsen buffer og hjelper konsentrere portene for kinetikk eksperimenter. Trinn 4.2 kan hoppes over for å delta porter fordi begge restriksjonsenzym PvuII-HF og nicking enzym Nb.BsrDI har samme fordøyelsen buffer. I trinn 4.2.8, blir Nuclease fri H 2 O ble anvendt istedenfor TE fordi EDTA er et chelateringsmiddel for toverdige kationer og kan hemme restriksjonsenzymer som trenger disse ioner til å fungere.
    Merk: Tilsetning av overskytende mengder av enzymer, kan føre til høye mengder av utgangskretsen lekkasje (figur 4), som er mest sannsynlig forårsaket av over-fordøyelse 46. Dette problemet can løses ved å optimalisere enzymmengder (se figur 4). Typisk utvalg av enzymer er fra 1-10 enheter / 1 ug plasmid.

5. Utarbeidelse av enkeltkjedet Oligonukleotider

Merk: Denne delen beskriver protokollen for resuspending og kvantifisere kjemisk syntetisert enkelttrådet DNA (ssDNA) som skal brukes for signal tråder og hjelpe tråder. For streng sekvenser, se tabell 10. Legg merke til at følgende protokoll er et eksempel på å forberede 10 mikrometer ssDNA. Andre konsentrasjoner av ssDNA kan fremstilles på lignende måte.

  1. Etter å ha mottatt DNA-oligonukleotider fra produsenten, spinne rør inneholdende DNA på 10,000-14,000 xg i 1 min for å sikre at alle tørket DNA er på bunnen av røret.
  2. Resuspender DNA ved bruk av 1 x Tris etylendiamintetraeddiksyre (EDTA) buffer (TE-buffer: 10 mM Tris og 1 mM EDTA, pH 8,0) for å oppnå en sluttkonsentrasjon på 100 uM. Tileksempel resuspender 8 nmol av DNA i 80 pl TE-buffer.
  3. Bland 10 ul av DNA på 100 um med 90 ul molekylært vann i et mikro-sentrifugerør, som skal oppnå en sluttkonsentrasjon på 10 uM.
  4. Måle den nøyaktige konsentrasjonen av DNA-prøven ved hjelp av et spektrofotometer følge produsentens instruksjoner. Følgende protokoll gir et eksempel på hvordan DNA-konsentrasjonen kan måles.
    1. Blank spektrofotometeret med 2 mL av molekylære vann.
    2. Mål absorbansen ved 260 nm (A 260) av DNA-prøven. Bruke følgende ligning for å beregne konsentrasjonen lager.
      Merk: Prøven konsentrasjonen er M = En 260 / ekstinksjonskoeffisient. Ekstinksjonskoeffisienten kan bli funnet på spesifikasjonen dataarket av DNA produsenten.

6. Utarbeidelse av Fluorescent Reporters

Merk: Denne delen beskriverprotokoll for å forberede Reporter C, kan Andre fluorescerende reportere settes sammen på samme måte.

  1. Rekkefølgen væskekromatografi (HPLC) rensede oligonukleotider ROX- <c * t c *> (den øverste streng av reporter C) og <c> -RQ (den nederste tråden i Reporter C) fra DNA produsenten (se tabell 10 for sekvenser ).
  2. Etter å ha mottatt syntetisert oligonukleotider, resuspender og kvantifisere prøvene som forklart i trinn 5.
  3. Bland reporter øverste og nederste strengene (dvs. ROX- <c * tc *> og <c> -RQ) i 1x Tris-acetat-EDTA (TAE) med 12,5 mm Mg 2+ (se tabell 11 for detaljert oppskrift ). Merk at her 30% overskudd quencher merkede tråd <c> -RQ tilsettes for å montere reporteren, som sikrer at alle fluoroforen merkede strengene er slukket selv med ufullkommen støkiometri.
  4. Gløde Reporter C-komplekset ved hjelp av en termosykler, avkjøling fra 95 ° C til 20 ° C med en hastighet på 1 ° C / min. Prøvene kan bli lagret ved 4 ° C.

7. fluorescensmålinger

Merk: Denne delen beskriver en generell protokoll for fluorescens kinetiske målinger (se figur 5 for den eksperimentelle prosedyre), og denne protokollen vil bli brukt i trinn 8, 9 og 10. Merk også at denne protokollen er for bruken av en spectrofluorimeter. Alternativt kunne disse eksperimentene også utføres i en plateleser selv om følsomheten, vel-til-brønn variasjoner og mangel på temperaturkontroll i langvarige forsøk kan være et problem.

  1. Sett temperaturkontrolleren til 25 ° C, og vente på at temperaturen har stabilisert seg. Ved hjelp av en temperatur-regulator kan redusere variasjoner i signalet som kan følge av temperaturvariasjon.
  2. Sett riktige parametere for kinetikk målinger i datainnsamling programvare av spectrofluorimeter. Detaljert eksempel Innstillingene er som følger:
    1. Still slissebredden til 2,73 nm for både eksitasjon og utslipps monokromatorer.
    2. Still integrasjonstiden til 10 sekunder for hvert 60. sekund tids punkt. Angi den totale måletiden til 24 timer.
    3. Still-eksitasjons- / emisjonsbølgelengder som passer fluoroforene som brukes i forsøket. Eksempel bølgelengder er som følger: ROX (588 nm / 608 nm), og TAMRA (559 nm / 583 nm).
  3. Legg Nuclease fri H 2 O og 10 x Tris-acetat-EDTA-buffer inneholdende 125 mM Mg2 + (10 x TAE / Mg2 +) til et syntetisk kvartscelle. Se tabell 12, 13 og 14 for eksempel volumer å bruke.
  4. Legg polyT strengene for å oppnå en sluttkonsentrasjon på ~ 1 um (se tabell 12, 13 og 14 for volumdeler), og deretter vortex syntetiskekvarts celler for 10-15 sek. Vanligvis vil pipettespissene ikke-spesifikt binder DNA. Tilsetning av høye konsentrasjoner av polyT tråder kan redusere denne ikke-spesifikk binding feil.
  5. Legg journalister og hjelpe tråder. Se tabell 12, 13, og 14 for eksempel volumer å bruke. Merk at for reporter kalibrering, er ingen hjelpe tråder nødvendig.
  6. Tilsett 10% natriumdodecylsulfat (SDS) for å oppnå en sluttkonsentrasjon på 0,15% SDS. Merk: SDS brukes til å dissosiere enzymer fra plasmid-avledede porter fordi enzymer kan forstyrre trådforskyvningsreaksjon (se figur 6). SDS er anbefalt her i stedet for varme denaturering av enzymer for å unngå dissosiasjon og feil rekombinasjon av gate tråder, som kan ha negativ innvirkning kretsen funksjon.
  7. [Hopp over dette trinnet for reporter kalibrering.]
    1. Legg delta og gaffel porter (se tabell 13, og 14 for volumer)til den syntetiske kvartscelle og blande løsningen ved pipettering opp og ned i minst 20 ganger (ikke vortex kyvetten fordi virvling løsninger med SDS kan resultere i bobler som vil påvirke fluorescens kinetikkmålinger).
    2. Også, gå til følgende måletrinn så snart som mulig, fordi lekkasjen reaksjonen starter umiddelbart etter tilsetningen av delta og gaffel portene til det syntetiske kvartscelle.
  8. Plasser de syntetiske kvarts cellene inn i kammeret i en spectrofluorimeter.
  9. Start kinetikk måling.
  10. Etter 5 min måle, tilsett inngangs trådene (se Tabell 12, 13 og 14 for volumdeler) til det syntetiske kvartscelle og bland reaksjonen ved pipettering opp og ned i minst 20 ganger. Legg merke til at prøven skal blandes forsiktig for å unngå bobler. Utfør dette trinnet mens datainnsamlingsprogram er satt på pause for å unngå å måle signaler utløst av eksternelys.
  11. Spill reaksjonskinetikken til den når stabil tilstand. Reaksjonskinetikk vises på datamaskinen.

8. Kalibrer Fluorescent Reporters

Merk: Denne delen beskriver protokollen for å lage kurver av fluorescerende reportere kalibrering. Kalibreringskurver blir brukt til å omdanne vilkår fluorescensenheter til molar signal konsentrasjon.

  1. Kalibrer fluorescerende reportere følge protokollen beskrevet i trinn 7. Bruk volumene av reaktanter og buffere, som oppsummert i tabell 12 Den standardkonsentrasjon for dette eksempel er 50 nM (1x).; journalister er på 3x; inngangen er 1x. For tilfeller der inngangs <tc c> er på 0,25x, 0.5x, 0.75x, justere volumet Nuclease free H 2 O tilsvar å holde sluttvolum på hver reaksjon å være 600 mL. Et eksempel på data er vist i figur 7A.
  2. Lage en kalibreringskurveReporter C med en lineær tilpasning av de endelige fluorescens-verdier mot den opprinnelige konsentrasjon av signal C (Et eksempel på kalibreringskurve er vist i figur 7B). Denne kalibreringskurve kan brukes til å konvertere vilkår fluorescensenheter til den tilsvarende signal konsentrasjon.

9. Kvantifisere Konsentrasjon av Plasmid-avledet ndsDNA Gates

Merk: Hver uavhengig behandlet parti av plasmid-avledet ndsDNA porter resulterer i et annet utbytte av funksjonelle porter, og dette avsnittet beskriver en protokoll for å kvantifisere konsentrasjonen av plasmid-avledet ndsDNA porter.

  1. Kvantifisere konsentrasjonen av plasmid-avledet ndsDNA porter følgende protokollen beskrevet i trinn 7. Bruk volumene av reagenser som oppsummert i tabell 13. Merk: Tabell 13 beskriver et eksempel oppskrift på Fork BC kvantifisering Delta. AB og andre porter kan utføres på samme måte, men ved hjelp av ulike innsats tråder, hjelpe tråder og journalister.
  2. Omdanne den endelige fluorescens-verdien målt i dette forsøk til en konsentrasjon på signal C ved hjelp av kalibreringskurve fra trinn 8.2. Så back-beregne ndsDNA gate konsentrasjon. For eksempel kan en endelig verdi for fluorescens porten kvantifisering eksperiment tilsvarer 25 nM signal C (0,5x) basert på kalibreringskurven i figur 7B. Siden lager av gaffel BC blir fortynnet 40 ganger i denne reaksjonen, er det lager konsentrasjonen av gaffel BC porten 1 uM.

10. Kinetics Målinger for reaksjonen A + B-> B + C

Merk: Denne delen beskriver en protokoll for å teste DNA realisering av en formell kjemisk reaksjon med fluoresens kinetikk målinger.

  1. Perskjemakinetikk måling ved å følge den protokoll som er beskrevet i trinn 7. Bruk volumer av reagenser og buffere, som oppsummert i tabell 14.

Representative Results

For en funksjonstest, ble en DNA gjennomføring av bimolekylære katalytiske reaksjonen (dvs. A + B-> B + C) er laget. Ytelsen av plasmid-avledet portene ble sammenlignet med portene sammensatt av syntetisk DNA. Katalytiske reaksjoner er en god test for port renhet fordi en feil gate kan irreversibelt felle en katalysator, som forårsaker en uforholdsmessig stor virkning på mengden av produkt produsert 18,19. På samme tid vil en liten lekkasje reaksjon som resulterer i untriggered frigjøring av den katalytiske signalet lineært forsterket, noe som fører til en uforholdsmessig feilsignal. Eksperimentelle data for plasmid-avledet og syntetiserte porter er vist i figur 8B og 8C, respektivt. I eksperimentene, er konsentrasjonen av signalet strengen Et fast, mens mengden av den katalytiske signal B blir variert. Signal C brukes til å lese ut fremdriften av reaksjonen uten å avbryte den katalytiskesyklus. Katalyse kan bli observert i dataene siden reaksjonene nærmer seg fullføring, selv med mengder av katalysator B mye mindre enn mengden av A. Etter SDS ikke ble satt til forsøk gjort med den syntetiserte systemet, er reaksjonshastigheten (som kan påvirkes ved tilsetning av SDS) ikke er sammenlignet og det analytiske fokus er stedet ved katalytisk omsetning (beskrevet nedenfor).

Videre analyse av den katalytiske omsetningen av denne reaksjonen ble utført. Omsetning er definert som den mengde signal C som produseres for hver katalysator B på et gitt tidspunkt. Spesifikt omsetning ble beregnet fra våre eksperimentelle data ved å dividere lekkasjen subtrahert signalet C av den opprinnelige mengden av katalysator B tilsettes. For en ideell katalytiske system, bør dette omsetningstall lineært øke med tiden, og å være uavhengig av mengden av katalysator, så lenge det ikke er begrensende substrat. I en reell system, kan defekte porter deaktivere katt alysts, og omsetningen vil nå en maksimal verdi, selv om ikke alle tilgjengelige substrat blir omdannet til produktet. Den maksimale omsetningsverdien indikerer hvor mange substrater (signal A) en katalysator (signal B) kan konvertere før de blir inaktivert. Her er det observert at det syntetiserte system avviker fra den ideelle lineær økning av omsetningen mye tidligere enn det plasmid-derived system gjør det, noe som indikerer deponering av katalysatoren gjennom en uønsket sidereaksjon (figur 8D). Sammenligningen omsetning vises bare for lave konsentrasjoner fordi ved høye konsentrasjoner av katalysatorer, vil alle porter utløses og slipp signal C. Kretsen lekkasje blir også sammenlignes, og det er observert at forholdet mellom lekkasje signal ved hjelp av plasmid-avledet porter er omtrent 8% mindre enn det som er syntetisert ved hjelp av portene etter 10 timers reaksjon (figur 8E).

iles / ftp_upload / 53087 / 53087fig1.jpg "/>
Figur 1. (A) CRNs tjene som en foreskrivende programmeringsspråk. DNA reaksjons nettverk kan være konstruert for å tilnærme dynamikken i en formell CRN (B) DNA implementering av et eksempel kjemisk instruksjon. A + B-> B + C. DNA-trådene er tegnet som linjer med piler på 3 'enden og * indikerer komplementaritet. All signal strander A (<ta en>, grønn), B (<tb b>, oransje) og C (<tc c>, rød) er besto av en toehold domene (merket som TA, TB, og tc) og en identitet domene (merket a, b og c). Den bimolecular reaksjonen A + B-> B + C krever to multi-strandet komplekser Bli AB og Fork BC, og fire hjelpe tråder <tr r>, <b tr>, <c tb> og <i tc>. Reaksjonen forløper gjennom syv trinnene i tråd fortrengning, der hvert trinn starts med toehold binding. (C) Reporter strategi. Reaksjonen følges ved hjelp av et reporter i hvilken bunn tråden blir merket med en fluorofor (rød prikk) og den øvre tråden er festet til en slukker (sort punkt). På grunn av den ko-lokalisering av fluoroforen og quencher er reporter fluorescens bråkjøles i intakt reporter. Signalet C kan erstatte toppen tråd av reporteren, som fører til en økning av fluorescens. (Dette tallet har blitt forandret fra Ref. 29) Klikk her for å se en større versjon av dette tallet.

Figur 2
Figur 2. (A) NdsDNA porter fra bakteriell plasmid DNA. Flere kopier av den dobbeltkjedede ndsDNA gate templat blir klonet inn i et plasmid. De klonede plasmider ern forvandlet til E. coli-celler og kolonier på plate er sekvensen bekreftet. Når sekvensen er bekreftet, blir plasmid-DNA amplifisert og ekstrahert. Til slutt blir den dobbeltkjedet plasmid bearbeides til de ønskede ndsDNA portene gjennom enzymatisk behandling. (B) Enzymatisk behandling av ndsDNA porter. Restriksjonsenzymet PvuII blir brukt til å frigjøre porten fra plasmidet. De frigitte portene er videre behandlet ved hjelp av knekk enzymer: Nb.BsrDI brukes til å generere kutt for Delta AB (Panel i); Nt.BstNBI brukes til å generere kutt for Fork BC (Panel ii). Restriksjons og knekk nettsteder er angitt som fargekodede bokser. (C) Sekvens visning av porten mal Bli AB (Panel i) og Fork BC (Panel ii). Den PvuII restriksjonssete (uthevet i lilla boks) er i begge ender av ndsDNA porter. Den Nb.BsrDI og Nt.BstNBI Knekk områder er uthevet i rødt og svarte bokser, henholdsvis. Lokaliseringen av kutt er merket med pilspisser. Sekvens N er hvilket som helst nukleotid. (Dette tallet har blitt modifisert med tillatelse fra Ref. 29) Klikk her for å se en større versjon av dette tallet.

Figur 3
Figur 3. (A) PCR fra et DNA-templat port. En DNA-porten templat inneholder ndsDNA port sekvensene i sentrum (et blått region), og avstands sekvenser på begge ender (sorte områdene, og disse to ende sekvenser er ortogonale). Primere kan binde seg til avstands sekvenser av porten mal, og generere fire overlappende DNA-fragmenter gjennom PCR (overlappende sekvenser er fargekodet i figuren). (B) Gibson montering. De fire amplifiserte DNA fragments blir deretter satt sammen til en linearisert plasmid ryggrad gjennom Gibson samlingsmetoden 43. (Dette tallet har blitt modifisert med tillatelse fra Ref. 29) Klikk her for å se en større versjon av dette tallet.

Figur 4
Figur 4. Circuit ytelse med forskjellige enzym beløp. (A) En forenklet fremstilling av porten, reporter, hjelpe tråder, og signal tråder som brukes til de tilsvarende eksperimenter. (B) Kinetics eksperimenter med plasmid-avledet Delta AB behandlet med forskjellige enzym mengder . jeg. 10 enheter av PvuII-HF og 45 enheter av Nb.BsrDI per 1 ug av plasmid; ii. 10 enheter av PvuII-HF og 4 enheter pr Nb.BsrDI 1 ug plasmid; iii. 4 enheter av PvuII-HF og 4 enheter pr Nb.BsrDI 1 ug av plasmid. Alle hjelpe tråder var på 2x (1x = 10 nM). Porten komplekset var 1,5x, og forsøkene ble utført ved 35 ° C i 1 x TAE / Mg2 +. (Dette tallet har blitt modifisert med tillatelse fra Ref. 29) Klikk her for å se en større versjon av dette tallet.

Figur 5
. Figur 5 Flytskjema av kinetikk eksperimenter Blå. Materialer som skal legge til kyvetten (0,875 ml syntetisk kvartscelle). Referansetabell 14 for spesifikke volumer for å legge for kinetisk eksperiment av A + B -> B + C. Grønn: Bruksanvisning av en spectrofluorimeter (merket som SPEX). Red: Blanding instruksjoner.53087fig5large.jpg "target =" _ blank "> Klikk her for å se en større versjon av dette tallet.

Figur 6
Figur 6. Enzyme dissosiasjon og krets atferd. (A) En forenklet fremstilling av porten, reporter, hjelpe tråder, og signal tråder som brukes til de tilsvarende eksperimenter. (B) Kinetics eksperimenter av plasmidet-avledet Bli AB bruker 80 ° C varme inaktive (grønne spor), 0,15% natrium (SDS) (rød), og en kontroll uten varme inaktivering eller tilsetting av SDS (blå). Standarden konsentrasjonen var 1x = 10 nM, og alle hjelpe tråder og inngang B var på 2x. Porten komplekset var 1,5x, og forsøkene ble utført ved 35 ° C i 1 x Tris-acetat-EDTA-buffer inneholdende 12,5 mM Mg2 + (1 x TAE / Mg 2+ Ref. 29) Klikk her for å se en større versjon av dette tallet.

Figur 7
Figur 7. Reporter kalibrering. (A) Reporter C kinetikk. Reporteren konsentrasjonen var på 3 x (1 x = 50 nM), og den opprinnelige konsentrasjon av signal C er indikert på figuren. (B) Fluorescens nivåene av signal C på målesluttpunkt (40 min) viser et lineært forhold med opprinnelige konsentrasjonen av signal C. I en kvantifisering eksempel på Fork BC gate (grønn stiplet linje), fluorescens verdien av Fork BC var måld som 3 x 10 6 (AU), som tilsvarer 25 nM (0.5x) basert på kalibreringskurven. Klikk her for å se en større versjon av dette tallet.

Figur 8
Figur 8. Bimolekylære katalytiske reaksjonskinetikken (A + B-> B + C). (A) En forenklet representasjon av porten, reporter, hjelpetråder, og signal tråder benyttet for de tilsvarende eksperimenter. Forsøk ble kjørt i 1 x Tris-acetat-EDTA-buffer inneholdende 12,5 mM Mg2 + (1 x TAE / Mg2 +). Alle port komplekser var på 75 nM konsentrasjon (1,5x), og hjelpe tråder var ved 100 nM konsentrasjon (2x). Kinetics data for plasmid-avledet porter og data for syntetiserte porter er vist i (B) og (C) (D) Plasmid-avledet porter viste høyere omsetning enn syntetiserte DNA-porter når lave mengder av inngangs ble tilsatt. (E) omfang lekkasje. Stolpediagrammet viser forholdet mellom den endelige lekkasje til det endelige signalet (C B0 = 0 / C B0 = 1) ved endepunktene (10 time). (Dette tallet har blitt forandret fra Ref. 29) Klikk her for å se en større versjon av dette tallet.

Gate Maler Sekvenser Lengde (nt)
JoinAB TCTAGTTCGATCAGAGCGTTATTACCAGTAGTCGATTGCTCAGCTGCTACATTGCTTCTACGAGTCATCCTTCCACCATTGCACCTTAGAGTCCGAATCCTACCATTGCTTAACCGAGTCTCACAACCAGCTGTCATTATGGACTTGACACACAGATTACACGGGAAAGTTGC 173
FORKBC TCTAGTTCGATCAGAGCGTTATTACCAGTAGTCGATTGCTCAGCTGCCATCATAAGAGTCACCATACCCACATTGCCACATCGAGTCCCTTTTCCACCATTGCACCTTAGAGTCCGAATCCTACCATTGCTTAACCGAGTCTCACAACCAGCTGTCATTATGGACTTGACACACAGATTACACGGGAAAGTTGC 194

Tabell 1. Sekvenser av ndsDNA gate maler.

Port Strand Lengde på bunnen tråd (nt)
JoinAB JoinAB-Bottom, <a tb>, <b tr>, <r tq> 87
ForkBC ForkBC-Bottom, <i>, <tc c>, <tb b>, <tr r> 108

Tabell 2. Strands bestående Bli AB og Fork BC. (Denne tabellen har blitt forandret fra Ref. 29)

Domene Sekvens Lengde (nt)
TA CTGCTA 6
tb TTCCAC 6
tc TACCCA 6
tr TCCTAC 6
tq AACCAG 6
en CATTGCTTCTACGAGTCATCC 21
b CATTGCACCTTAGAGTCCGAA 21
c CATTGCCACATCGAGTCCCTT 21
r CATTGCTTAACCGAGTCTCAC 21
jeg CTGCCATCATAAGAGTCACCA 21
jove_content "fo: keep-together.within-side =" always "fo: keep-med-previous.within-page =". always "> Tabell 3 domenenivå sekvenser for å implementere den kjemiske reaksjonen A + B -> B + C . (Denne tabellen har blitt forandret fra Ref. 29)

Primer strand Sekvenser Lengde (nt)
Forward primer-en AAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAG CGTTATTACCAGTAGTCGATTGC 60
Revers primer-en ACTACTATTTACTAATCCCATTGCGTGTTCTTATT TAATCTGTGTGTCAAGTCCATAATG 60
Forward primer-2 AATAAGAACACGCAATGGGATTAGTAAATAGTAGT CGTTATTACCAGTAGTCGATTGC 58
Revers primer-2 GCGAAACTAGCTTGTGGTGATATTGTCTCGTGTGT TAATCTGTGTGTCAAGTCCATAATG 60
Forward primer-3 ACACACGAGACAATATCACCACAAGCTAGTTTCGC CGTTATTACCAGTAGTCGATTGC 58
Revers primer-3 ACATTGTACGCCTAAATCATCAAGAATAATTGTTG TAATCTGTGTGTCAAGTCCATAATG 60
Forward primer-4 CAACAATTATTCTTGATGATTTAGGCGTACAATGT CGTTATTACCAGTAGTCGATTGC 58
Revers primer-4 GAGCGCAGCGAGTCAGTGAGCGAGGAAGCCTGCAG TAATCTGTGTGTCAAGTCCATAATG 60

Tabell 4. Primer sekvenser for PCR av ndsDNA gate maler.

Reagens Volum for 1x reaksjon (pl)
Høy kopiplasmid ryggrad (~ 300 ng / mL) 10
PvuII-HF (20.000 enheter / ml) 2
Pstl-HF (20.000 enheter / ml) 2
10x Cut smart buffer 2
H to O 4
Totalt volum 20 d>

Tabell 5. Protokoll for plasmid ryggrad fordøye.

Reagens Volum for 1x reaksjon (pl)
DNA vektor (~ 50 ng / mL) 1
PCR-amplifiserte fragment-1 (~ 50 ng / mL) 1
PCR-amplifiserte fragment-2 (~ 50 ng / mL) 1
PCR-amplifiserte fragment-3 (~ 50 ng / mL) 1
PCR-amplifiserte fragment-4 (~ 50 ng / mL) 1
2x Gibson Assembly mester Mix 5
Totalt volum 10
s "fo: keep-med-previous.within-side =" always "> Tabell 6 Protokoll for Gibson montering..

Reagens Volum for 1x reaksjon (pl)
Plasmid DNA (~ 1 ug / ul konsentrasjon) 1000
PvuII-HF (20.000 enheter / ml) 200
10x Cut smart buffer 133,3
Totalt volum 1333,3

Tabell 7. Protokoll for ndsDNA porter innsatt plasmid fordøye med Restriction enzym PvuII-HF.

Reagens Volum (mL)
Delta porter (~ 5 ug / ul konsentrasjon) 150
Nb.BsrDI (10.000 enheter / ml) 300
10x Cut smart buffer 50
Totalt volum 500

Tabell 8. Protokoll for å bli med porter fordøye med nicking enzym Nb.BsrDI.

Reagens Volum (mL)
Gaffel porter (~ 5 pg / mL konsentrasjon) 150
Nt.BstNBI (10.000 enheter / ml) 600
10x NEB buffer 3.1 83.3
Totalt volum 833,3

Tabell 9 Protokoll for gaffel porter fordøye med nicking enzym Nt.BstNBI.

Strand Domene Sekvens Lengde (nt)
JoinAB-Bottom tq * r * st * b * tb * en * ta * CTGGTT GTGAGACTCGGTTAAGCAATG GTAGGA TTCGGACTCTAAGGTGCAATG GTGGAA GGATGACTCGTAGAAGCAATG TAGCAG 87
FORKBC-Bottom tq * r * st * b * tb * c * tc * i * CTGGTT GTGAGACTCGGTTAAGCAATG GTAGGA TTCGGACTCTAAGGTGCAATG GTGGAA AAGGGACTCGATGTGGCAATG TGGGTA TGGTGACTCTTATGATGGCAG 108
<ta en> CTGCTA CATTGCTTCTACGAGTCATCC 27
<tb b> ta en TTCCAC CATTGCACCTTAGAGTCCGAA 27
<tc c> tb b TACCCA CATTGCCACATCGAGTCCCTT 27
<a tb> tc c CATTGCTTCTACGAGTCATCC TTCCAC 27
<b tr> en tb CATTGCACCTTAGAGTCCGAA TCCTAC 27
<r tq> b tr CATTGCTTAACCGAGTCTCAC AACCAG 27
<i> r tq CTGCCATCATAAGAGTCACCA 21
<tr r> jeg TCCTAC CATTGCTTAACCGAGTCTCAC 27
<i tc> tr r CTGCCATCATAAGAGTCACCA TACCCA 27
<c tr> Jeg tc CATTGCCACATCGAGTCCCTT TCCTAC 27
<c tb> c tr CATTGCCACATCGAGTCCCTT TTCCAC 27
<b tr> c tb CATTGCACCTTAGAGTCCGAA TCCTAC 27
<i tb> b tr CTGCCATCATAAGAGTCACCA TTCCAC 27
<b tb> Jeg tb CATTGCACCTTAGAGTCCGAA TTCCAC 27
<b tc> b tb CATTGCACCTTAGAGTCCGAA TACCCA 27
<c tr> b tc CATTGCCACATCGAGTCCCTT TCCTAC 27
<b tr> c tr CATTGCACCTTAGAGTCCGAA TCCTAC 27
ROX- <c * tc *> b tr / 56-ROXN / AAGGGACTCGATGTGGCAATG TGGGTA 27
<c> -RQ c * tc * CATTGCCACATCGAGTCCCTT / 3IAbRQSp / 21
<tq * r *> - TAMRA CTGGTT GTGAGACTCGGTTAAGCAATG / 36-TAMTSp / 27
RQ- <r> tq * r * / 5IAbRQ / CATTGCTTAACCGAGTCTCAC 21
r

. Tabell 10 Strand sekvenser for å implementere den kjemiske reaksjonen A + B -.> B + C (. Denne tabellen har blitt forandret fra Ref 29)

Reagens Volum (mL) Endelig konsentrasjon
ROX- <c * tc *> 100 mikrometer 10 10 um (1x)
<c> -RQ 100 μ; M 1. 3 13 mikrometer (1,3x)
10x TAE med 125 mm Mg 2+ 10 1x TAE med 12,5 mm Mg 2+
H to O 67 -
Totalt volum 100 10 um (1x)

Tabell 11. Protokoll for montering Reporter C.

Reagens Volum (mL) Endelig konsentrasjon
H to O 514 -
10x TAE med 125 mm Mg 2+ 60 1x TAE med 12,5 mm Mg 2+
PolyT på 300 μ; M 2 1 mikrometer
Reporter C ved 10 mikrometer 9 150 nM (3x)
10% SDS 9 0,15%
<tc c> 5 mikrometer 6 50 nM (1x)
Totalt volum 600 -

Tabell 12. Protokoll for kalibrering av reporter C. Mengdene gitt her er for et totalt reaksjonsvolum på 600 ul (som tilsvarer bruk av en 0.875 ml syntetisk kvartscelle), men kan justeres til å arbeide med forskjellig størrelse celler.

<td> 600
Reagens Volum (mL) Endelig consentra
H to O 493 -
10x TAE med 125 mm Mg 2+ 60 1x TAE med 12,5 mm Mg 2+
polyT på 300 mikrometer 2 1 mikrometer
Reporter C ved 10 mikrometer 9 150 nM (3x)
<i TC> 100 mikrometer 3 10x
<c tb> 100 mikrometer 3 10x
<b tr> 100 mikrometer 3 10x
10% SDS 9 0,15%
Gaffel BC på ~ 1 mikrometer (konsentrasjon ukjent) 15 ~ 0.5x
<r tq> 100 mikrometer 3 10x
Totalt volum -

Tabell 13. Protokoll for kalibrering av gaffel BC. Mengdene gitt her er for et totalt reaksjonsvolum på 600 ul, men kan justeres til å arbeide med forskjellig størrelse celler.

Reagens Volum (mL) Endelig konsentrasjon
H to O 407,2 -
10x TAE med 125 mm Mg 2+ 52.8 12,5 mm Mg 2+
polyT på 300 mikrometer 2 1 mikrometer
Reporter C ved 10 mikrometer 9 150 nM (3x)
<i TC> 10 mikrometer 6 100 nM (2x)
<c tb> 10 mikrometer 6 100 nM (2x)
<b tr> 10 mikrometer 6 100 nM (2x)
<tr r> 10 mikrometer 6 100 nM (2x)
10% SDS 9 0,15%
Bli med AB på 1fiM 45 75 nM (1,5x)
Gaffel BC på 1 mikrometer 45 75 nM (1,5x)
<ta en> 10 mikrometer 3 50 nM (1x)
<tb b> 10 mikrometer 3 50 nM (1x)
Totalt volum 600 -

Tabell 14. Protokoll for en kjemisk reaksjon A + B-> B + C. Mengdene gitt her er for et totalt reaksjonsvolum på 600 ul, men kan justeres til å arbeide med forskjellig størrelse celler.

Syntetiserte porter Plasmid-avledet porter
Beskrivelse Koste Bli med porter Fork porter
SIDE renset lang strand (100 nt, fungerte som de nederste trådene i en gate) ~ $ 75 Beskrivelse </ strong> Koste Beskrivelse Koste
SIDE renset kort strand (~ 30 nt, servert som topp tråder av en gate) ~ $ 185 Gate mal ~ $ 100 Gate mal ~ $ 100
Total ~ $ 260 Plasmid utvinning kit ~ $ 26 Plasmid utvinning kit ~ $ 26
Restriksjonsenzym (PvuII-HF) ~ $ 11 Restriksjonsenzym (PvuII-HF) ~ $ 11
Nicking enzym (Nt.BsrDI, Delta porter) ~ $ 29 Nicking enzym (Nt.BstNBI, Fork porter) ~ $ 62
Total ~ $ 166 Total ~ $ 199

fo:.. keep-med-previous.within-side = "always"> Tabell 15 Kostnads ​​sammenligning mellom plasmid-avledet porter og syntetiserte porter (. Denne tabellen har blitt forandret fra Ref 29)

Syntetiserte porter Plasmid-avledet porter
Behandling Behandlingstid Behandling Behandlingstid
Gløding 1 time Kloning 5 timer
SIDE rensing 2 timer Plasmid utvinning 2 timer
Total 3 hr To skritt av enzymet fordøyelsen 0,5 timer
Etanolutfelling
Total 8.5 hr

Tabell 16. Behandlingstid sammenligning mellom plasmid-avledet porter og syntetiske porter. (Denne tabellen har blitt forandret fra Ref. 29)

Discussion

Dette notatet beskriver en metode for å utlede ndsDNA porter fra høyren plasmid DNA. Videre er en protokoll presenteres for karakterisering gate ytelse ved anvendelse av en fluorescens-kinetikk assay. Eksperimentelle data viser at plasmid-derived system gir bedre resultater enn dens syntetiske motpart selv om det syntetiske systemet er sammensatt av tråder renset ved anvendelse av polyakrylamid-gel-elektroforese (PAGE). Sannsynlig, er den forbedrede ytelsen til plasmid-avledet porter primært på grunn av svært høy renhet av den biologiske DNA. Syntetisk DNA inneholder en rekke feil, særlig delesjoner som resulterer i oligonukleotider med lengde n-1, og slike biprodukter er vanligvis ikke fullstendig fjernet i PAGE eller væskekromatografi (HPLC) renseprosedyrer. Lignende forbedringer til de som presenteres her, ble også observert i en tidligere studie av en katalysert hårnål forsterker som brukes DNA stammer fra biologiske kilder 21.

(se figur 4). For det andre, i disse forsøk, de fleste innganger og hjelpetråder var syntetisk DNA, og således inneholdt delesjoner og mutasjoner. I prinsippet kan alle enkelt-trådet inngang og tilleggs tråder også fås fra fagmid DNA gjennom en sammenpressing enzymoppløsning av pre-kodede m13 virale genom 26. Kanskje kretsen ytelse kan forbedres ytterligere ved hjelp av ssDNA avledet fra det bakterielle genomet.

Mens bruken av plasmid-avledet portene ble funnet å forbedre kretsytelse, en analyseav kostnads ​​og behandlingstiden viste at mens produksjonen av plasmid-avledet portene er litt billigere (tabell 15), tar det 2-3 ganger lengre saksbehandlingstid i forhold til montering og rensing av porter fra kommersielt syntetiserte oligos (Tabell 16). Den primære kostnadene for plasmid-avledet portene er gen-syntese og anvendelse av restriksjonsenzymer. For 300 pmol av porter (nok for 15 reaksjoner på 30 nM), er den estimerte kostnaden for Delta porter ca $ 170 og $ 200 for Fork porter, kostnaden forskjellen er på grunn av bruk av ulike knekk enzymer. I kontrast, kjemisk syntese av trådene for de samme gate koster rundt $ 260 inkludert en PAGE rensing avgift. Den primære tid kostnaden for plasmid-avledet porter er i kloning prosedyre, som, akkurat som DNA-syntese, kan settes ut til et gen syntese selskap. Imidlertid, når montert, plasmid-avledet portene har den fordelen at verts plasmider kan lett bli replikert ennd kan lagres i form av bakterie glyserol aksjer. Dette gjør det mulig å gjenbruke portene mange ganger over.

Ser frem, kan den forbedrede ytelsen til plasmid-avledet porter aktivere et mye større spekter av dynamikk atferd enn det har vist eksperimentelt så langt med DNA CRNs. For eksempel foreslo nylig teoretisk arbeid 47,48 at selvorganisert romlige mønstre på makro-skala kan realiseres med DNA CRNs gjennom en reaksjon diffusjon mekanisme. Metoden som presenteres her gir en levedyktig bane for å konstruere de underliggende molekylære komponenter for slike selv mønstring DNA materialer. Selv utfordrende, ville utvikle makro-skala morfologi i en programmerbar måte har betydelige implikasjoner i områder som spenner fra biomaterialer forskning for å regenerativ medisin.

Acknowledgements

Tallene 1, 2, 3, 4, 6, 8 og Bord 2, 3, 10, 15, 16 er endret fra Ref 29. Dette arbeidet ble støttet av National Science Foundation (gi NSF-CCF 1.117.143 og NSF-CCF 1.162.141 til GS). Y.-JC ble støttet av taiwanske regjeringen Fellowships. SDR ble støttet av National Science Foundation Graduate Research Fellowship Program (GRFP).

Materials

Name Company Catalog Number Comments
Phusion High-Fidelity PCR Master Mix with HF Buffer NEB M0531S
PvuII-HF NEB R3151L
PstI-HF NEB R3140S
Gibson Assembly Master Mix NEB E2611S
Terrific Broth, Modified SIGMA-ALDRICH T0918-250G
QIAprep Spin Miniprep Kit (250) QIAGEN 27106
QIAGEN Hispeed Maxi-prep Kit QIAGEN 12662
Nb.BsrDI NEB R0648L
Nt.BstNBI NEB R0607L
NanoDrop 2000c Thermo Scientific
Double-stranded Genomic Blocks IDT
Horiba Jobin-Yvon Spex Fluorolog-3 Fluorimeter Horiba/Jobin Yvon
Synthetic Quartz Cells  Starna 23-5.45-S0G-5
QIAGEN Gel Extraction Kit QIAGEN 28706
Plasmid Backbones BioBrick E0240-pSB1A2 High copy number plasmid with Ampicillin resistance. Sequence can be found from http://parts.igem.org

DOWNLOAD MATERIALS LIST

References

  1. Zhang, D. Y., Seelig, G. Dynamic DNA nanotechnology using strand-displacement reactions. Nat. Chem. 3, 103-113 (2011).
  2. Krishnan, Y., Simmel, F. C. Nucleic acid based molecular devices. Angew. Chem. Int. Ed. Engl. 50, 3124-3156 (2011).
  3. Zhang, D. Y., Winfree, E. Control of DNA strand displacement kinetics using toehold exchange. J. Am. Chem. Soc. 131, 17303-17314 (2009).
  4. Qian, L., Winfree, E., Bruck, J. Neural network computation with DNA strand displacement cascades. Nature. 475, 368-372 (2011).
  5. Qian, L., Winfree, E. Scaling up digital circuit computation with DNA strand displacement cascades. Science. 332, 1196-1201 (2011).
  6. Zadegan, R. M., Jepsen, M. D., Hildebrandt, L. L., Birkedal, V., Kjems, J. Construction of a fuzzy and boolean logic gates based on DNA. Small. 11, 1811-1817 (2015).
  7. Seelig, G., Soloveichik, D., Zhang, D. Y., Winfree, E. Enzyme-free nucleic acid logic circuits. Science. 314, 1585-1588 (2006).
  8. Zadegan, R. M., et al. Construction of a 4 zeptoliters switchable 3D DNA box origami. ACS Nano. 6, 10050-10053 (2012).
  9. Andersen, E. S., et al. Self-assembly of a nanoscale DNA box with a controllable lid. Nature. 459, 73-76 (2009).
  10. Zhang, D. Y., Hariadi, R. F., Choi, H. M., Winfree, E. Integrating DNA strand-displacement circuitry with DNA tile self-assembly. Nat. Commun. 4, (1965).
  11. Yurke, B., Turberfield, A. J., Mills, A. P., Simmel, F. C., Neumann, J. L. A DNA-fuelled molecular machine made of DNA. Nature. 406, 605-608 (2000).
  12. Green, S. J., Lubrich, D., Turberfield, A. J. DNA hairpins: fuel for autonomous DNA devices. Biophys. J. 91, 2966-2975 (2006).
  13. Venkataraman, S., Dirks, R. M., Rothemund, P. W., Winfree, E., Pierce, N. A. An autonomous polymerization motor powered by DNA hybridization. Nat. Nanotechnol. 2, 490-494 (2007).
  14. Green, S. J., Bath, J., Turberfield, A. J. Coordinated chemomechanical cycles: a mechanism for autonomous molecular motion. Phys. Rev. Lett. 101, 238101 (2008).
  15. Omabegho, T., Sha, R., Seeman, N. C. A bipedal DNA Brownian motor with coordinated legs. Science. 324, 67-71 (2009).
  16. Turberfield, A. J., et al. DNA fuel for free-running nanomachines. Phys. Rev. Lett. 90, 118102 (2003).
  17. Dirks, R. M., Pierce, N. A. Triggered amplification by hybridization chain reaction. Proc. Natl. Acad. Sci. U. S. A. 101, 15275-15278 (2004).
  18. Seelig, G., Yurke, B., Winfree, E. Catalyzed relaxation of a metastable DNA fuel. J. Am. Chem. Soc. 128, 12211-12220 (2006).
  19. Zhang, D. Y., Turberfield, A. J., Yurke, B., Winfree, E. Engineering entropy-driven reactions and networks catalyzed by DNA. Science. 318, 1121-1125 (2007).
  20. Yin, P., Choi, H. M., Calvert, C. R., Pierce, N. A. Programming biomolecular self-assembly pathways. Nature. 451, 318-322 (2008).
  21. Chen, X., Briggs, N., McLain, J. R., Ellington, A. D. Stacking nonenzymatic circuits for high signal gain. Proc. Natl. Acad. Sci. U. S. A. 110, 5386-5391 (2013).
  22. Phillips, A., Cardelli, L. A programming language for composable DNA circuits. J. R. Soc. Interface. 6, Suppl 4. S419-S436 (2009).
  23. Lakin, M. R., Youssef, S., Polo, F., Emmott, S., Phillips, A. Visual DSD: a design and analysis tool for DNA strand displacement systems. Bioinformatics. 27, 3211-3213 (2011).
  24. Lakin, M. R., Youssef, S., Cardelli, L., Phillips, A. Abstractions for DNA circuit design. J. R. Soc. Interface. 9, 470-486 (2012).
  25. Zhang, D. Y., Winfree, E. Robustness and modularity properties of a non-covalent DNA catalytic reaction. Nucleic Acids Res. 38, 4182-4197 (2010).
  26. Ducani, C., Kaul, C., Moche, M., Shih, W. M., Hogberg, B. Enzymatic production of 'monoclonal stoichiometric' single-stranded DNA oligonucleotides. Nat. Methods. 10, 647-652 (2013).
  27. Lin, C., et al. In vivo cloning of artificial DNA nanostructures. Proc. Natl. Acad. Sci. U. S. A. 105, 17626-17631 (2008).
  28. Bhatia, D., et al. Icosahedral DNA nanocapsules by modular assembly. Angew. Chem. Int. Ed. Engl. 48, 4134-4137 (2009).
  29. Chen, Y. J., et al. Programmable chemical controllers made from DNA. Nat. Nanotechnol. 8, 755-762 (2013).
  30. Arkin, A., Ross, J. Computational functions in biochemical reaction networks. Biophys. J. 67, 560-578 (1994).
  31. Érdi, P., Tóth, J. Mathematical models of chemical reactions: theory and applications of deterministic and stochastic models. Manchester University Press. (1989).
  32. Magnasco, M. O. Chemical kinetics is Turing universal. Phys. Rev. Lett. 78, 1190 (1997).
  33. Oishi, K., Klavins, E. Biomolecular implementation of linear I/O systems. IET Syst. Biol. 5, 252-260 (2011).
  34. Senum, P., Riedel, M. Rate-independent constructs for chemical computation. PLoS One. 6, (2011).
  35. Soloveichik, D., Cook, M., Winfree, E., Bruck, J. Computation with finite stochastic chemical reaction networks. Natural Computing. 7, 615-633 (2008).
  36. Soloveichik, D., Seelig, G., Winfree, E. DNA as a universal substrate for chemical kinetics. Proc. Natl. Acad. Sci. U. S. A. 107, 5393-5398 (2010).
  37. Tyson, J. J., Chen, K. C., Novak, B. Sniffers, buzzers, toggles and blinkers: dynamics of regulatory and signaling pathways in the cell. Curr. Opin. Cell. Biol. 15, 221-231 (2003).
  38. Cardelli, L. Two-domain DNA strand displacement. Math. Struct. Comput. Sci. 23, 247-271 (2013).
  39. Angluin, D., Aspnes, J., Eisenstat, D. A simple population protocol for fast robust approximate majority. Distrib. Comput. 21, 87-102 (2008).
  40. Cardelli, L., Csikasz-Nagy, A. The cell cycle switch computes approximate majority. Sci. Rep. 2, 656 (2012).
  41. Zadeh, J. N., et al. NUPACK: Analysis and design of nucleic acid systems. J. Comput. Chem. 32, 170-173 (2011).
  42. Lee, P. Y., Costumbrado, J., Hsu, C. Y., Kim, Y. H. Agarose gel electrophoresis for the separation of DNA fragments. J. Vis. Exp. (2012).
  43. Gibson, D. G., et al. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat. Methods. 6, 343-345 (2009).
  44. Froger, A., Hall, J. E. Transformation of plasmid DNA into E. coli using the heat shock method. J. Vis. Exp. e253 (2007).
  45. Lessard, J. C. Transformation of E. coli via electroporation. Methods Enzymol. 529, 321-327 (2013).
  46. Nasri, M., Thomas, D. Alteration of the specificity of PvuII restriction endonuclease. Nucleic Acids Res. 15, 7677-7687 (1987).
  47. Dalchau, N., Seelig, G., Phillips, A. Computational design of reaction-diffusion patterns using DNA-based chemical reaction networks. DNA Computing and Molecular Programming. 84-99 (2014).
  48. Scalise, D., Schulman, R. Designing modular reaction-diffusion programs for complex pattern formation. Technology. 2, 55-66 (2014).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics