심 외막 파생물 문화 분석 및

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Trembley, M. A., Velasquez, L. S., Small, E. M. Epicardial Outgrowth Culture Assay and Ex Vivo Assessment of Epicardial-derived Cell Migration. J. Vis. Exp. (109), e53750, doi:10.3791/53750 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

심 외막 세포 선 단층 심장, 심근 세포의 증식을 자극 분비 인자를 제공하고 직접 개발 및 심혈관 질환 중에 조상 기여. 다수의 인자가 심장 외막 유래 세포 (EPDC) 동원에 연루되어 있지만, 그 이후의 이동과 분화를 지배하는 메커니즘이 제대로 이해된다. 여기, 우리는 EPDC 운동성 및 분화를 연구하는 생체 외생체 전략을 제시한다. 먼저, 마우스 배아 심장에서 생장 배양 주 외막 세포를 얻는 방법을 설명한다. 또한 장기 배양 시스템에서 표지 EPDC 입체 마이그레이션을 평가하기 상세한 프로토콜을 소개한다. 우리는 심장 외막에 myocardin 관련 전사 인자의 유전 삭제 EPDC 마이그레이션을 감쇠 이러한 기술을 사용하여 증거를 제공합니다. 이 방법은 EPDC의 후보 수식을 평가하기위한 플랫폼 역할생물학은 심장 수리를 위해 유용 할 수 있습니다 EPDC 동원의 새로운 규제를 식별하는 유전 물질 또는 화학 물질 화면을 개발하는 데 사용할 수 있습니다.

Introduction

심장 외막은 중피 세포의 단일 층입니다 라인 심장과 영향 심장 개발, 성숙 및 수리. 분비 신호 높은 코디 교환을 통해, 심근과 외막 사이에 친밀한 대화 심장 성장 및 비 - 심장 근세포 계통 (1)의 형성에 필수적이다. 심 외막 유래 세포 (EPDC)의 상피 - 투 - 중간 엽 전이 (EMT) (2)를 통해 심 외막 세포의 일부에서 등장는 subepicardial 공간 및 기본 심근 침입, 크게 관상 동맥 혈관 벽화 세포와 심장 섬유 아 세포로 분화하고,에 조금 적게, 내피 세포 및 심근 3-9.

심 외막 EMT 및 EPDC 침입 조절 메커니즘 분비 리간드 10-13, 세포 표면 수용체 및 부착 분자 (14, 15), 가열 공기 조절기 등 다양한 분자의 조정 동작에 기인 한혀끝 - 기초 극성 16, 17, 작은 GTP 아제 18, 19, 및 전사의 lators은 2,20,21 요인. EPDC 이주의 분자 이펙터 많은 정의되었지만, 전략의 개발을 촉진 할 수있다 배아 EPDC 가동화를 자극하는 생리적 신호의 더 나은 이해를 개선 심장 수리 어른이 공정을 조작한다.

EPDC 동원의 새로운 규제를 식별하기위한 연구는이 세포 인구의 정제 또는 개별 심 외막 세포의 이동을 추적에 의존하고 있습니다. 하나 WT1, Tcf21, Tbx18 및 / 또는 Aldh1a2 포함 마커 유전자의 조합은 일반적으로 태아의 심장 외막 하나를 식별하는 데 사용된다. 그러나, 이들 마커의 사용은 심 외막 세포 transdif을 겪을 때 심 외막 마커의 발현은 심장 개발의 과정 기울면 종종 손실로 EPDC 최적 아니다 마이그레이션 추적중간 엽 세포로 ferentiation.

정속 신장식 /에 loxP 시스템의 응용 프로그램은, 혈통-추적 기자와 함께 영구적으로 심장 개발하는 동안 심장 외막와 그 하위 라벨 및 성인 7,22,23에서 허혈 손상을 다음에 유용합니다. 여러 심 외막 제한 Cre 호텔 라인이 생성되어 널리 EPDC 라벨 및 조건부 유전자 삭제 전략 1하는 데 사용됩니다. 이러한 연구는 다양한 심 외막 계통의 특성 및 EPDC 운동성 및 분화의 중요한 매개체의 식별을 주도했다. 그러나, 축적 증거가 심장 외막이 전구 세포 4,24,25의 이기종 인구 제안합니다. 따라서, 심 외막 세포의 서브 세트 만이 주어진 Cre 호텔 드라이버를 사용하여 타겟팅된다.

에 관계없이 Cre 호텔 특이성의 전체 심장 외막에 레이블을하기 위해, 실험실의 수는 가지 막힌를 활용 한진짜야 시스템 또는 생체 기관 배양 방법은 충실하게 격리 또는 26 ~ 28 마커 유전자 혈통의 표현에 의존하지 않고 심 외막 세포를 레이블을. 생체 마이그레이션 연구의 경우, 배아 마음 심 외막 EMT 이전 및 녹색 형광 단백질 (GFP) 발현 아데노 바이러스 (광고 / GFP) 9,18 보충 된 배지에서 배양 격리됩니다. 이 접근법은 효​​율적인 전체 심장 외막의 표시보다는 Cre 호텔 매개 재조합에 의해 세포의 부분 집합을 허용한다. 심장의 문화는 이후 EPDC (28, 29)의 동원을 자극하는 EMT의 알려진 유도 물질에 노출되어있다. 예 생체 내생체 내 분석 EPDC 마이그레이션을 운전 자세한 메커니즘을 탐구에 특히 유용한 방법이다 체외 심 외막 이식편 문화에 의해 보완된다.

여기, 우리는 epicardi의 체외 연구에 대한 기본 심 외막 세포를 분리하는 방법을 설명합니다알 EMT뿐만 아니라 생체에 대한 기관 배양 물 시스템은 EPDC 운동성 분석. 우리는 최근 유전자 EPDC 9 굴지 기반 마이그레이션을 조작하는 축 시그널링 myocardin 관련 전사 인자 (MRTF) / 혈청 반응 계수 (SRF)를 변조하여이 방법의 유용성과 견고성을 증명하고있다. 우리의 연구 결과는 EPDC 이동을 규제하기 위해 필요한 하나의 신호 전달 경로를 강조하지만,이 방법은 집합 EPDC 마이그레이션 및 차별화를 조율 메커니즘을 해명하기에 적합하다. 또한, 체외 이식편 및 생체 외 배양 시스템은 심장 재생 치료에 응용 프로그램 EPDC 동원 신규 ​​레귤레이터를 식별하는 기능 화면에서 구현 될 수있다.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

참고 : 마우스 모든 실험은 로체스터 대학 동물 자원에 대학위원회에 의해 승인되었다.

1 심 외막 파생물 문화 분석 (그림 1A)

  1. 준비
    1. 5 % 소 태아 혈청 (FBS), 1 % 페니실린 / 스트렙토 마이신 (PEN / 패 혈성) 중간 (199) (M199)를 보충하여 주 외막 세포 격리 5 ml의 배지 A를 준비한다.
    2. 매체 사전 따뜻한 100ml를 37 ° C의 물을 욕조에 행크스 '균형 소금 솔루션 (HBSS).
    3. 콜라겐 - 코팅 된 챔버 슬라이드를 30 분 동안 실온으로 가온하도록 허용.
    4. 챔버 슬라이드의 각 웰에 100 ㎕의 매체 A를 추가하고 부드럽게 고르게 코트 콜라겐 표면에 회전합니다. 8-12 우물을 반복합니다. 코팅 챔버 후 용지를 제거합니다.
    5. 분취 액을 50 ㎖의 HBSS를 각각 함유하는 두 개의 10cm 2 플레이트로 HBSS를 예열.
  2. 11.5 일 후 교미 (DPC)에서 임신 댐에서 배아 마음을 격리 할 것.(30)
    1. 복강 내 주사를 통해 13 ㎎ / ㎖ 케타민 / 0.88 밀리그램 / 1 배 둘 베코 인산염 완충 식염수 (DPBS)의 ㎖의 자일 라진 칵테일의 0.5 ml의 마우스를 마취. 발가락 핀치 테스트를 사용하여 적절한 마취를 확인합니다. 부드러운 핀치 마우스가 응답 여부를 결정하기에 충분하다. 모든 이동이나 발 철회은 동물이 충분히 수술을 할 마취되지 않음을 나타냅니다. 자궁 전위에 의해 안락사.
    2. 최대 복부 측면에 대향하는 마우스를 놓고 머리에 의한 오염을 줄이기 위해 70 % 에탄올로 복부를 스프레이.
    3. 집게로 피부를 조이고 수술 가위로 복부에 횡 절개를 잘라. 단단히 피부를 누른 다음, 머리와 꼬리를 향해 반대 방향으로 간격을 당깁니다.
    4. 집게로 복막을 조이고 복강을 노출 가위로 잘라.
    5. 조심스럽게 mesometrium을 따라 절단하여 탈락을 제거합니다. 하는 해부 탈락 이동 처음에 HBSS를 미리 예열10cm 2 판.
    6. 배아 사이에 절단하여 탈락을 분리합니다.
    7. 해부 현미경 미리 예열 HBSS로 두 번째 10cm 2 판에 배아를 전송합니다. 조심스럽게 다음 배아 목을 벨의 배외 (extraembryonic) 조직과 난황 주머니를 제거합니다.
    8. 집게와 흉부 벽을 조이고 흉강을 노출, 중간 선에서 떨어져 조직을 찢어.
    9. 심장 뒤 집게를 놓습니다. 유출 관을 잡고 멀리 배아의 마음을 잡아 당깁니다. 아직 장착되어있는 경우, 심장에서 폐 기관과 폐를 분리합니다.
  3. 콜라겐 코팅 슬라이드 하나의 웰에 마음을 전송하고 (그림 1B)를 그 지느러미면을 아래로 놓습니다. 각각의 배아에 대한 단계를 반복 1.2.7-1.3.
  4. 일단 모든 하트 개별 ​​웰에 이전되고, 37 ° C에서 30 분 동안 상기 챔버 슬라이드를 부화, 5 % CO 2는 콜라겐 기질에 충분한 접착을 허용한다.
  5. 조심스럽게 추가각 심장 주위 예열 이식편 매체 A의 20 내지 50 μL. 중요 : 너무 빨리 또는 심장 위의 레벨에 미디어를 추가하지 마십시오, 그렇지 않으면 마음 콜라겐 기판에서 분리 할 수​​ 있습니다.
  6. 문화 약 24 시간 동안 37 ° C, 5 % CO 2에서 마음 심 외막 가지를 허용합니다. 참고 :의 outgrowths는 문화의 조기 3-4로 시간 (그림 1C)를 관찰 주로 최소한의 중간 엽 세포 오염 (도 1D, E)과 자갈이 깔린 형태를 표시 중피 세포로 구성 될 수있다. 대표적인 결과는 카메라가 장착 된 해부 현미경을 사용하여 획득 하였다.

심 외막의 outgrowths 2. 유전 적 절제 및 EMT의 유도

주의 : 승인 된 바이오 안전성 가이드 라인에 따라주의 아데노 바이러스를 처리합니다.

  1. 15 ml의에게 매체 B를 준비 수욕에서 37 ° C로 사전 따뜻하고 (M199은 1 % FBS, 1 % 펜 / 연쇄상 구균 보충).
  2. 의 절단을 위해floxed 대립 유전자는 Cre 호텔의 재조합 효소를 발현하는 아데노 바이러스 2.5 × 104 PFU / ㎖ (광고 / Cre 호텔) 또는 제어 바이러스에 보충 이식편 매체 B를 준비합니다.
    주 : 후보 유전자의 아데노 바이러스 매개 과발현은 또한 기능 표현형의 증가를 평가하기 위해 수행 될 수있다. 바이러스 역가가 최종 사용자에 의해 결정되어야한다.
  3. 조심스럽게 집게를 사용 부산물 문화의 심장 외막 고갈 마음을 제거합니다. 나중에 RNA 분리 및 유전자 발현 분석을 위해 -80 ° C에서 1.5 ml를 800 ㎕의 트리 졸와 튜브 및 저장소로 전송 마음입니다.
  4. 혈액 세포와 과잉 세포 파편을 제거하는 DPBS 잘 각을 씻으십시오.
  5. 각 가지 문화 500 μl를 아데노 바이러스 (들)로 보충 이식편 매체 B를 추가하고 37 ° C, 5 % CO 2에서 24 시간 동안 배양한다.
  6. EMT 유도를 들어, 미디어를 제거하고 재조합 형질 전환 성장 인자 (TGF)로 보충 37 ° C 이식편 매체 B -β1 [10 NG / ㎖] 또는 차량 (4 MM의 시간과 보충ydrochloric 산 (염산)를 함유하는 1 ㎎ / ㎖ 소 혈청 알부민 (BSA)). 37 ° C에서 추가로 24 시간 동안 배양 외식, 5 % CO 2. 유전자 / 발현 분석 단백질 또는 후속 프로토콜에 설명 된대로 면역 세포를 진행합니다.
    참고 : 심 외막 EMT의 유도가 0.5 NG / ㎖에 이르기까지 TGF-β1의 다양한 농도로 자극 한 - 10 NG / ㎖ 26,31-33. 리간드의 높은 농도는 모든 TGF-β 수용체에 결합하는 비 특정 될 수 있습니다. TGF-β1의 농도는 특정 실험의 목표를 반영해야한다.

심 외막의 outgrowths 3. 유전자 발현 분석

  1. 이전에 트리 졸 (2.2)에 저장 해동 심장 외막 고갈 된 마음입니다.
  2. EPDC 문화에서 대기음 미디어와는 DPBS로 두 번 씻는다.
  3. 문화를 이식편하는 800 ㎕를 실온 트리 졸을 추가합니다.
  4. 객실 temperatu에서 5 분 동안 트리 졸의 심장 외막 고갈 마음과 EPDC 문화를 품다 레. 최대 피펫 및 열 배 아래로 용해 샘플을 균질화 할 수 있습니다.
    참고 : 마음이 완전히 균질화 더 피펫을 필요로 할 수있다.
  5. 1.5 ml의 튜브에 해물을 전송하고 제조업체의 지침에 따라 총 RNA 분리를 진행합니다. RNA 수율을 증가시키기 전에 강수량 10 μg의 글리코겐을 추가합니다. 주어진 이식편은 약 0.5 ~ 1.0 μg의 RNA를 얻을 것입니다.
  6. DNase의 I와 오염 DNA를 제거하고 제조업체의 지침에 따라 0.5 μg의 mRNA의를 전사 역.
  7. 녹색 SYBR 및 글리 세르 알데히드 -3- 인산 탈수소 효소 (GAPDH)에 표 1. 표준화 mRNA 수준을 설명 마커를 사용하여 심 외막 외식 및 / 또는 정량적 역전사와 EMT 유도의 순도 (QRT) - PCR (34)를 확인하고 사용 기준 식을 계산 2 - ΔΔCt 방법 35. 전형적인 결과는도 2a에 도시되어있다.
심 외막의 outgrowths의 제목 "> 4. 단백질 분석

  1. EPDC 문화에서 대기음 미디어와는 DPBS로 두 번 씻는다.
  2. 10 μl의 빙냉 단백질을 용해 완충액 (50 mM 트리스 (pH 7.5), 150 mM 염화나트륨, 1 mM의 에틸렌 디아민 테트라 아세트산의 pH를 8.0, 1 % 트리톤 X-100, 1X 프로테아제 억제제 칵테일) 각 웰 챔버를 추가의 챔버 슬라이드를 배치 얼음. P200 피펫 팁에 약 하단의 ¼ 잘라 슬라이드 떨어져 세포를 긁어 나머지 조각을 사용합니다. 피펫 위를 Lyse 심 외막 세포와 1.5 ML 튜브로 전송에 이르기까지.
  3. 30 초 ON과 OFF 사이클 빙수 조에서 5 분 동안 저 (160 W)에 용해 이식편 초음파 처리.
  4. 10,000 XG, 4 ° C에서 10 분 동안 원심 분리 용 해물. 새로운 튜브로 상청액을 옮기고, 단백질 분석 (36)를 사용하여 단백질 농도를 결정한다.
    참고 : 주어진 이식편은 최대 1.5 μg의 총 단백질을 얻을 것입니다. 우리가 발견 한 두 개의 마음에서 풀링 외식물론 당 D로드 2 μg의 단백질은 평활근 α - 굴지 (ACTA2) 및 GAPDH (9)을 감지하기에 충분하다. 다른 표적 단백질의 검출이 최종 사용자에 의해 결정된 바와 같이 여러 시료 이식편 풀링 요구할 수있다.

심 외막의 outgrowths 5. 면역 세포 화학

  1. 이식편 문화에서 용지를 제거하고 DPBS로 두 번 씻는다.
  2. 부드럽게 각각 C o를 -20 실온에서 5 분 또는 10 분 동안 외식 편을 각 웰에 4 % (v / v)의 파라 포름 알데히드 또는 빙냉 메탄올 500 μL를 추가하고 수정. 제조업체에서 권장하는 항체 사양에 따라 수정합니다.
  3. 5 분 동안 세 번 정착액을 제거하고 DPBS 잘 각을 씻어.
  4. 5 분 동안 0.1 % DPBS 500 μL (v / v) 트리톤 X-100 세포를 Permeabilize 하시려면.
  5. 5 분 동안 세 번 permeabilization 솔루션을 제거하고 DPBS 씻어.
  6. temperatu 방에서 30 분 동안 DPBS 10 % 혈청으로 세포를 차단레.
  7. 제조업체의 권장 사항 및 최종 사용자에 의해 결정되는 최적의 조건에 따라 일차 항체 염색을 진행합니다.
  8. 5 분 동안 세 번 항체 용액을 제거하고 DPBS 씻어.
  9. 적절한 핵 염료 제조업체의 지침과 Counterstain과 당 차 항체를 적용합니다.
  10. 5 분 동안 세 번 항체 용액을 제거하고 DPBS 씻어.
  11. 제조업체의 지침에 따라 챔버 슬라이드 벽을 제거하고 세포에 직접 수성 장착 매체를 추가 할 수 있습니다. 세포를 통해 커버 슬립을 놓고 매니큐어로 밀봉. 반전 공 초점 주사 현미경을 사용하여 2D - 전형적인 결과를도 2b에 나타내었다.

6. 전의 VIVO 문화 분석 (그림 3A)

  1. 준비
    1. 준비 12 ml를 사용하여 A 배양액 생체 : 둘 베코 변형 이글 중간 (DMEM) (1 1) 혼합물 : M199 10 % 보충FBS와 1 % 펜 / 패 혈성.
    2. 37 ° C의 수조에서 미리 따뜻한 체외 배양 배지 100 ㎖의 HBSS.
    3. 나누어지는 1 ml를 24 웰 플레이트의 8-12 우물에 매체를 따뜻하게 사전.
    4. 전송은 각각 50 ㎖를 함유하는 두 개의 10cm 2 플레이트로 HBSS를 미리 예열.
  2. 12.5 DPC에서 임신 댐에서 (1.2에서 설명) HBSS에 마우스 배아의 마음을 분리합니다.
  3. 생체 외 배양 배지를 포함하는 24 웰 플레이트의 한 웰에 각각의 마음을 전송합니다. 37 ° C, 부드러운 수동 흔들 또는 부착을 방지하기 위해 락 플랫폼을 사용하여 5 %의 CO 2의 판을 품어. 즉시 7.1 단계로 진행합니다.

7. 전의 VIVO 문화의 심 외막 라벨링 및 EMT 유도

  1. 상기 외막 라벨 광고 / GFP 3.0 × 106 PFU / ㎖로 보충 된 37 ° C 생체 배지 12 mL로 제조한다. floxed 대립 유전자의 대상 절제, (A)의 전송 6 ml를 들어D / GFP는 새로운 15ml의 원뿔형 튜브에 배양액을 첨가. 광고 / Cre 호텔 추가 또는 1.5 × 106 PFU / ml의 최종 농도를 제어하는 아데노 바이러스.
    주 : 함수의 이득은 또한 적절한 아데노 바이러스 매개 된 유전자 전달과 함께 수행 될 수있다 분석한다.
  2. 조심스럽게 P1,000 피펫 팁을 사용하여 24 웰 플레이트의 각 웰에서 배지를 제거한다.
  3. 부드럽게 잘 각각 아데노 바이러스 (들)이 보충 된 배지를 추가합니다.
  4. 부드러운 락 24 시간 동안 37 ° C, 5 % CO 2의 판을 품어.
  5. EMT 유도를 들어, 37 ° C 생체 10 NG / ㎖ TGF-β1 20 NG / ㎖, 혈소판 유래 성장 인자 (PDGF) -BB 또는 비히클을 함유하는 배지 (4 mM의 HCl을 함유 한 ㎎ / ㎖ BSA 12 ml를 준비 ).
  6. 조심스럽게 P1,000 피펫 팁을 사용하여 24 웰 플레이트의 각 웰에서 배지를 제거합니다. 부드럽게 1 ML의 DPBS과 마음을 씻어.
  7. DPBS를 제거하고 체외 문화에 마음을 보충 날TGF-β1 및 PDGF-BB 또는 차량을 포함 dium.
  8. 부드러운 락 37 ° C에서 24 시간, 5 % CO 2 품어.

8. 냉동 보존 및 면역 전의 VIVO 문화의

  1. 냉동 보존을 위해 마음을 준비합니다.
    1. 배지를 제거하고 얼음처럼 차가운 DPBS로 두 번 마음을 씻는다.
    2. 각각의 심장에 4 % (v / v)의 파라 포름 알데히드의 1 ML을 추가하고 부드러운 락 4 ° C에서 2 시간 동안 고정한다.
    3. 정착액을 제거하고 DPBS로 두 번 마음을 씻는다. 1 ml의 10 % DPBS에서 제조 (w / v)의 크로스 신선한 우물에 마음을 전송합니다. 부드러운 락 4 ℃에서 하룻밤 접시를 품어.
    4. 조심스럽게 18 % DPBS에서 제조 (w / v)의 크로스 새로운 우물에 마음을 전송합니다. 부드러운 락 4 ℃에서 하룻밤 접시를 품어.
    5. 조직 동결 매체를 포함하는 cryomold 각 마​​음을 전송합니다. 즉시 -80 & #에서 액체 질소와 저장소를 사용하여 블록을 동결176; C.
  2. 양으로 대전 된 현미경 슬라이드에 그라 이오 스탯과 장소 조직 섹션을 사용하여 5 μm의에서 제 마음입니다. 스토어 염색 할 때까지 -80 ° C에서 슬라이드.
  3. 서브 심 외막 기저막의 검출 부분에 대한 면역 조직 화학 염색을 수행합니다.
    1. 실온에서 적어도 30 분 동안 해동 슬라이드.
    2. 부드러운 락 5 분 동안 DPBS에 두 번 세척하여 섹션을 재수.
    3. 실온에서 5 분 동안 PBS에서 0.1 % (v / v) 트리톤 X-100 Permeabilize 하시려면 부.
    4. 부드러운 락 5 분 동안 DPBS 두 번 슬라이드를 씻으십시오.
    5. 초과 DPBS을 가릴 및 소수성 라벨 펜으로 염색 영역을 정의합니다. 실온에서 30 분 동안 DPBS 10 % 혈청으로 차단 부.
    6. 블록에 희석 : 콜라겐 유형 IV 항체 (200 ColIV 1) 블록을 제거하고 적용 할 수 있습니다. 습도 조절 실에 4 ° C에서 밤새 품어.
    7. 대한 DPBS에 슬라이드를 세 번 씻으부드러운 락 5 분.
    8. DPBS과 슬라이드에 적용하고 DAPI (5,000 일) : 형광 접합 된 이차 항체 (500 일)을 희석. 실온에서 1 시간 동안 인큐베이션. GFP 구별 방출 및 여기 파장 적절한 이차 항체를 선택합니다.
    9. 부드러운 락 5 분 동안 PBS에서 슬라이드를 세 번 씻으십시오. 마운트 매체를 장착하여 슬라이드.

9. 이미징 및 정량화 전의 VIVO 문화의

  1. 맹검 사용자 이미지를 가지고 스테인드 섹션을 정량화. 심장 외막 (심장의 날) 40 배 배율에서 형광 또는 공 초점 현미경을 사용하여 함께 4-5 임의의 위치에서 주어진 마음에서 이미지는 적어도 5 비 연속적인 조직 섹션. 전형적인 결과가 반전 된 공 초점 주사 현미경을 사용하여도 3b에 도시된다.
  2. 수동 지정된 이미지 GFP 양성 세포의 총 수를 계산. GFP 포로 EPDC 마이그레이션 확인내 또는 ColIV subepicardial 기저막 이상있는 sitive 세포. GFP는 주어진 이미지에서 GFP 양성 세포의 총 수를 통해 GFP를 양성 세포 마이그레이션의 수가 셀 마이그레이션의 비율을 결정합니다. 전형적인 결과가 반전 공 초점 주사 현미경을 사용하여도 3C-D에 도시된다.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

심장 외막이 효율적으로 외부 위치를 활용하고 개발 소성 및 EPDC의 고유 철새 동작을 이용하여 부산물 문화 분석을 이용하여 분리 할 수​​ 있습니다. 쥐의 배아 마음 전에 아래 콜라겐 코팅 챔버 슬라이드에 심 외막 EMT 배양 등의 측에 E11.5에서 분리되어 26 (그림 1A, B). 외식 마음은 계약을 계속; 그러나, 심장 외막은 콜라겐 매트릭스 준수와 문화의 24 시간 (그림 1C)에서 심근으로부터 마이그레이션합니다. 심 외막 세포 중피 정체성 (도 1C-E)를 나타내는 조약돌 같은 형태로 떨어져 마음에서 나오는 관찰 할 수있다. 문화의 24 시간 후 심장 외막 고갈 마음은 유전자 또는 단백질 발현 분석을 위해 제거됩니다.

epitheli 관찰 이외에알의 형태는 심 외막 세포 배양의 순도는 더 심 외막 제한된 유전자와 단백질 마커의 발현에 의해 검증 될 수있다. 심 외막 세포 외식은 심 외막 및 중피 마커 (Aldh1a2, Tcf21 및 WT1)와 심장 외막 고갈 된 마음 (그림 2A)에 비해 심근 유전자 (Nkx2-5Myh7)의 낮은 표현의 강력한 표현을 표시합니다. 또한 신원을 확인하기 위해, 심 외막 세포 배양 후 48 시간에서 해결 된 마음 제거 각각 중피 세포와 세포 사이 꽉 접합, 37, 38 라벨을 Wilm의 종양 1 (WT1)와 조나 occludens 단백질 1 (ZO1)에 대한 항체 (와 공동 스테인드 그림 2B). 이 생장 배양 방법은 중피 세포의 비교적 높은 순도를 산출한다; 그러나, 사용자가 셀 오염의 작은 비율을 관찰 할 수있다. 섬유 아세포 및 평활근 세포의 현저한 nucle 부재와 함께 연장 중배엽 표현형을 나타낸다WT1 및 조직 꽉 접합 (그림 2C) 아칸소. 기술 해결은 비 외막 세포 오염의 양이 논의에서 전개되고 제한한다.

이식편 파생물 분석은 시험 관내에서 외막 생물학 질의 유용한 배양 시스템이다. 심 외막 세포의 가소성을 설명하기 위해, 외식은 중간 엽 세포 (26, 28)로 분화를 유도하기 위해 [10 NG / ㎖] TGF-β1 자극했다. 자극의 24 시간 후, EPDC 특히 문화 39 (빨간색 그림 2D)의 주변에, 감소 ZO1 염색 및 평활근 α - 굴지 긍정적 인 스트레스 섬유 (ACTA2 또는 SMA)의 강력한 드 노보 형성에 중간 엽 표현형을 채택한다. 반대로, 이식편의 주위에 monolaye의 중심에 더 정의 세포 간 접촉 (ZO1 녹색)와 합류 외막 세포를 섬유 집합체 스트레스대뇌 피질 굴지의 R 표시 ACTA2 단백질 발현.

EMT를 겪고 외에도 EPDC 비 심근 인구의 상당 부분을 구성하는, 심근 침입과 구별된다. EPDC의 운동성은 E12.5 마음의 외부는 GFP 9,18 (그림 3A)를 발현하는 아데노 바이러스로 표시되어있다 이전에 설립 된 생체 기관 배양 시스템을 사용하여 평가 될 수있다. 레이블이 마음 EPDC 이동을 촉진하는 TGF-β1 [10 NG / ㎖] 및 PDGF-BB [20 NG / ㎖]의 존재에 3 일 동안 배양한다. 기관 배양 물을 주기적으로 배양 플레이트의 표면에 생체 하트 부착을 방지하는 회전한다. 스크래치 시험 관내 분석법으로 이동 방향과 반대로 이러한 시스템은 입체 모델의 전체 심장 외막과 EPDC 운동성 평가를 효율적으로 표시 가능하다. EPDC의 마이그레이션은 obser입니다VED 긍정적 인 심 외막 세포로 또는 ColIV (빨간색) subepicardial 기저막 (16) (도 3B, C)를 넘어 GFP의 침공으로. 이 시스템의 유틸리티를 설명하기 위해, 우리는 최근에 EPDC 9의 운동성에 영향을 미칠 수있는 MRTF / SRF 신호 축의 조작을 보여 주었다. floxed 대립 유전자의 Cre 호텔 - 중재 절단 (MRTFdKO)에 의해 MrtfaMrtfb의 삭제는 subepicardial 공간으로 EPDC의 이동을 감쇠. 반대로 증가 EPDC 마이그레이션 및 ColIV 기저막 (도 3C, D)의 중단에 C57BL / 6 마음 결과에 MRTF-A (광고 / MRTF-A)의 발현을 강요했다.

유전자 앞으로 NCBI의 기탁
Aldh1a2 GGCACTGTGTGGATCAACTG TCACTTCTGTGTACGCCTGC NM_009656
GAPDH CGTGCCGCCTGGAGAAAC TGGGAGTTGCTGTTGAAGTCG NM_001289726
Myh7 GTGGCTCCGAGAAAGGAAG GAGCCTTGGATTCTCAAACG NM_080728
Nkx2-5 GACGTAGCCTGGTGTCTCG GTGTGGAATCCGTCGAAAGT NM_008700
Tcf21 CATTCACCCAGTCAACCTGA CCACTTCCTTCAGGTCATTCTC NM_011545
WT1 ATCCGCAACCAAGGATACAG GGTCCTCGTGTTTGAAGGAA NM_144783

. 표 1 : 심장 외막의 분석 및 심근 제한된 유전자 발현 유전자 발현이 QRT-PCR 위스콘신에 의해 결정됩니다에 의해 심 외막 파생물 문화 순도의 검증에 사용 앞으로의 시퀀스 및 역방향 프라이머다음 매개 변수 번째 10 초 동안 95 ° C에서 변성; 30 초 동안 60 ° C에서 어닐링; 50 배 사이클을 반복합니다.

그림 1
그림 1. 파생물 배양 분석 (A) 외막 변조 및 분석을 위해 권장 막대와 심 외막 가지 이식편 분석의 개략도를 사용하여 주 외막 세포의 분리. (B - E) 이식편 분석하는 동안 다양한 시점의 대표 시야 이미지. (B) 배아 일 E11.5의 쥐 마음은 콜라겐 기판 아래로 몸 윗면을 배치됩니다. (C) 심 외막 세포 (흰색 화살촉) 문화의 3 ~ 4 시간 내 마음을 마이그레이션하기 시작합니다. 혈액 세포 (검은 색 화살표) 근처의 축적 또는 심 외막 가지 중 외식을 커버 할 수있다. (D, E) 후문화의 약 24 시간이, 마음이 제거되고 심 외막 단일 층 챔버 슬라이드에 부착 된 상태로 유지됩니다. 세포의 outgrowths는 세포의 조약돌 같은 배열과 상피 형태를 표시합니다. 스케일 바 = 250 μm의 (BD) 또는 50 μm의 (C, E). H = 마음, LA = 좌심방, LV는 = 좌심실, OFT = 유출 관, RA = 우심방, RV = 우심실. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 2
그림 2 : 심 외막 세포 생장 순도의 평가 (A) 심장 외막 고갈 E11에서 심근 유전자 발현 (Nkx2-5Myh7)에 비해 가지 문화 심 외막 제한 마커 (Tcf21, Aldh1a2 및 WT1)의 QRT-PCR 검증.. 5 마음입니다. 데이터 represenSEM ± (N = 8 그룹 당) 평균에서 t. 별표 **** P <0.0001와 학생 T-test를 이용하여 통계적 유의성을 나타낸다. (B) 비자극의 outgrowths 심 외막 표현 (빨간색 WT1), 간 긴밀한 접합 (ZO1, 녹색)과 핵의 대표 공동 면역 염색 (DAPI, 청색). (C)을 가지 배양 세포 오염의 예. 심 외막 세포 (별표) 특성 중피 정체성 (핵 WT1, 빨간색) 및 조직 상피 꽉 접합 (ZO1, 녹색)와 패널의 오른쪽에 관찰된다. 중앙 (흰색 화살촉)에 인접한 세포는 최소한의 핵 WT1 단백질과 조직적 ZO1 염색과 미분 간섭 대비 (DIC) 이미지로 나타낸 신장 중간 엽 형태를, 나타낸다. (D) 외막 세포 배양 (1 ㎎ / ㎖ BSA 4 mM의 염산)으로 자극 하였다 차량 또는 TGF-β1 [10 NG / ㎖] 외막을 유도EMT. TGF-β1의 자극 이식편 또는 단일 층의 에지 또는 주변부 마이그레이션 세포 스트레스 섬유의 중심에 융합 세포의 피질 영역에 ACTA2 (적색)의 강력한 발현을 촉진한다. 세포 유착은 ZO1 (녹색)으로 표시되어 있습니다. 스케일 바 = 25 μm의 (BD). 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

그림 3
도 3 : EPDC 운동성 생체 외 평가 (A)가 생체의 심장 배양 검정의 개략 타임 라인.. (B) 24 시간 동안 광고 / GFP (녹색)으로 형질 도입 C57BL / 6 E12.5 마음의 대표적인 5 μm의 섹션은 심장의 외부에 레이블을합니다. 예 생체 내 마음이 TGF-에 추가로 48 시간 동안 연속적으로 배양 β1 [10 NG / ㎖]및 PDGF-BB는 [20 NG / ㎖]는 EPDC 마이그레이션을 자극한다. 섹션은 subepicardial 기저막과 핵 (파란색 DAPI). 예 생체 내 마음의 문화 형태가 DIC에 의해 표시되는 레이블을 ColIV (빨간색)에 대한 공동 염색 하였다. LV = 좌심실, RV = 우심실, RA = 우심방. (C, D)를 MRTF / SRF 규제 축 변조하여 생체 마이그레이션 분석의 예시적인 애플리케이션. 이 수치는에서 [9] 수정되었습니다. - / - E12.5 마음이 Mrtfa에서 분리 하였다. Mrtfb FL / FL 배아 및 광고 / GFP 및 제어 바이러스 또는 24 시간 동안 Cre 호텔의 재조합 효소를 발현하는 아데노 바이러스로 형질 전 생체 내 문화 후 TGF-β1 자극했다 [10 NG / ㎖] 및 PDGF-BB 추가로 48 시간 동안 [20 NG / ㎖]. EPDC 운동성 (흰색 화살표)로 또는 ColIV (빨간색)을 넘어 GFP 양성 세포 (녹색)의 이동로 관찰된다. 에 Mrtfb의 삭제를 CRE 매개 <EM> Mrtfa - / - 마음을 제어하는 데 비해 EPDC 마이그레이션의 감쇠의 배경 (MRTFdKO) 결과. 반대로, E12.5 C57BL / 6 마​​음에 MRTF-A (광고 / MRTF-A)의 발현을 강제 EPDC 마이그레이션을 향상시킵니다. (D) % GFP 양성 세포 이동의 정량화. 데이터는 SEM (각 조건에 대한 N = 4 하트) ± 평균으로 표시하고 있습니다. 데이터가 별표 **** P <0.0001와 Tukey에 사후 검사로 유의성을 나타내는 함께 일방향 ANOVA를 이용하여 분석 하였다. 스케일 바 = 200 μm의 (B) 또는 25 μm의 (C). 모든 이미지는 반전 된 공 초점 레이저 주사 현미경을 사용하여 획득 하였다. 이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

여기에서 우리는 가지가 기본 심 외막 세포를 분리하고 생체 심장 문화 EPDC 이동을 추적하는 자세한 방법을 설명합니다. 가지 문화를 들면, 심장 외막 고갈 마음을 제거 할 수있는 적절한 시간 실험 사이에 약간 다릅니다. 하룻밤 배양 후 외식의주기적인 모니터링이 심 외막 가지의 정도를 측정하고 섬유 아세포를 표시하기 전에 마음을 추출하는 것이 좋습니다. 순도를 보장하기 위해, 마음이 아닌 심 외막 계통의 축적을 방지하기 위해 explanting의 24 시간 내에 제거해야합니다. 유출 기관도 오염 세포 유형 27,40을 줄일 수있는 챔버 슬라이드에 마음을 전송하기 전에 두 심방을 멀리 트리밍. 태아 하트는 시간의 좁은 기간 동안 마우스 쓰레기 분리와 같은 조건에서 배양되므로 표시하기위한 시간의 outgrowths 한 심장에서 실험 내에서 서로 상대적으로 유사하다. 따라서 모든 마음 ㄴ한다이식편의 대부분은 심 외막의 outgrowths을 나타낼 때, 예를 제거. 어떤 경우에는, 세포 외막이 이식편은 실험에서 제외되어야하는 경우에 다른 사람들보다 더 강하게 수축 된 심장으로부터 효율적으로 이동하지 않는다.

혈액 세포의 축적은 종종 ​​따라서 어려운의 outgrowths 시각화하게 외막 세포 (화살표,도 1C)의 평면 단층을 은폐 할 수있다. 과도한 혈액 세포 기여를 방지하기 위해, 마음 배아에서 해부시 몇 분 동안 HBSS에 남아있을 수 있습니다. 이는 태아의 심장 챔버 슬라이드로 전송되기 전에 심장 챔버에 잔류 혈액을 펌프 할 충분한 시간을 허용한다. 또한, 첫 번째 하룻밤 배양 한 후 이식편 매체 A와 문화를 보충하는 것은 약간의 여분의 혈액을 멀리 세척과의 outgrowths를 공개하는 데 도움이 될 것입니다; 표면 장력이 중심을 일으킬 수 있지만, 매체의 수준은 심장 이상으로 상승하지 않아야기판으로부터 멀리 당겨. 강력한 외막의 outgrowths 배양 기판으로서 콜라겐 타입 I을 사용하여 관찰된다; 그러나, 다른 기판은 유기체 및 / 또는 애플리케이션에 따라 27,40-42보고되었다. 이 프로토콜을 이용하여, 일차 태아 심장 외막 세포 및 제거 매일 배지 보충 다음 4 일 동안 성공할 수있다; 그러나, 장기간 배양이 필요한 실험 디자인은 최종 사용자에 의해 결정되어야한다. 심 외막 EMT 강하게 배아 발달 동안 활성화되기 때문에, 이러한 부산물 배양 기술은 태아 세포 외막의 농축에 한정된다. 다른 그룹은 성인 심 외막 세포 43, 44를 분리하는 방법을 설명했다.

생체 마이그레이션 분석, 심장 추출 및 심 외막 세포 표지에 대한 두 가지 이유 E12.5에 권장됩니다. 첫째, E12.5 후 격리하는 마음이 큰 따라서 생존을 지원하기 위해 더 많은 혈류를 필요로한다. 영양의 단순 확산S는 큰 마음에서 기관 배양 물을 유지하기에는 충분하지 않다. 둘째, 심 외막 EMT 및 EPDC 마이그레이션 E12.5 주위에 발생합니다. 따라서, 심장 외막은 EPDC의 검출을 최대화하는 중심 추출 직후 형광 단백질을 발현하는 아데노 바이러스로 표지한다. 또한, 카르복시 디 아세테이트의 숙신 이미 딜 에스테르 (CFSE)는 이전에 심장의 외부 레이블과 EPDC 마이그레이션 10,45을 추적하는 것으로보고되었습니다.

가지 분석법 달리, 생체 외 배양 심장 외막 세포 부착 및 생장을 방지하기 위해 주기적으로 요동한다. 배양은 연속적으로 낮은 속도 설정에 로커 구비 한 배양기에서 교반 될 수있다. 사용자 장기 문화의 몇 일 이내에 심장 형태의 변화를 알 수 및 심장 격리의 72 시간 이상 분석을 피해야한다. 이 분석을 사용하여, EPDC 침공은 문화의 48 ~ 72 시간 내에 관찰된다. Cre 호텔-에 loxP 시스템 동안관상 혈관, 심근의 간질 및 심실 중격 7,22이 생체 외 기술은 서브 외막 공간의 일부 세포층에서 EPDC 이전에 한정되는 EPDC의 현지화를 매핑 생체 내에서 사용되어왔다. 따라서,이 방법은 EPDC 운동성 및 침략의 규제를 결정하는 것이 아니라 EPDC 마이그레이션의 최종 목적지를 정의하기위한 더 적합하다.

심 외막 세포 절연 부 및 생체 마이그레이션 분석은, 이득 또는 함수 접근법의 손실과 함께, 이미 EPDC 생물학 9,18,46에 영향을 줄 수있는 후보 유전자를 평가하는 데 유용 입증했다. 이 방법은 EPDC 마이그레이션의 새로운 규제를 식별하는 이득의 기능 또는 손실의 기능 화면을위한 플랫폼을 제공합니다. 이 전략은 형광 활성화 세포 분류 또는 단일 세포 RN​​A 시퀀싱과 함께, 또한 심 외막 얼룩이 조사 할 기회를 제공 할 수있다더 자세히과 EPDC 차별화. 마지막으로,이 절차의 변형이 심장 재생 의학의 목적을 위해 심 외막 세포 및 EPDC 생물 영향 소분자에 대한 화면을 개발하는데 사용될 수있다.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

저자는 공개 아무것도 없어.

Acknowledgements

EMS는 건강 (NIH)의 국립 연구소에서 보조금에 의해 지원되었다 [부여 번호 R01HL120919] 미국 심장 협회 [허가 번호 10SDG4350046] 국립 보건원 [허가 번호 UL1 TR000042]에서 로체스터 CTSA 수상의 대학; 그리고 AAB CVRI에서 시작 기금. MAT는 하워드 휴즈 의학 연구소 메드 - 속 - 대학원 이니셔티브에서 의학 및 치과 로체스터 대학의 대학에 교부금에 의해 부분적으로 지원되었다; 그리고 NIH [허가 번호 GM068411]에서 기관 루스 L. Kirschstein 국가 연구 서비스 상.

Materials

Name Company Catalog Number Comments
Dulbecco's Modified Eagle Medium Hyclone  SH3002201 DMEM
Hanks' Balanced Salt Solution Hyclone SH3003102 HBSS
Medium 199 Hyclone SH3025301 M199
Dulbecco’s Phosphate-Buffered Saline  Hyclone SH3002802 DPBS
Fetal Bovine Serum  Gemini  100-106 FBS
Penicillin/Streptomycin Solution Hyclone SV30010
Corning Biocoat Collagen I, 4-Well Culture Slides Corning 354557
Multiwell 24-well plates Falcon 08-772-1
Dissecting microscope Leica M50 Equipped with Leica KL300 LED might source
Confocal miscroscope Olympus 1X81 Equipped with muli-argon laser 405/488/515, FV10-MCPSU laser 405/440/635, 559 laser, and mercury lamp
Bioruptor Diagenode  UCD-200
Transforming growth factor beta 1 R&D Systems 100-B-001 TGF-β1
Platelet-derived growth factor BB R&D Systems 220-BB-010 PDGF-BB
Trizol Reagent Applied Biosystems 15596-026 Caution, hazardous material
TURBO DNA-free Kit Life Technologies AM1907 DNaseI
iScript cDNA Synthesis Kit BioRad 1708891
UltraPure Glycogen Life Technologies 10814-010
SYBR Green BioRad 170-8880
Protease inhibtor cocktail tablets Roche 11836170001
Alexa Goat-anti-rabbit 488 Life Technologies A11008 Secondary antibody
Alexa Goat anti-rabbit 594 Life Technologies A-11012 Secondary antibody
Alexa Goat anti-mouse 594 Life Technologies A-11005 Secondary antibody
Mouse anti-smooth muscle alpha actin, Cy3-conjugated  Sigma-Aldrich C6198 monoclonal antibody, clone 1A4
Mouse anti-Wilms tumor 1 (WT1) Life Technologies MA1-46028 monoclonal antibody, clone 6F-H2
Rabbit anti-ZO1 Life Technologies 40-2200 polyclonal antibody
Rabbit anti-Collagen Type 4 Millipore AB756P polyclonal antibody
4',6-Diamidino-2-Phenylindole, Dihydrochloride  Life Technologies D1306 DAPI
Fluorescent mounting medium  DAKO S3023
16% Paraformaldehyde solution Electron Microscopy Sciences 15710 PFA diluted to 4% in DPBS. Caution, hazardous material
Sucrose Sigma-Aldrich S0389
Tissue Freezing Medium Triangle Biomedical Sciences TFM-B
Pap pen DAKO S2002
Disposable mictrotome blades  Sakura Finetek 4689
Microscope slides Globe Scientific 1358W positively charged, 25 mm x 75 mm x 1 mm
Cryostat  Leica CM1950
Forceps Fine Science Tools 11295-00
Surgical Scissors Fine Science Tools 91460-11
Disposable base molds Fisher Scientific 22-363-553
Ketamine Hospira NDC 0409-2051-05
Xylazine Akorn NADA 139-236

DOWNLOAD MATERIALS LIST

References

  1. von Gise, A., Pu, W. T. Endocardial and epicardial epithelial to mesenchymal transitions in heart development and disease. Circ Res. 110, 1628-1645 (2012).
  2. Martinez-Estrada, O. M., et al. Wt1 is required for cardiovascular progenitor cell formation through transcriptional control of Snail and E-cadherin. Nat Genet. 42, 89-93 (2010).
  3. Gittenberger-de Groot, A. C., Vrancken Peeters, M. P., Mentink, M. M., Gourdie, R. G., Poelmann, R. E. Epicardium-derived cells contribute a novel population to the myocardial wall and the atrioventricular cushions. Circ Res. 82, 1043-1052 (1998).
  4. Katz, T. C., et al. Distinct compartments of the proepicardial organ give rise to coronary vascular endothelial cells. Dev Cell. 22, 639-650 (2012).
  5. Mikawa, T., Gourdie, R. G. Pericardial mesoderm generates a population of coronary smooth muscle cells migrating into the heart along with ingrowth of the epicardial organ. Dev Biol. 174, 221-232 (1996).
  6. Wilm, B., Ipenberg, A., Hastie, N. D., Burch, J. B., Bader, D. M. The serosal mesothelium is a major source of smooth muscle cells of the gut vasculature. Development. 132, 5317-5328 (2005).
  7. Zhou, B., et al. Epicardial progenitors contribute to the cardiomyocyte lineage in the developing heart. Nature. 454, 109-113 (2008).
  8. Dettman, R. W., Denetclaw, W., Ordahl, C. P., Bristow, J. Common epicardial origin of coronary vascular smooth muscle, perivascular fibroblasts, and intermyocardial fibroblasts in the avian heart. Dev Biol. 193, 169-181 (1998).
  9. Trembley, M. A., Velasquez, L. S., de Mesy Bentley, K. L., Small, E. M. Myocardin-related transcription factors control the motility of epicardium-derived cells and the maturation of coronary vessels. Development. 142, 21-30 (2015).
  10. Mellgren, A. M., et al. Platelet-derived growth factor receptor beta signaling is required for efficient epicardial cell migration and development of two distinct coronary vascular smooth muscle cell populations. Circ Res. 103, 1393-1401 (2008).
  11. von Gise, A., et al. WT1 regulates epicardial epithelial to mesenchymal transition through beta-catenin and retinoic acid signaling pathways. Dev Biol. 356, 421-431 (2011).
  12. Lavine, K. J., et al. Endocardial and Epicardial Derived FGF Signals Regulate Myocardial Proliferation and Differentiation In Vivo. Dev Cell. 8, 85-95 (2005).
  13. Sanchez, N. S., Barnett, J. V. TGFbeta and BMP-2 regulate epicardial cell invasion via TGFbetaR3 activation of the Par6/Smurf1/RhoA pathway. Cell Signal. 24, 539-548 (2012).
  14. Dettman, R. W., Pae, S. H., Morabito, C., Bristow, J. Inhibition of 4-integrin stimulates epicardial-mesenchymal transformation and alters migration and cell fate of epicardially derived mesenchyme. Dev Biol. 257, 315-328 (2003).
  15. Rhee, D. Y., et al. Connexin 43 regulates epicardial cell polarity and migration in coronary vascular development. Development. 136, 3185-3193 (2009).
  16. Wu, M., et al. Epicardial spindle orientation controls cell entry into the myocardium. Dev Cell. 19, 114-125 (2010).
  17. Hirose, T., et al. PAR3 is essential for cyst-mediated epicardial development by establishing apical cortical domains. Development. 133, 1389-1398 (2006).
  18. Baek, S. T., Tallquist, M. D. Nf1 limits epicardial derivative expansion by regulating epithelial to mesenchymal transition and proliferation. Development. 139, 2040-2049 (2012).
  19. Lu, J., et al. Coronary smooth muscle differentiation from proepicardial cells requires rhoA-mediated actin reorganization and p160 rho-kinase activity. Dev Biol. 240, 404-418 (2001).
  20. Combs, M. D., Braitsch, C. M., Lange, A. W., James, J. F., Yutzey, K. E. NFATC1 promotes epicardium-derived cell invasion into myocardium. Development. 138, 1747-1757 (2011).
  21. Acharya, A., et al. The bHLH transcription factor Tcf21 is required for lineage-specific EMT of cardiac fibroblast progenitors. Development. 139, 2139-2149 (2012).
  22. Zhou, B., von Gise, A., Ma, Q., Hu, Y. W., Pu, W. T. Genetic fate mapping demonstrates contribution of epicardium-derived cells to the annulus fibrosis of the mammalian heart. Dev Biol. 338, 251-261 (2010).
  23. Zhou, B., et al. Adult mouse epicardium modulates myocardial injury by secreting paracrine factors. J Clin Invest. 121, 1894-1904 (2011).
  24. Singh, M., Epstein, J. Epicardial Lineages and Cardiac Repair. Journal of Developmental Biology. 1, 141-158 (2013).
  25. Braitsch, C. M., Combs, M. D., Quaggin, S. E., Yutzey, K. E. Pod1/Tcf21 is regulated by retinoic acid signaling and inhibits differentiation of epicardium-derived cells into smooth muscle in the developing heart. Dev Biol. 368, 345-357 (2012).
  26. Austin, A. F., Compton, L. A., Love, J. D., Brown, C. B., Barnett, J. V. Primary and immortalized mouse epicardial cells undergo differentiation in response to TGFbeta. Developmental dynamics : an official publication of the American Association of Anatomists. 237, 366-376 (2008).
  27. Kim, J., Rubin, N., Huang, Y., Tuan, T. L., Lien, C. L. In vitro culture of epicardial cells from adult zebrafish heart on a fibrin matrix. Nat Protoc. 7, 247-255 (2012).
  28. Compton, L. A., Potash, D. A., Mundell, N. A., Barnett, J. V. Transforming growth factor-beta induces loss of epithelial character and smooth muscle cell differentiation in epicardial cells. Developmental dynamics : an official publication of the American Association of Anatomists. 235, 82-93 (2006).
  29. Smith, C. L., Baek, S. T., Sung, C. Y., Tallquist, M. D. Epicardial-derived cell epithelial-to-mesenchymal transition and fate specification require PDGF receptor signaling. Circ Res. 108, 15-26 (2011).
  30. Shea, K., Geijsen, N. Dissection of 6.5 dpc Mouse Embryos. JOVE. 2, (2007).
  31. Witty, A. D., et al. Generation of the epicardial lineage from human pluripotent stem cells. Nature biotechnology. 32, 1026-1035 (2014).
  32. Iyer, D., et al. Robust derivation of epicardium and its differentiated smooth muscle cell progeny from human pluripotent stem cells. Development. 142, 1528-1541 (2015).
  33. Takeichi, M., Nimura, K., Mori, M., Nakagami, H., Kaneda, Y. The transcription factors Tbx18 and Wt1 control the epicardial epithelial-mesenchymal transition through bi-directional regulation of Slug in murine primary epicardial cells. PloS one. 8, e57829 (2013).
  34. Wong, M. L., Medrano, J. F. Real-time PCR for mRNA quantitation. BioTechniques. 39, 75-85 (2005).
  35. Schmittgen, T. D., Livak, K. J. Analyzing real-time PCR data by the comparative CT method. Nature Protocols. 3, 1101-1108 (2008).
  36. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical biochemistry. 72, 248-254 (1976).
  37. Moore, A. W., McInnes, L., Kreidberg, J., Hastie, N. D., Schedl, A. YAC complementation shows a requirement for Wt1 in the development of epicardium, adrenal gland and throughout nephrogenesis. Development. 126, 1845-1857 (1999).
  38. Kim, J., et al. PDGF signaling is required for epicardial function and blood vessel formation in regenerating zebrafish hearts. Proc Natl Acad Sci U S A. 107, 17206-17210 (2010).
  39. Kalluri, R., Weinberg, R. A. The basics of epithelial-mesenchymal transition. J Clin Invest. 119, 1420-1428 (2009).
  40. Dong, X. R., Maguire, C. T., Wu, S. P., Majesky, M. W. Chapter 9 Development of Coronary Vessels. Methods in Enzymology. 445, 209-228 (2008).
  41. Ruiz-Villalba, A., Ziogas, A., Ehrbar, M., Perez-Pomares, J. M. Characterization of epicardial-derived cardiac interstitial cells: differentiation and mobilization of heart fibroblast progenitors. PLoS One. 8, e53694 (2013).
  42. Garriock, R. J., Mikawa, T., Yamaguchi, T. P. Isolation and culture of mouse proepicardium using serum-free conditions. Methods. 66, 365-369 (2014).
  43. Smart, N., Riley, P. Derivation of epicardium-derived progenitor cells (EPDCs) from adult epicardium. Curr Protoc Stem Cell Biol. (2009).
  44. Zhou, B., Pu, W. T. Isolation and characterization of embryonic and adult epicardium and epicardium-derived cells. Methods Mol Biol. 843, 155-168 (2012).
  45. Morabito, C. J., Dettman, R. W., Kattan, J., Collier, J. M., Bristow, J. Positive and negative regulation of epicardial-mesenchymal transformation during avian heart development. Dev Biol. 234, 204-215 (2001).
  46. Grieskamp, T., Rudat, C., Ludtke, T. H., Norden, J., Kispert, A. Notch signaling regulates smooth muscle differentiation of epicardium-derived cells. Circ Res. 108, 813-823 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics