Flow-padrão Fabrication guiada de alta densidade Barcode Antibody Microarray

Chemistry

Your institution must subscribe to JoVE's Chemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Este protocolo descreve o fabrico de uma grande escala, o ADN ou o anticorpo matriz bidimensional multiplexado, com aplicações potenciais em estudos de sinalização de células e detecção de biomarcador.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Ramirez, L. S., Wang, J. Flow-pattern Guided Fabrication of High-density Barcode Antibody Microarray. J. Vis. Exp. (107), e53644, doi:10.3791/53644 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Os microarrays de anticorpos têm sido amplamente usados ​​em estudos de proteómica durante décadas para examinar a presença de proteínas-alvo, incluindo os biomarcadores da proteína 1-3. Embora esse campo está actualmente a enfrentar grandes desafios de outros tecnologias de alta capacidade, tais como espectrometria de massa (MS), ainda há muito espaço para o utilitário de microarrays de anticorpos, principalmente porque estes dispositivos proporcionam interpretação de dados simples e fácil de interface com outros ensaios. Nos últimos anos, a integração de microarrays para andaimes microchip forneceu o microarray anticorpo uma nova oportunidade para prosperar 4-7. Por exemplo, o micro-arranjo de código de barras integrado em um microchip de uma única célula foi usada em estudos de comunicação celular 8,9. Esta tecnologia tem vantagens distintas em relação a outras tecnologias de microarray disponíveis. Possui elementos de matriz em 10-100 mm, muito menor do que o 150 um tamanho típico usado em elemen microarray convencionaisTS. A construção dos elementos de matriz mais pequenas é conseguida utilizando abordagens de fluxo de padrões sistemáticos, e isto dá origem a microarranjos compactos que podem detectar as proteínas de célula única segregadas e proteínas intracelulares. Outra vantagem é o uso de uma configuração simples, livre de instrumento. Isto é particularmente importante, porque a maioria dos laboratórios e empresas de pequeno porte pode não ser capaz de acessar instalações nucleares microarray. Microarrays de anticorpo tal código de barras recurso avançado de ensaio de transferência e podem ser usados ​​para realizar ensaios altamente multiplexados em células isoladas, enquanto alcançando alta sensibilidade e especificidade comparável com a do ensaio de imunossorvente ligado a enzima-sanduíche convencional (ELISA 8). Esta tecnologia tem numerosas aplicações na detecção de proteínas de 9-11 glioblastoma, células T 12, e as células tumorais circulantes 13. Como alternativa, DNA microarrays de códigos de barras só têm sido utilizados no posicionamento preciso de neurónios e astrócitos para Mimicking a montagem in vivo do tecido cerebral 14.

Este protocolo incide apenas sobre os passos experimentais e blocos acúmulo de o bidimensional (2-D) de código de barras anticorpo microarray que tem aplicações potenciais na detecção de biomarcadores em amostras de fluidos e em células individuais. A tecnologia baseia-se numa endereçável de cadeia simples, unidimensional (1-D) de microarranjo de DNA construído utilizando oligonucleótidos que são ortogonais modelado espacialmente em substratos de vidro. O padrão 1-D é formado quando os canais de fluxo paralelos são usados ​​no passo de fluxo-padronização, e tal padrão aparece como bandas discretas visualmente semelhantes a 1-D Universal Product Code (UPC) de códigos de barras. A construção de um 2-D (n x m) matriz de anticorpo - reminiscente de um 2-D de Resposta Rápida (QR) de código matriz - necessita de estratégias de padrões mais complexos, mas permite a imobilização de anticorpos a uma densidade mais elevada 8,15. A fabricaçãorequer dois passos de modelação de ADN, com o primeiro padrão perpendicular ao segundo. Os pontos de intersecção destes dois padrões constituem os elementos de m x n da matriz. Ao seleccionar estrategicamente as sequências de ADN de cadeia simples (ssDNA) utilizado em fluxo-padronização, cada elemento de uma determinada matriz é atribuído um endereço específico. Esta referência espacial é necessário distinguir entre sinais de fluorescência no slide microarray. A matriz de ADNcs é convertido em uma matriz de anticorpo por meio da incorporação de conjugados ADN-anticorpo complementares, formando uma plataforma chamada biblioteca de anticorpos codificados por ADN (DEAL 16).

Este protocolo vídeo descreve os principais passos na criação de matrizes nxm de anticorpos que incluem a preparação de polidimetilsiloxano (PDMS) moldes código de barras, fluxo-padronização ssDNA em duas orientações, a preparação de conjugados anticorpo-DEAL de oligonucleotídeos, e converter a matriz 3 x 3 DNA em um 3x 3 matriz de anticorpo.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Atenção: Vários produtos químicos utilizados neste protocolo são irritantes e são perigosos em caso de contacto com a pele. Consultar fichas de dados de segurança de materiais (MSDS) e usar equipamento de proteção pessoal adequado antes de executar esse protocolo. A solução piranha utilizado no Passo (1.1.1) é altamente corrosivo e deve ser preparada por adição do peróxido lentamente ao ácido com agitação. Lidar com esta solução com extrema cautela em um exaustor. Use proteção para os olhos adequada e luvas resistentes aos ácidos. Trimetilclorosilano (TMCS) é um produto químico corrosivo, inflamável usado em uma etapa opcional, depois (1.1.6). Lidar com este produto químico em uma coifa.

Nota: Execute a fabricação de barras de slides e procedimentos de fluxo de padrões críticos em uma sala limpa para minimizar a contaminação por partículas. Partículas de poeira pode bloquear as portas e os microcanais de moldes PDMS e interferir com o fluxo-padronização.

1. A construção do One-dimensional DNA Barcode Deslize

  1. Preparação do mestre SU-8 para os padrões de fluxo de código de barras
    Nota: Os desenhos para os padrões de fluxo perpendicular (Figura 1A-B) são criadas utilizando um software assistida por computador (CAD). Esses padrões são rendidos em um photomask cromo. Áreas transparentes da máscara correspondem às características do mestre SU-8.
    1. Limpar uma bolacha de silício (diâmetro de 100 mm), cuidadosamente, a uma mistura de 3 H 2 SO 4: 1 H 2 O 2 (solução piranha) 30% aquecida a 96 ° C. Lava-se a pastilha com água de s ionizada e álcool isopropílico, seguido por secagem com uma pistola de ar de azoto.
    2. Verter cerca de 4 ml de SU-2025 8 fotorresistente na bolacha. Use um aplicador de rotação programável para espalhar uniformemente o photoresist na bolacha para 10 segundos a 500 rpm, em seguida, 30 segundos a 3.000 rpm. Isto cria uma camada foto-resistente com uma espessura de ~ 25? M. Gradualmente permitem girar a desacelerar antes de parar - esta é a maintain um revestimento uniforme sobre a superfície da bolacha.
    3. Cozer a pastilha revestida numa placa de aquecimento durante 1 min a 65 ° C, em seguida durante 5 min a 95 ° C. Este passo permite que o revestimento para solidificar. Arrefecer até à TA durante 5 min.
    4. Coloque a máscara de cromo (Figura 1C) no revestimento foto-resistente. Expor as características de máscara à luz near-UV (350-400 nm, energia exposição 150-160 mJ / cm2) durante 20 segundos.
      Nota: O design da máscara cromo contém 20 canais, cada um dos quais são 20 mm de largura, com 50 mm campo. Os canais são de enrolamento de uma extremidade do padrão para a extremidade oposta. No total, os 20 canais de cobrir uma área rectangular, com um comprimento de ~ 40 mm e uma largura de 20 mm ~. Cada canal é flanqueado por dois elementos circulares, que correspondem a uma entrada e uma saída. Entradas e saídas são intercambiáveis.
    5. Cozer a bolacha exposta numa placa de aquecimento durante 5 min a 95 ° C. Arrefecer attemperatura ambiente gradualmente.
    6. Mergulhe o wafer em SU-8 desenvolvedor com agitaçãodurante 5 min. Lava-se a pastilha com uma pequena porção de fresco SU-8 desenvolvedor, seguido de álcool isopropil. Seque o wafer usando uma pistola de ar de azoto. Duro-coza a bolacha sobre uma placa de aquecimento a 200 ° C durante 30 min, e permitir que a bolacha se arrefecer gradualmente até à temperatura ambiente.
      Nota: O desenvolvimento pode ser realizado durante um tempo mais longo se uma película branca é observada após a lavagem nesta etapa.
      Opcional: silanizar o mestre SU-8 por exposição a vapor de trimetilclorossilano em uma placa de Petri fechada, durante 10 min.
  2. Preparação do molde de código de barras PDMS
    1. Combinar 40,0 g de base de silicone de elastómero com 4,0 g de agente de cura. Agita-se a mistura de pré-polímero vigorosamente durante 10 min. Desgaseificar durante 20 min sob vácuo.
      Observação: Como uma regra geral, utilizar uma mistura 10: 1 (base: agente de cura) relação de massa.
    2. Verter o pré-polímero em uma placa de Petri contendo uma bolacha de silício com a SU-8 mestre do padrão do código de barras. A altura da mistura PDMS devem ser de cerca de 7,5 mm ou superior. Desgaseificar a mistura no Petri prato para uma segunda vez para remover quaisquer bolhas restantes, em seguida, coze-se a mistura durante 1 hora a 75 ° C para permitir que o PDMS para curar.
      Nota: É importante manter a espessura suficiente da laje PDMS em ~ 7,5 mm ou acima para evitar a adição de demasiada tensão para a ligação de PDMS de vidro aquando da inserção de pinos / tubos através dos furos no molde PDMS no passo (1.3.3.1)
    3. Utilizando um bisturi, com cuidado corte em torno da área da laje de PDMS que contém as características de molde de código de barras e descascar a laje da bolacha.
    4. Aparar os bordos da placa para atingir a forma desejada do molde de código de barras de PDMS. Perfurar 20 buracos (1.0-mm de diâmetro) através do molde utilizando uma punção para biópsia com êmbolo. Assegure-se que os orifícios estão alinhados com as características circulares do padrão do código de barras. Estes buracos servir como as entradas e saídas.
  3. Modelação unidimensional de poli-L-lisina (PLL)
    1. Remover qualquer pó na superfície de uma lâmina de poli-L-lisina de vidro revestido usando uma pistola de ar de azoto. Attach no molde PDMS para a lâmina de vidro limpa. Assegure-se que as extremidades do molde e a lâmina são alinhados.
    2. Cozer durante 1,5 h a 75 ° C, para reforçar a ligação entre o molde PDMS e a corrediça de PLL-revestido. Enquanto isso, preparar 20 peças de tubos de polietileno flexível (3- em pedaços de 4 polegadas, com um diâmetro interno de 0,5 mm e um diâmetro externo de 1,5 mm).
      Nota: O número de pedaços de tubos corresponde ao número de entradas do código de barras no molde PDMS. O tubo serve para acoplar os canais de código de barras sobre o molde PDMS a um tanque de gás de azoto equipado com um regulador de pressão.
    3. Para um fim de cada pedaço de tubo, anexar um pino de aço inoxidável oco (1 mm de diâmetro). Aspirar estéril-filtrada-poli-L-lisina solução através do pino, até que, pelo menos, 1 cm, o tubo é cheio com a solução.
      1. Fixar os pinos (ligado a uma tubagem cheia de solução) para as entradas do código de barras molde PDMS (Figura 1E). Conecte a outra extremidade dos tubos deum tanque de nitrogênio regulada por pressão set-up. Permitir que a solução flua através do molde, utilizando uma gama de pressão de 0,5-1 psi durante pelo menos 6 horas.
        Nota: Consulte o passo (1.3.3) para todos os procedimentos de fluxo de padronização.
  4. Modelação unidimensional de ssDNA 14
    Nota: A solução salina tamponada com fosfato (PBS) utilizada nos passos subsequentes é preparado a partir de 137 mM de NaCl, 10 mM de Na 2 HPO 4, e 2 mM de KH 2 PO 4. O pH do tampão é de 7,4.
    1. Solução 2 mM de cloreto de bis (sulfosuccinimidil) suberato (BS3) em PBS preparar. Preparar soluções de 300 uM A, B, e C de ADNcs (5'-amina modificada, 80 nucleótidos) em PBS ou água ultrapura.
      Nota: Use a solução BS3 dentro de cerca de 30 minutos após a preparação, porque o éster de hidroxissuccinimida N facilmente sofre hidrólise.
    2. Combinar 2,5 uL de 300 uM A, B, ou C ADNcs com 2,5 ul de 2 mm (bis sulfosuccinimidyl) suberato em PBS para cada canal. A, B, e C de ADN são designadas aos canais 1, 2, e 3, respectivamente. Esta ordem é também aplicado para os restantes conjuntos de 3 canais (Figura 2A).
    3. Execute o passo (1.3.3). Desta vez, aspirar as soluções BS3 / DNA 5-ul através de pinos de aço inoxidável e no tubo de polietileno, em seguida, o molde PDMS casal à fonte de nitrogênio. Permitir que a solução BS3 / ADN a fluir através do molde de código de barras para cerca de 40 min ou até aos canais são preenchidos.
    4. Pare o fluxo logo que todos os canais são preenchidos, depois incubar a solução BS3 / ADN no código de barras à TA durante 2 h. Não permita que a solução para secar. Asse o molde PDMS com corrediça de código de barras ligado durante 1 hora a 75 ° C.
      Nota: Para facilitar o alinhamento em passos subsequentes de fluxo de padronização, os bordos do padrão de canal de código de barras sobre a corrediça pode ser delineado. Isto é feito por cuidadosamente riscar a superfície do vidro utilizando um diamante Scribe para gerar marcas de alinhamento na parte inferior da placa de vidro. Alinhamento em fases posteriores do protocolo pode ser verificado sob um microscópio.
    5. Retirar o molde PDMS da corrediça de código de barras. Lavar o deslize suavemente com SDS a 0,01% e uma vez a três vezes com água ultrapura.
      1. Seque o slide código de barras usando um spinner lâmina de microscópio. Armazenar as lâminas de código de barras num tubo limpo de centrífuga de 50 ml, para utilização subsequente.

2. Validação do padrão One-dimensional no Slide Barcode

Nota: Este protocolo de validação pode também ser adaptado para utilização na avaliação da qualidade de passos de modelação de fluxo posteriores.

  1. O bloqueio da corrediça
    1. Prepare 1% de albumina de soro bovino (BSA) em PBS. Filtrar esta solução através de um filtro de seringa de 0,45 um antes da utilização. Utilizando uma ponta de carregamento de gel, aplicar 50 ul de solução de BSA a 1% a uma aresta da lâmina de código de barras.
    2. Incubar a 1% de BSA solutião positivo durante 1 h à TA.
  2. A incubação com a Cianina 3 (Cy3) conjugado a ADN complementar
    1. Prepara-se uma mistura de A ', B', C e oligonucleótidos 'conjugado com Cy3 numa extremidade. As sequências de A ', B' e C 'são complementares das de A, B, e C, respectivamente. A concentração de trabalho do ADN-Cy3 é de 0,05 uM em 0,1% de BSA.
    2. Remover a solução de BSA a partir do slide por pipetagem, em seguida, aplicam-se 30 ul da solução de cocktail de ADN, na mesma borda do diapositivo. Incubar o cocktail de Cy3-ADN no slide à TA durante 1 h. Executar este passo de incubação no escuro para proteger a porção de Cy3 fotobranqueamento.
  3. Análise de intensidade de fluorescência
    1. Pipetar para o cocktail de ADN Cy3 e lavar a lâmina em 1% de BSA, PBS, e finalmente diluída em PBS (1 Parte PBS com 50 partes de água ultrapura). Secar a lâmina utilizando um spinner.
    2. Observar a fluorescência (Figura 2B), utilizando um microscópio de fluorescência ou um scanner de microarray. Ao usar um scanner de microarray, defina o comprimento de onda de emissão de laser para 532 nm, o tamanho do pixel em 5 microns, tubo fotomultiplicador ganho (PMT) a 450 e de energia em 15%.

3. Fabricação da Matriz 2 dimensional-DNA (3x3) 14

  1. Preparação do molde de código de barras PDMS
    1. Realizar procedimento (1.1) para a construção de uma outra SU-8 mestre, mas desta vez utilizando uma máscara de cromo com um padrão de fluxo perpendicular a essa da primeira concepção. Execute o procedimento de (1,2) para a construção de um novo molde PDMS com o padrão perpendicular.
  2. Padrões de fluxo bi-dimensional de ADNcs
    1. Para uma matriz 3 x 3, prepare-150? M soluções estoque de A'-i, ii, B'-C'-iii, A'-IV, B'-V, C'-vi, A'-vii, B'DNA -viii, e C'-IX em BSA a 3% / PBS. Estes oligonucleótidos servem como "sequências de ponte" (Figura 2A). Combinam-se as soluções de oligonucleótidos (Soluções 1 a 3) tal que a concentração de trabalho é de 50 uM para cada oligonucleótido. Use o guia proporcionado na Tabela 1.
    2. Fluxo de 3% de BSA / PBS, solução de bloqueio em todos os 20 canais durante 1 hora a 0,5-1 psi.
    3. Soluções de fluxo de 1, 2, e 3 para os canais 1, 2 e 3, respectivamente. Siga esta ordem para conjuntos subsequentes de 3 canais. O fluxo é geralmente terminada em cerca de 40 min. Incubam-se as soluções de ADN à TA durante 2 h, para permitir o ADN para hibridar.
    4. Fluxo de 3% de BSA / PBS, solução de bloqueio em todos os 20 canais durante 1 hora a 0,5-1 psi para remover o ADN não hibridado. Retire a laje de PDMS, e lavar a lâmina de microarranjo de DNA resultante, mergulhando a lâmina de vidro em 3% de BSA / PBS e PBS uma vez, duas vezes, seguido de PBS diluída (1 parte de PBS e 50 partes de água ultrapura). Dry o slide usando um spinner lâmina de microscópio.
    5. Executar uma segunda etapa de validação (Figura 2C) semelhante à da seção 2. Use oligonucleotídeos i 'a ix' que são Cy3 conjugado. Armazenar a 3 x 3 corrediça matriz em um tubo de centrífuga de 50 ml, para utilização subsequente.
      Nota: A DNA microarray pode ser armazenado a temperatura ambiente num excicador durante meses.

4. Conversão da matriz de 3 x 3 de ADN num matriz de anticorpo

  1. Preparação de anticorpo por oligonucleótidos (negócio) conjugados
    1. Preparar soluções de 200 mM de succinimidil-4-formilbenzoato (S-4FB) e 40 mM de succinimidil-6-hydrazinonicotinamide (HYNIC-S) em N, N-dimetilformamida (DMF).
    2. Prepara-se a 7 soluções separadas de anticorpos de captura (1 mg / ml) em PBS.
      Nota: Se as soluções de reserva anticorpo contêm azida de sódio bacteriostático, realizar a troca de tampão com PBS usando rotação dessalinização columns com 7 kDa de peso molecular de corte (MWCO).
    3. Prepare separados 400? M de soluções i, ii ', iii', iv ', v', vi ', e DNA "vii. Atribuir cada anticorpo de captura a uma sequência oligonucleotídica. Combinar 40 uL de 400 uM de ADN com 12,25 ul de DMF em tubos de microcentrífuga e girar para baixo para misturar completamente.
      1. Para cada solução de ADN / DMF, adicionar 2,3 mL de 200 mM de S-4FB em DMF. Para cada 100 ng de anticorpo de captura, adicionar 2,25 mL de 40 mM de S-HYNIC em DMF.
    4. Incubam-se as soluções de anticorpo / S-HYNIC e ADN / S-4FB durante 4 h à TA.
    5. Em preparação para a reacção de acoplamento de anticorpo-ADN, preparar novas colunas de centrifugação de dessalinização (um para cada solução de ADN e um para cada anticorpo), lavando-as com tampão de citrato a pH 6.
    6. Após 4 h de incubação, realizar a troca de tampão para cada anticorpo / S-HYNIC e solução de ADN / S-4FB. Combine o S-4FB conjugada 'oligonucleotídeos VII com os conjugados anticorpo-S-HYNIC. Incubam-se as misturas durante 2 horas à TA.
    7. Incubar a reacção de O / N a 4 ° C.
  2. A purificação de anticorpo por oligonucleótidos (negócio) conjugados
    Nota: Para purificar os conjugados de anticorpos-oligonucleótido, proteína rápido realizar cromatografia líquida (FPLC) em um sistema padrão de FPLC equipado com uma coluna de Superose 6 10/300 GL.
    1. Definir o comprimento de onda do detector de UV de sistema de FPLC de 280 nm. Use fluxo isocrático de PBS (pH 7,4) a 0,3 ml / min para separar os conjugados de anticorpo-oligonucleótido a partir do excesso de DNA-4FB-S.
    2. Reunir as fracções contendo o conjugado e concentra-se as fracções até um volume de 150 ul usando filtros de spin com um MWCO de 10 kDa.
  3. Modelação bidimensional de anticorpos
    1. Prepare outro molde PDMS com microchambers ou micro poços-using procedimentos de fabricação na etapa (1.2). O molde pode conter PDMS microlitros aos poços nanolitros para imunoensaios.
      Nota: Para a detecção de biomarcadores geral em amostras de fluidos, um molde PDMS com vários poços é acoplado com o slide matriz. As características do molde PDMS dependem do sistema a ser estudado. Por exemplo, a detecção de proteínas a partir de experiências com células individuais podem ser realizadas com um molde PDMS contendo microchambers com volumes de 0,15-nl.
    2. (Opcional) Apresentar o molde PDMS de plasma de limpeza (18 W) para 1,5 min para tornar sua superfície hidrófila modelado. Antes da limpeza de plasma, utilizar fita adesiva para bloquear todas as outras superfícies que vão ser ligados directamente à matriz 3 x 3 corrediça.
      Nota: O passo (4.3.2) é opcional, mas é normalmente realizada quando o molde PDMS é destinado a ser utilizado em experiências de células únicas.
    3. Acoplar o molde PDMS com a matriz 3 x 3 corrediça, em seguida bloquear a corrediça com 1% de BSA em PBS. Incubar durante 1 h à TA. Meanwhile, se preparar um cocktail (volume final 200 ul) de conjugados de anticorpos-oligonucleótido. A concentração de trabalho de cada conjugado é de 10 ug / mL em 1% de BSA / PBS.
    4. Adicionar a mistura de anticorpos-oligonucleótido, depois incubar durante 1 hora a 37 ° C para permitir que a porção dos conjugados oligonucleótido para hibridar com manchas específicas sobre as matrizes de 3 X 3, convertendo assim a matriz de ADN para uma matriz de anticorpo.
    5. Repita o passo (3.2.4) para limpar e secar o slide. A sensibilidade mais elevada pode ser conseguida, se a matriz de anticorpo é utilizado imediatamente. Armazenamento prolongado pode resultar em perda de sensibilidade.
  4. Detecção de proteínas
    1. Reconstituir proteínas recombinantes ou preparar uma amostra de células filtrada.
    2. Acoplar o microarray com um chip personalizados, e bloquear a superfície com 3% de BSA em PBS durante 1 h. Em seguida, remover a solução de BSA, e aplicam-se as amostras e incuba-se durante 2 h.
    3. Lavar as amostras usando 3% BSA em PBS três vezes, umad em seguida, adicione detecção de anticorpos a uma concentração fornecida pela ficha técnica do produto. Incubar durante 2 horas.
    4. Lavar os anticorpos de detecção por 3% de BSA em PBS três vezes, e, em seguida, adicionar Cianina 5 (Cy5) -streptavidin a 1 ug / ml, seguido de incubação durante 1 h.
    5. Repita o passo (3.2.4) para limpar e secar o slide para a digitalização.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Os desenhos para as PDMS moldes (Figura 1A-1B) foram elaboradas usando um programa CAD (AutoCAD). Dois projetos mostrados os canais de recursos para padrões de fluxo, um horizontal e um vertical. As partes esquerda e direita de cada projeto são simétricos; qualquer um deles poderia ser entradas ou saídas. Cada um dos 20 canais é de enrolamento a partir de uma extremidade até à outra extremidade. Cada design é impresso em um photomask cromo (Figura 1C). A SU-8 fabricado numa bolacha mestre é mostrado na Figura 1D. Para facilitar o fluxo de PLL-modelação ou ADN, o molde PDMS foi acoplado a um caudal de azoto gasoso set-up (Figura 1E).

Há três etapas de fluxo de padrões utilizados neste protocolo. O primeiro passo imobiliza PLL no substrato de vidro, enquanto que os passos subsequentes ambos introduzir soluções de oligonucleótidos. Na Tabela 1, o oligonucleSoluções de composições otide 1-3 são dados. A concentração de trabalho de cada oligonucleótido é de 50 ^ M e o volume total de cada solução é de 39 ul. Estas soluções são preparadas através da combinação de 13 ul de cada solução de estoque de oligonucleótidos (150 ^ M).

As unidades de DNA microarrays estampados são repetitivos e adjacente ao longo de toda a lâmina de vidro. Para 3 x 3 microarrays, a densidade máxima é de cerca de 400.000 manchas sobre uma lâmina de vidro. Comparação lado-a-lado com DNA microarrays comercial revela que a nossa tecnologia é de cerca de 5 vezes mais sensível quando se ligar a Cy3 marcado DNAs complementares. Os DNAs estampados são relativamente uniforme com variação ~ 5% em múltiplas repetições. Essas características prometer a alta capacidade quantificação da nossa tecnologia ao medir os teores de proteínas de amostras biológicas. Além disso, a ortogonalidade de ADN em combinação com o design de canais de escoamento oferecem a flexibilizaçãoTy de modelação em uma variedade de geometrias (Figura 2D).

Depois de converter a matriz de ADN para uma matriz de anticorpo através de hibridação com ADN-anticorpo conjugados (Figura 3B), o painel de anticorpos resultante é usada para a detecção multiplexada, principalmente por meio de ELISA de sanduíche de plataforma, como mostrado na Figura 3C. Em ELISA de sanduíche, de detecção de anticorpos biotinilados (secundários) ligam-se às proteínas capturadas, e rotulagem subsequente com estreptavidina conjugada com fluoróforo permite a detecção baseada em fluorescência (Figura 3C-E). A detecção das proteínas mostrar <variação de 10% a partir de uma extremidade para a outra extremidade da lâmina de vidro (Figura 3D). Com a matriz de 3 x 3, que são capazes de detectar até 7 proteínas, enquanto que a atribuição de um elemento de matriz como referência (Cy3 marcado) e um outro elemento como controlo negativo. Por exemplo, em um ensaio de célula única realizada duranteestudos de tumor, das proteínas de interleucina-6 (IL-6), matriz metalopeptidase 9 (MMP9), factor de crescimento de hepatócitos (HGF), factor de crescimento endotelial vascular (VEGF), interleucina-8, factor de (IL-8), e macrófagos inibidor da migração (CIM) de uma única célula pode ser detectado simultaneamente (Figura 3E).

Nós também calibrado o sistema, utilizando proteínas recombinantes em várias concentrações. Na Figura 3F, curvas de calibração para as proteínas recombinantes do interferão-γ (IFN-y), α factor de necrose tumoral (TNFa), interleuquina-13 (IL-13), necrose tumoral β (TNF p), granzima B, interleucina -4 (IL-4), e interleucina-8 (IL-8) são mostrados. A sensibilidade de detecção é bastante semelhante ao de ELISA em sanduíche convencional em placas assim, mesmo com uma carga mais elevada de anticorpos DNAs e possivelmente sobre o substrato.

O código de barras Antibody de microarray pode ser usado para detectar biomarcadores em amostras de fluidos, bem como em células isoladas. Como a análise de uma única célula não é o foco deste protocolo, nós simplesmente exemplificou a aplicação do 3 x 3 anticorpo microarray na detecção de citocinas. Através de interacções anticorpo-marcador de superfície, aglomerado de diferenciação 8 (CD8) -positivas células foram capturados sobre um dos elementos de microarray (Figura 3G; um chip PDMS no topo), e o resto dos elementos foram usadas para detectar citoquinas segregadas ( Figura 3H). Com este método de captura de células, "conjuntos de células" podem ser formados. Esta técnica de captura de matriz também permite o controle sobre o número de células sujeitas a cada ensaio de ELISA. As células foram fisicamente isoladas nas microcâmaras de modo que as proteínas detectadas dizem respeito a células individuais particulares. Na figura 3H, é mostrado que cada microcâmara 16 está equipado com elementos de microarranjo para assegurar o encapsulamento deum completo 3 x 3 set microarray.

figura 1
Figura 1. Projeto e fabricação de moldes de PDMS de código de barras para baseado em fluxo padronização DNA. O painel (A) mostra os desenhos do AutoCAD para os padrões de código de barras unidimensional horizontal e vertical. O painel (B) mostra os padrões de código de barras horizontais e verticais sobrepostas de (a). Caixas verdes delimitar áreas modeladas com discretas 3 x 3 matrizes. Máscara (C) Chrome para fabricar o mestre SU-8. (D) SU-8 mestre fabricado numa bolacha de silício. (E) Set-up para padronização do fluxo. Por favor clique aqui para ver uma versão maior desta figura.

Figura 2 Figura 2. Construção e validação de uma matriz de DNA 3 x 3. Este valor foi modificado a partir de "quantificar funções de interação célula-célula com aplicativos para células de glioblastoma multiforme Câncer", de Wang, J. et al., 2012, Nano Lett 12 . Copyright 2012 pela American Chemical Society. Adaptado com permissão. (A) Esquema para as etapas de fluxo de padrões de DNA. Perfil (B) A intensidade de fluorescência de 20 canais numa área seleccionada (traçada por uma linha vertical) do código de barras 1D. Cy3-conjugado oligonucleótidos foram hibridados com as matrizes de ADN para validação. (C) perfil de intensidade de fluorescência de ADN com matrizes validados Cy3-conjugado depois de completar o segundo passo de modelação de ADN. (D) padrões fluorescentes alternativos de fl diferenteow-padronização estratégias. Por favor clique aqui para ver uma versão maior desta figura.

Figura 3
Figura 3. Processo de microarray 3 x 3. (A) Esquema para a síntese de conjugados de anticorpo-DEAL oligonucleótido. (B) Esquema para a conversão de a matriz de ADN para uma matriz de anticorpo através de hibridação com os conjugados de anticorpos-oligonucleótido. (C) Esquema de microarray utilizando 3 x 3 em uma plataforma de ELISA em sanduíche. Esta figura foi modificado a partir de "quantificar funções de interação célula-célula com aplicativos para células de glioblastoma multiforme Câncer", de Wang, J. et al., 2012, Nano Lett 12. Direitos de autor 2012 pela American Chemical Society. Adaptado com permissão. Painel (D) mostra uma leitura de fluorescência gerada sob um canal Cy5. Isto corresponde a um ensaio ELISA em sanduíche que detectado 6 proteínas. Painel (E) é um zoom-in perfil de uma leitura de 3 x 3 matriz sob canais Cy3 e Cy5. O painel (F) mostra as curvas de calibração de ELISA de sanduíche para as proteínas recombinantes. O painel (G) mostra uma "matriz celular", formado por captura de células por meio de ligação com os anticorpos na matriz. Painel (H) mostra o resultado de detecção sobreposta com microchambers em um microchip. Por favor clique aqui para ver uma versão maior desta figura.

1
Solução Oligonucleotide Composição
A'-i, B'-ii, C'-iii
2 A'-IV, B'-V, VI-C'
3 A'-vii, B'-viii, C'-ix

Tabela 1. Composição das Soluções 1-3 para ADN Fluxo de modelação.

Sequências de ancoragem
UMA ATCCTGGAGCTAAGTCCGTA-AAAAAAAAAAAAAAAAAAAA-ATCCTGGAGCTAAGTCCGTA-AAAAAAAAAAAAAAAAAAAA
B GCCTCATTGAATCATGCCTA-AAAAAAAAAAAAAAAAAAAA-GCCTCATTGAATCATGCCTA-
AAAAAAAAAAAAAAAAAAAA
C GCACTCGTCTACTATCGCTA-AAAAAAAAAAAAAAAAAAAA-GCACTCGTCTACTATCGCTA-AAAAAAAAAAAAAAAAAAAA
Colmatar as sequências
A'-i TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA-ATGGTCGAGATGTCAGAGTA
B'-II TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA-ATGTGAAGTGGCAGTATCTA
C'-iii TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA-ATCAGGTAAGGTTCACGGTA
A'-iv TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA-GAGTAGCCTTCCCGAGCATT
B'-v TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA-ATTGACCAAACTGCGGTGCG
C'-VI TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA-TGCCCTATTGTTGCGTCGGA
A'-VII TACGGACTTAGCTCCAGGAT-AAAAAAAAAAAAAAAAAAAA-TCTTCTAGTTGTCGAGCAGG
VIII B'- TAGGCATGATTCAATGAGGC-AAAAAAAAAAAAAAAAAAAA-TAATCTAATTCTGGTCGCGG
C'-ix TAGCGATAGTAGACGAGTGC-AAAAAAAAAAAAAAAAAAAA-GTGATT AAGTCTGCTTCGGC
Oligonucleótidos Cy3-conjugado para validação
UMA' TACGGACTTAGCTCCAGGAT
B ' TAGGCATGATTCAATGAGGC
C ' TAGCGATAGTAGACGAGTGC
Eu' TACTCTGACATCTCGACCAT
ii ' TAGATACTGCCACTTCACAT
iii ' TACCGTGAACCTTACCTGAT
iv ' AATGCTGGGGAAGGCTACTC
v ' CGCACCGCAGTTTGGTCAAT
VI ' TCCGACGCAACAATAGGGCA
vii ' CCTGCTCGACAACTAGAAGA
viii ' CCGCGACCAGAATTAGATTA
ix ' GCCGAAGCAGACTTAATCAC
"Fo: manter-together.within-page =" 1 "> Tabela 2. As sequências de DNA usados ​​no fluxo-padronização.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Padrão de fluxo de concepção é o primeiro passo crítico na fabricação da micromatriz 2-D. Para gerar dois padrões de ADN que se sobrepõem sobre um substrato de vidro, as características do canal do primeiro design deve ser perpendicular às da segunda (Figura 1A-B). Os projetos também considerar as aplicações a jusante do microarray. No caso de análise de uma única célula, o micro-arranjo é utilizado para detectar proteínas a partir de células individuais e fechadas em microcâmaras, por conseguinte, as dimensões do canal são tornadas compatíveis com as microcâmaras que se alinham com as matrizes de 2-D. Cada projeto é rendida em um photomask e técnicas de fotolitografia padrão são usadas para fabricar as características de canal em SU-8 em um wafer de silício (Figura 1C-D). Isto serve como o mestre PDMS para moldagem. Depois de o molde ter sido fabricada, que está ligado a uma corrediça de PLL-revestido e, em seguida, acoplado com um caudal de azoto gasoso set-up (Figura 1E). O que set-uputilização é simples e tem a vantagem de ser facilmente incorporado em qualquer laboratório com uma fonte de gás de azoto de pressão regulada. Nós usamos uma montagem de várias válvulas de baixo custo de 3 vias conectadas a um tanque de gás nitrogênio. O fluxo de ar para a modelação devem ser mantidos a baixas pressões (0,5-1 psi) para evitar a delaminação da lâmina de vidro a partir do molde. As fugas no interior do molde PDMS pode comprometer a integridade dos padrões.

Os passos de modelação de fluxo de ADN neste protocolo utilizar ADNcs com sequências ortogonais cuidadosamente seleccionadas (Figura 2A). Antes de fluir-padronização, as sequências únicas sobre estes oligonucleótidos devem ser testadas para a ausência de diafonia. Um teste simples para a diafonia é feito modificando o procedimento de validação que introduzir no nosso protocolo (Passo 2). Em vez de utilizar um cocktail de Cy3 com etiquetas de ADN complementar, apenas um tipo de sequência complementar é utilizada de cada vez para uma área seleccionada da corrediça no qual múltiplosAs sequências de ADN são imobilizadas. Na ausência de ADN conversa cruzada, apenas uma banda (para o ADN matriz 1-D) ou um ponto (para o ADN matriz 2-D) deve ser fluorescente sob um filtro de Cy3. Exemplos de sequências ortogonais completamente validados podem ser encontrados na Tabela de Materiais e Equipamentos. O primeiro passo padronização DNA introduz três tipos de oligonucleotídeos "âncora". Estas sequências de 80 nt são compostos de duas regiões poli-A 20-mer que alternam com duas seqüências de 20-mer únicas. A modificação 5'-amina nestas sequências âncora é necessário para amina-a-amina de reticulação 17 com PLL mediada por BS3. O segundo passo de modelação de ADN não requer um agente de reticulação. Este passo introduz oligonucleotídeos "ponte" que hibridizam em parte com as sequências de ancoragem. Cada uma das sequências de ligação de 60-nt consiste de uma região de 20-mero complementar a uma sequência de âncora, um 20-mero de poli-A espaçador, e uma sequência de 20-mer única. Validação das matrizes de ADN (Figure 2B-C) é realizada depois de cada passo de ADN de fluxo-padronização para avaliar a qualidade dos passos de modelação e para garantir que não haja contaminação cruzada 14. Isto é realizado através da introdução de sondas de oligonucleótido conjugado com Cy3 que hibridam com os padrões de ADN. Com os parâmetros definidos no Passo (2.3.2) para a análise da intensidade de fluorescência, os padrões de DNA deve apresentar intensidades de fluorescência de pelo menos 40.000 au para maximizar a sensibilidade de imunoensaios jusante realizada utilizando o microarray. A utilização estratégica de diferentes conjuntos de Cy3-ADN durante a validação dá origem a padrões alternativos (Figura 2D), demonstrando assim a flexibilidade da padronização ADN passos 8. Incapacidade de alcançar padrões uniformes poderiam resultar de vazamentos ou obstruções mecânicas (tais como partículas de poeira) encontrou nas etapas de fluxo de padronização.

A preparação de conjugados de anticorpo-DEAL oligonucleótido é um passo crítico no thé protocolo. A escolha de anticorpos é ditada pelo sistema biológico sob estudo. Os oligonucleótidos utilizados em conjugação deve ter sequências que são complementares às ancorada na matriz de ADN. As soluções de ligantes S-4FB e S-HYNIC devem ser preparados e mantidos longe da umidade para evitar a hidrólise. Os tempos de incubação utilizado no nosso protocolo de conjugação são o tempo suficiente para introduzir as funcionalidades desejadas sobre os anticorpos e ADN. A reacção de acoplamento final é somente suprimida por remoção dos oligonucleótidos S-4FB-conjugados que não reagiram através de FPLC. Assim, FPLC purificação deve ser realizado imediatamente após a conclusão da conjugação. Ao realizar FPLC com o sistema descrito no nosso protocolo, taxas de fluxo inferiores (0,2-0,25 mL / min) também pode ser utilizado para melhorar a resolução. Os conjugados são eluídos como um pico largo (volume de eluição de cerca de 9-15 ml) que aparece antes de um pico de DNA mais estreito e alto (17-20 ml volume de eluição). Nós não recomendamos armazenar soluçõesconjugados com excesso de S-4FB-ADN, porque isso pode levar a perda de locais de ligação a antigénio no anticorpo mediante conjugação com excesso funcionalizado ADN. A sensibilidade, especificidade e reprodutibilidade do ELISA de sanduíche utilizando conjugados DEAL foram demonstradas em estudos anteriores. 8,9,11,12,16 Para avaliar a qualidade dos conjugados de anticorpo-ADN, os conjugados podem ser incubadas em matrizes de ADN para gerar o matriz de anticorpo, o qual é subsequentemente utilizada em experiências de ELISA de sanduíche para gerar curvas de calibração para a detecção de proteína (Figura 3F). Para gerar as curvas de calibragem, podem ser usadas as proteínas recombinantes proporcionadas num kit de ELISA em sanduíche convencional. O uso de conjugados de alta qualidade deveria dar origem a cadeias lineares e limites inferiores de detecção comparáveis ​​com aqueles do kit. Como um exemplo, os limites mais baixos para INFγ e TNFa para ELISA sanduíche sobre a matriz de anticorpo (Figura 3F) são ~ 50-100 pg / ml, e são consistent com a faixa de detecção linear de ~ 15-1,000 pg / ml indicado na ficha técnica do produto para o kit de ELISA sanduíche convencional. Leitura de sinal fraco obtido em experiências de ELISA sanduíche a jusante poderia ser atribuída à baixa qualidade da matriz de ADN, o ADN do excesso de interferência nas soluções de conjugado, ou, em alternativa, a conjugação de ssDNAs incompleta com anticorpos.

Principais preocupações para realizar ELISA sanduíche na matriz de anticorpo incluem a diafonia entre os reagentes e se o sinal reflecte os eventos biológicos reais. Os DNAs ortogonais que usamos neste protocolo, foram exaustivamente validada ter menos de 0,1% de cross-talk. Por conseguinte, qualquer conversa cruzada observada na fase de imunoensaio é principalmente a partir dos anticorpos e reagentes de ELISA. Testes para conversa cruzada entre os anticorpos na matriz deve ser realizada antes da realização de ensaios em amostras reais. Uma vez que um painel de anticorpos é construído, a poucos sanduíche experimentos de controle de ELISA deve ser perfORMED com as seguintes condições: 1. Sem antigénios, 2. Sem anticorpos, detecção de anticorpos e detecção de 3. e apenas reagentes de marcação. Se a diafonia é observado na fase de imunoensaio, os pares de anticorpos e / ou os reagentes de ELISA deve ser substituído. Deve notar-se que a utilização de anticorpos disponíveis comercialmente a partir de kits de ELISA convencionais não garante a aplicabilidade da técnica ELISA sanduíche à base de matriz.

Os méritos desta tecnologia incluem a fabricação de baixo custo, tamanho miniatura, e flexibilidade de design. Nosso protocolo de fabricação não precisa de um microarray spotter que pode não estar disponível para muitos usuários de matrizes de anticorpo. O padrão de fluxo de set-up podem ser facilmente montadas em laboratórios simples. Para laboratórios que não estejam equipados com instrumentos para fotolitografia, os desenhos CAD que oferecemos em nosso protocolo pode ser transmitida a empresas que oferecem serviços de microfabricação. Downsizing o microarray convencional ema matriz compacto fabricado com nosso protocolo permite a compatibilidade com microchips utilizados em experiências de uma única célula. Nosso protocolo apresenta a produção da matriz como uma matriz de ADNcs primeiro antes da conversão a uma matriz de anticorpo. Padronização preliminar com ssDNAs tem um número de vantagens. Em primeiro lugar, ssDNAs são quimicamente mais estáveis ​​em relação a anticorpos, assim as lâminas modelado-ssDNA pode ser armazenado num exsicador durante pelo menos 6 meses, sem degradação significativa 8,16. Em segundo lugar, a nossa abordagem oferece um usuário final a flexibilidade de escolher os ensaios necessários, simplesmente misturando os conjugados selectivos juntos em uma solução sem modificação do microarray; Pelo contrário, as matrizes de anticorpo / proteína convencionais são pré-concebido e fixo sobre um substrato, de modo que a mudança de ensaios exigiria a modelação / impressão de proteínas / anticorpos, desde o início. Estudos representativos ilustram o uso de micro-arranjo de anticorpos de código de barras em a de alto rendimento detectioN de várias proteínas de sinalização a partir de células individuais. Variando os modelos padrão de fluxo e / ou as soluções de oligonucleótido padronização utilizados, uma multiplicidade de esquemas de matriz pode ser explorado. Como um exemplo desta aplicação, as proteínas funcionais a partir de células individuais podem ser estudados. O chip para análise de uma única célula abrange tantos como ~ 8.700 microchambers, cada um alinhado com um completo 3 x 3 anticorpo array (Figura 3H). Tal configuração permite a detecção de alto rendimento. As proteínas segregadas por células cultivadas em microcâmaras podem ser detectadas por este conjunto. O desenho também permite que microarray versátil para a detecção de proteínas multiplexado de soro, lisados ​​de células, e células isoladas após combinação microarray com outros componentes genéricos 8,15. Em adição à detecção de proteína, a 3 x 3 matriz de anticorpo também é útil em células de captura (Figura 3G).

A principal desvantagem desta abordagem é a sua compl adicionalexity em comparação com o fabrico de microarrays convencionais. Estratégias para a padronização e para o projeto matriz deve ser cuidadosamente conceptualizada considerando as aplicações específicas da matriz fabricada. Esta abordagem também requer uma série de passos críticos, incluindo os procedimentos de validação e testes para cross-talk. A matriz de 3 x 3 construído usando o nosso protocolo é limitado à detecção de 7 proteínas de cada vez. No entanto, este limite pode ser ultrapassado através da criação de matrizes maiores. O protocolo apresentado aqui não se limita à fabricação de 3 x 3 microarrays. Temos sido capazes de fabricar com sucesso 5 x 5 microarrays e outras dimensões de elementos da matriz. Em princípio, outras matrizes n x m podem ser fabricados usando técnicas semelhantes, desde que os conjuntos de oligonucleótidos utilizadas na criação da matriz modelado por ADN preliminar são ortogonais para evitar conversas cruzadas entre os elementos de matriz. A criação de matrizes expandido é alcançada por fluxo patterning de ADNcs n tipos de ancora para o primeiro passo de padronização de DNA, seguido de n x m ponte sequências de ADNcs para o segundo passo de padronização. Por exemplo, para criar uma matriz de 5 x 5, as sequências de âncora de A a E pode ser utilizado, enquanto que as sequências de ponte A'-I são utilizados para XXV-E'. Para automatizar o processo de padronização do fluxo, uma plataforma robótica foi desenvolvida 18, embora isto só foi utilizado um passo de ADN de padronização fluxo. Em princípio, a mesma plataforma pode ser estendida para o segundo passo de modelação fluxo perpendicular, enquanto que a comutação entre as duas etapas podem requerer manualmente descascando o primeiro molde PDMS após o primeiro passo de modelação, seguido de lavagem e secagem da corrediça (este passo seria levar cerca de 10 minutos), antes do acasalamento o slide com outro molde PDMS para facilitar a padronização segundo passo no sentido perpendicular.

Nós discutimos os procedimentos detalhados para a fabricação de uma matriz nxm modeladocom anticorpos em alta densidade, que é uma grande promessa para futuras aplicações em estudos de proteômica e sinalização celular. O protocolo aqui apresentado pode também servir como um guia para a construção de matrizes de ADN mais elaborados / anticorpos para outros fins.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
Sylgard 184 silicone elastomer base Dow Corning 3097366-1004
Sylgard 184 silicone elastomer curing agent Dow Corning 3097358-1004
SU-8 2025 photoresist MicroChem Y111069
Silicon wafers  University Wafers 452
Poly-L-lysine coated glass slides Thermo Scientific C40-5257-M20
Oligonucleotides Integrated DNA Technologies *Custom-ordered from Integrated DNA Technologies, see Table 2.
Poly-L-lysine adhesive stock solution Newcomer Supply 1339
Bis (sulfosuccinimidyl) suberate  (BS3) Thermo Scientific 21585
1x Phosphate buffered saline, pH 7.4 Quality Biological 114-058-101
Äkta Explorer 100 Fast Protein Liquid Chromatography (FPLC) System GE (Amersham Pharmacia)  18-1112-41
Superose 6 10/300 GL column GE Healthcare Life Sciences 17-5172-01
Capture antibodies various various *Antibody selection depends on application
Succinimidyl-6-hydrazino-nicotinamide (S-HyNic) Solulink S-1002
Succinimidyl-4-formylbenzamide (S-4FB) Solulink S-1004
N,N-dimethylformamide Sigma-Aldrich 227056
Citric acid, anhydrous Acros 42356
Sodium hydroxide Fisher Scientific S318
Amicon Ultra spin filter 10 kDa MWCO EMD Millipore UFC201024
Spin coater Laurell Technologies WS-650-MZ
Biopsy punch with plunger (1.0 mm diameter) Ted Pella, Inc. 15110-10
Diamond scribe (Style 60) SPI supplies 6004
Trimethylchlorosilane Sigma Aldrich 92361

DOWNLOAD MATERIALS LIST

References

  1. Alhamdani, M. S. S., Schroder, C., Hoheisel, J. D. Oncoproteomic profiling with antibody microarrays. Genome Med. 1, (7), (2009).
  2. Angenendt, P. Progress in protein and antibody microarray technology. Drug Discov Today. 10, (7), 503-511 (2005).
  3. Sun, H. Y., Chen, G. Y. J., Yao, S. Q. Recent advances in microarray technologies for proteomics. Chem Biol. 20, (5), 685-699 (2013).
  4. Fan, R., et al. Integrated barcode chips for rapid, multiplexed analysis of proteins in microliter quantities of blood. Nat Biotechnol. 26, (12), 1373-1378 (2008).
  5. Chattopadhyay, P. K., Gierahn, T. M., Roederer, M., Love, J. C. Single-cell technologies for monitoring immune systems. Nat Immunol. 15, (2), 128-135 (2014).
  6. Varadarajan, N., et al. Rapid, efficient functional characterization and recovery of HIV-specific human CD8(+) T cells using microengraving. Proc Natl Acad Sci USA. 109, (10), 3885-3890 (2012).
  7. Ma, S., et al. Electroporation-based delivery of cell-penetrating peptide conjugates of peptide nucleic acids for antisense inhibition of intracellular bacteria. Integr Biol-Uk. 6, (10), 973-978 (2014).
  8. Wang, J., et al. Quantitating cell-cell interaction functions with applications to glioblastoma multiforme cancer cells. Nano Lett. 12, (12), 6101-6106 (2012).
  9. Kravchenko-Balasha, N., Wang, J., Remacle, F., Levine, R. D., Heath, J. R. Glioblastoma cellular architectures are predicted through the characterization of two-cell interactions. Proc Natl Acad Sci USA. 111, (17), 6521-6526 (2014).
  10. Xue, M., et al. Chemical methods for the simultaneous quantitation of metabolites and proteins from single cells. J Am Chem Soc. 137, (12), 4066-4069 (2015).
  11. Shi, Q. H., et al. Single-cell proteomic chip for profiling intracellular signaling pathways in single tumor cells. Proc Natl Acad Sci USA. 109, (2), 419-424 (2012).
  12. Ma, C., et al. A clinical microchip for evaluation of single immune cells reveals high functional heterogeneity in phenotypically similar T cells. Nat Med. 17, (6), 738-743 (2011).
  13. Deng, Y., et al. An integrated microfluidic chip system for single-cell secretion profiling of rare circulating tumor cells. Sci Rep. 4, 7499 (2014).
  14. Vermesh, U., et al. High-density, multiplexed patterning of cells at single-cell resolution for tissue engineering and other applications. Angew Chem Int Ed. 50, (32), 7378-7380 (2011).
  15. Yu, J., et al. Microfluidics-based single-cell functional proteomics for fundamental and applied biomedical applications. Annu Rev Anal Chem. 7, 275-295 (2014).
  16. Bailey, R. C., Kwong, G. A., Radu, C. G., Witte, O. N., Heath, J. R. DNA-encoded antibody libraries: A unified platform for multiplexed cell sorting and detection of genes and proteins. J Am Chem Soc. 129, 1959-1967 (2007).
  17. Alegria-Schaffer, A. General protein-protein cross-linking. Methods Enzymol. 539, 81-87 (2014).
  18. Ahmad, H., et al. A robotics platform for automated batch fabrication of high density, microfluidics-based DNA microarrays, with applications to single cell, multiplex assays of secreted proteins. Rev Sci Instrum. 82, 094301 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics