Epicardico escrescenza Cultura Assay e

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Trembley, M. A., Velasquez, L. S., Small, E. M. Epicardial Outgrowth Culture Assay and Ex Vivo Assessment of Epicardial-derived Cell Migration. J. Vis. Exp. (109), e53750, doi:10.3791/53750 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Un singolo strato di linee cellulari epicardiche cuore, fornendo fattori paracrini che stimolano la proliferazione dei cardiomiociti e contribuendo direttamente progenitori cardiovascolari durante lo sviluppo e la malattia. Mentre un certo numero di fattori sono stati implicati nella cella (EPDC) mobilitazione epicardium-derivati, i meccanismi che regolano la loro successiva migrazione e differenziamento sono poco conosciute. Qui, vi presentiamo in vitro ed ex vivo strategie per studiare EPDC la motilità e la differenziazione. In primo luogo, si descrive un metodo per ottenere cellule epicardici primarie dalla cultura escrescenza dal cuore embrionale del mouse. Presentiamo anche un protocollo dettagliato per valutare la migrazione tridimensionale marcato EPDC in un sistema di coltura di organi. Forniamo la prova utilizzando queste tecniche che delezione genetica di fattori di trascrizione myocardin legati nel epicardio attenua la migrazione EPDC. Questo approccio funge da piattaforma per valutare modificatori candidati di EPDCbiologia e potrebbe essere usato per sviluppare schermi genetici o chimici per identificare nuovi regolatori di EPDC mobilitazione che potrebbero essere utili per la riparazione cardiaca.

Introduction

L'epicardio è un singolo strato di cellule mesoteliali che riveste il cuore e impatti cardiaca sviluppo, maturazione e riparazione. Attraverso uno scambio altamente coordinato di segnali paracrini, il dialogo intimo tra il miocardio ed epicardio è indispensabile per la crescita cardiaca e la formazione di non-miociti cardiaci linee 1. Cellule epicardial-derivato (EPDC) emergono da un sottogruppo di cellule epicardici attraverso una epiteliali-to-mesenchymal transizione (EMT) 2, invadere lo spazio subepicardico e del miocardio sottostante, e differenziare ampiamente in cellule parietali vascolari coronariche e fibroblasti cardiaci, e ad un in misura minore, le cellule endoteliali e cardiomiociti 3-9.

I meccanismi che regolano EMT epicardico e EPDC invasione sono stati attribuiti all'azione coordinata di varie molecole, tra cui ligandi secrete 10-13, recettori di superficie delle cellule e molecole di adesione, 14,15 regolatori di apicale-basale polarità 16,17, piccole GTPasi 18,19, e fattori di trascrizione 2,20,21. Mentre molti degli effettori molecolari della migrazione EPDC sono stati definiti, una migliore comprensione dei segnali fisiologici che stimolano EPDC mobilizzazione nell'embrione può accelerare lo sviluppo di strategie per manipolare questo processo nell'adulto per migliorare riparazione cardiaca.

Studi volti ad identificare nuovi regolatori di EPDC mobilitazione si basano su di purificazione di questa popolazione di cellule o di tracciare la migrazione di singole cellule epicardici. Uno o una combinazione di geni marcatori, tra WT1, Tcf21, Tbx18, e / o Aldh1a2, è comunemente usato per identificare il epicardio del feto 1. Tuttavia, l'uso di questi marcatori per tracciare migrando EPDC non è ottimale come espressione di marcatori epicardici diminuisce nel corso dello sviluppo del cuore e spesso si perde quando le cellule subiscono epicardial transdifdifferenzia- in cellule mesenchimali.

L'applicazione del sistema Cre / loxP, in collaborazione con i giornalisti lineage tracing, è stato utile per etichettare in modo permanente la dell'epicardio e dei suoi discendenti durante lo sviluppo del cuore e dopo danno ischemico nell'adulto 7,22,23. Diversi epicardici-restricted linee Cre sono stati generati e sono ampiamente utilizzate per etichettare EPDC e per il gene condizionale cancellazione strategie 1. Questi studi hanno portato alla caratterizzazione dei vari lignaggi epicardici, e l'identificazione di mediatori critici di EPDC motilità e differenziazione. Tuttavia, l'evidenza suggerisce anche accumulando dell'epicardio è una popolazione eterogenea di cellule progenitrici 4,24,25. Così, solo un sottoinsieme di cellule epicardici sarà mirata utilizzando un dato conducente Cre.

Per etichettare l'intera epicardio indipendentemente Cre specificità, una serie di laboratori hanno utilizzato cul escrescenzasistemi ture o ex vivo metodi di coltura di organi per isolare fedelmente o l'etichetta cellule epicardici senza dipendere l'espressione di un lignaggio genetico marcatori 26-28. Per ex vivo studi sulla migrazione, cuori embrionali sono isolate prima di EMT epicardico e coltivate in media integrato con una proteina fluorescente verde (GFP) esprimente adenovirus (Ad / GFP) 9,18. Questo approccio consente etichettatura efficiente dell'intera epicardio piuttosto che un sottogruppo di cellule mediante ricombinazione Cre-mediata. Culture cuore vengono successivamente esposte a induttori noti di EMT per stimolare la mobilitazione di EPDC 28,29. Ex vivo e in vivo analisi sono integrate da colture in vitro espianto epicardici, che sono un approccio particolarmente utile per esplorare i meccanismi dettagliati di guida migrazione EPDC.

Qui, descriviamo i metodi per isolare le cellule epicardial primarie per gli studi in vitro di epicardial EMT, nonché un sistema di coltura organo per ex vivo analisi di EPDC motilità. Abbiamo recentemente dimostrato l'utilità e la robustezza di questo metodo modulando geneticamente il fattore myocardin legati trascrizione (MRTF) / fattore di risposta del siero (SRF) di segnalazione asse di manipolare la migrazione actina-based di EPDC 9. Mentre i nostri risultati evidenziano una via di segnalazione necessaria per regolare la migrazione EPDC, questi metodi sono adatti per svelare i meccanismi che orchestrano la migrazione collettivamente EPDC e la differenziazione. Inoltre, l'ex vivo sistemi di espianto e potrebbero essere implementate in schermi funzionali per identificare nuovi regolatori di EPDC mobilitazione per le applicazioni terapeutiche nella rigenerazione cardiaca.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

NOTA: Tutte sperimentazione con i topi sono stati approvati dal Comitato Università per le risorse animali presso l'Università di Rochester.

1. epicardico escrescenza Cultura Assay (Figura 1A)

  1. preparativi
    1. Preparare 5 ml di mezzo A per l'isolamento delle cellule epicardico primaria, completandolo Medium 199 (M199) con siero 5% fetale bovino (FBS) e 1% penicillina / streptomicina (Pen / Strep).
    2. Pre-calda media A e 100 ml Hanks 'Balanced Salt Solution (HBSS) a bagnomaria C 37 °.
    3. Lasciare le diapositive da camera di collagene rivestite per riscaldare a temperatura ambiente per 30 min.
    4. Aggiungere 100 microlitri medio A ciascun pozzetto del vetrino camera e ruotare delicatamente per rivestire la superficie uniformemente collagene. Ripetere per 8-12 pozzi. Rimuovere media dopo le camere di verniciatura.
    5. Aliquota pre-riscaldato HBSS in due 10 centimetri 2 piastre contenenti 50 ml di HBSS.
  2. Isolare embrionali Cuori da incinta Dam a 11,5 giorni post coitum (DPC).30
    1. Anestetizzare mouse con 0,5 ml di 13 mg / ml di ketamina / 0,88 mg / ml di cocktail xilazina a 1x Dulbecco Phosphate-Buffered Saline (DPBS) tramite iniezione intraperitoneale. Verificare il corretto anestesia utilizzando un test punta pizzico. Un pizzico delicato è sufficiente per determinare se il mouse è reattivo. Ogni movimento o zampa di ritirare indica l'animale non è sufficientemente anestetizzato per fare un intervento chirurgico. Eutanasia da dislocazione cervicale.
    2. Posare il mouse di fronte alla parte ventrale e spruzzare l'addome con il 70% di etanolo per ridurre la contaminazione da capelli.
    3. Pizzicare la pelle con una pinza e tagliare una incisione laterale in addome con le forbici chirurgiche. Tenere la pelle con fermezza e poi tirare a parte in direzioni opposte verso la testa e la coda.
    4. Pizzica il peritoneo con una pinza e tagliare con le forbici per esporre la cavità addominale.
    5. Rimuovere con attenzione il decidua tagliando lungo la mesometrio. Trasferire il decidua sezionato di pre-riscaldato HBSS nel primo10 cm 2 piastre.
    6. Separare la decidua tagliando tra embrioni.
    7. Trasferire un embrione alla seconda piastra 10 cm 2 con pre-riscaldato HBSS sotto un microscopio da dissezione. Rimuovere con attenzione il tessuto e sacco vitellino extraembryonic, quindi decapitare l'embrione.
    8. Pizzicare la parete toracica con una pinza e strappare il tessuto a parte sulla linea mediana, esponendo la cavità toracica.
    9. Posizionare la pinza dietro il cuore. Afferrare il tratto di efflusso e tirare il cuore lontano dall'embrione. Separare il tratto polmonare e polmoni dal cuore, se ancora attaccato.
  3. Trasferire il cuore ad un singolo pozzetto del vetrino collagene rivestite e posizionarlo lato dorsale verso il basso (Figura 1B). Ripetere i passaggi 1.2.7-1.3 per ogni embrione.
  4. Una volta che tutti i cuori sono stati trasferiti a singoli pozzetti, incubare il vetrino camera per 30 minuti a 37 ° C, 5% CO 2 per consentire l'aderenza sufficiente per la matrice di collagene.
  5. aggiungere con cautela20-50 ml di pre-riscaldato medio espianto Un attorno ad ogni cuore. Importante: Non aggiungere il mezzo troppo velocemente o ad un livello sopra il cuore, altrimenti cuori possono staccarsi dal substrato collagene.
  6. Cultura i cuori a 37 ° C, 5% di CO 2 per circa 24 ore per consentire escrescenza epicardico. Nota: escrescenze possono essere osservati fin da 3-4 ore di cultura (Figura 1C) ed è composto principalmente da cellule mesoteliali che mostrano la morfologia ciottoli, con un minimo di contaminazione delle cellule mesenchimali (figure 1D, E). Risultati rappresentativi sono stati acquisiti utilizzando un microscopio dissezione dotato di una fotocamera.

2. genetica ablazione e induzione di EMT in epicardici escrescenze

Attenzione: maneggiare con cura adenovirus secondo le linee guida di biosicurezza approvati.

  1. Preparare 15 ml di mezzo B (M199 integrato con 1% FBS e 1% Pen / Strep) e pre-riscaldare a 37 ° C in un bagno d'acqua.
  2. Per l'asportazione dialleli floxed, preparano espianto medio B integrato con 2,5 x 10 4 pfu / ml di adenovirus che esprimono Cre ricombinasi (Ad / Cre) o virus di controllo.
    Nota: adenovirale sovraespressione mediata di geni candidati può anche essere effettuato per valutare guadagno di fenotipi funzionali. titoli virali devono essere determinati da parte dell'utente finale.
  3. Rimuovere con cautela cuori epicardium-impoverito da culture escrescenza con pinze. cuori Trasferire provette da 1,5 ml con 800 ml Trizol e conservare a -80 ° C per l'isolamento di RNA più tardi e analisi di espressione genica.
  4. Lavare ogni pozzetto con DPBS per rimuovere le cellule del sangue e detriti cellulari in eccesso.
  5. Aggiungere 500 microlitri espianto medio B supplementato con adenovirus (es) per ciascuna cultura escrescenza e incubare per 24 ore a 37 ° C, 5% CO 2.
  6. Per EMT induzione, rimuovere i supporti e ricostituire con 37 ° C di media espianto B integrato con ricombinante del fattore di crescita trasformante (TGF) -β1 [10 ng / ml] o di un veicolo (4 mm HAcido ydrochloric (HCl) contenente 1 mg / ml di albumina di siero bovino (BSA)). Espianti di coltura per un ulteriore 24 ore a 37 ° C, 5% di CO 2. Procedere con il gene / proteina analisi di espressione o immunocitochimica come indicato nei protocolli successivi.
    Nota: Induzione di EMT epicardico è stato stimolato con varie concentrazioni di TGF-β1 da 0,5 ng / ml - 10 ng / ml 26,31-33. Concentrazioni più elevate di ligando possono provocare vincolante per tutti i recettori TGF-β non specifico. La concentrazione di TGF-β1 dovrebbe riflettere gli obiettivi sperimentali specifici.

3. Analisi di espressione genica di epicardici escrescenze

  1. Scongelare cuori epicardium impoverito precedentemente memorizzati in Trizol (2.2).
  2. supporti Aspirare da culture EPDC e lavare due volte con DPBS.
  3. Aggiungere 800 ml Trizol temperatura ambiente per espiantare culture.
  4. Incubare cuori epicardium-impoverito e culture EPDC in Trizol per 5 minuti a camera tempe ri. Pipetta su e giù dieci volte per omogeneizzare il campione lisato.
    Nota: I cuori possono richiedere ulteriori pipettaggio per omogeneizzare completamente.
  5. Trasferimento lisati provette da 1,5 ml e procedere con l'isolamento di RNA totale per le istruzioni del produttore. Aggiungere 10 mg di glicogeno prima di precipitazioni per aumentare il rendimento RNA. Un dato espianto produrrà circa 0,5-1,0 mg di RNA.
  6. Rimuovere contaminazione del DNA con DNasi I e invertire trascrivere 0,5 mg mRNA secondo le istruzioni del produttore.
  7. Convalida la purezza di espianti e / o induzione di EMT con trascrizione inversa quantitativa epicardici (qRT) -PCR 34 con SYBR verde e gli indicatori descritti nella tabella 1. Livelli di mRNA Normalizzare a gliceraldeide 3-fosfato deidrogenasi (GAPDH) e calcolare l'espressione relativa utilizzando il 2 - metodo ΔΔCt 35. I risultati tipici sono mostrati nella Figura 2A.
titolo "Proteine ​​Analisi> 4. di epicardici escrescenze

  1. supporti Aspirare da culture EPDC e lavare due volte con DPBS.
  2. Aggiungere 10 microlitri tampone proteico lisi ghiacciato (50 mM Tris pH 7,5, 150 mM cloruro di sodio, 1 mM di acido etilendiamminotetraacetico pH 8,0, 1% Triton X-100, inibitore della proteasi 1x cocktail) per ciascuna camera bene e posizionare il vetrino alloggiamento su ghiaccio. Tagliare circa ¼ del fondo su un puntale P200 e utilizzare il pezzo rimanente per raschiare le cellule fuori della diapositiva. Pipetta su e giù per le cellule epicardial Lisare e trasferire in una provetta da 1,5 ml.
  3. Sonicare espianti lisati in basso (160 W) per 5 minuti in un bagno di acqua ghiacciata con 30 cicli sec ON e OFF.
  4. lisati di centrifugazione per 10 min a 10.000 xg, 4 ° C. Trasferire il surnatante in una nuova provetta e determinare la concentrazione di proteine ​​utilizzando un saggio proteico 36.
    Nota: Un dato espianto produrrà fino a 1,5 mg di proteine ​​totali. Abbiamo scoperto che pooling espianti da due cuori und carico 2 mg proteine ​​per bene è sufficiente per rilevare muscolo liscio α-actina (ACTA2) e GAPDH 9. Il rilevamento di altre proteine ​​bersaglio può richiedere riunire più campioni espianto come determinato da parte dell'utente finale.

5. Immunocitochimica di epicardici escrescenze

  1. Rimuovere i supporti da culture espianto e lavare due volte con DPBS.
  2. Delicatamente aggiungere 500 ml di 4% (v / v) paraformaldeide o metanolo ghiacciata in ciascun pozzetto e fissare espianti per 5 min a temperatura ambiente o 10 min a -20 ° C, rispettivamente. Fissare secondo le specifiche di anticorpi, come raccomandato dal produttore.
  3. Rimuovere fissativo e lavare ogni pozzetto con DPBS tre volte per 5 min.
  4. Permeabilize le cellule con 500 ml di 0,1% (v / v) Triton X-100 in DPBS per 5 min.
  5. Rimuovere la soluzione permeabilizzazione e risciacquare con DPBS tre volte per 5 min.
  6. Bloccare le cellule con 10% di siero in DPBS per 30 min at room temperi.
  7. Procedere con primaria colorazione anticorpi secondo le raccomandazioni del costruttore e condizioni ottimali, come determinato da parte dell'utente finale.
  8. Rimuovere soluzione di anticorpo e sciacquare con DPBS tre volte per 5 min.
  9. Applicare anticorpo secondario secondo le istruzioni e di contrasto del produttore con un colorante nucleare appropriata.
  10. Rimuovere soluzione di anticorpo e sciacquare con DPBS tre volte per 5 min.
  11. Rimuovere pareti scorrevoli della camera le istruzioni del produttore e aggiungere mezzo di montaggio acquoso direttamente alle cellule. Mettere un vetrino sulle celle e sigillare con smalto. I risultati tipici sono mostrati in Figura 2B - 2D utilizzando invertito microscopio confocale a scansione.

6. Ex Cultura Vivo Assay (figura 3A)

  1. preparativi
    1. Preparare 12 ml ex vivo terreno di coltura con un (1: 1) miscela di Dulbecco Modified Eagle Medium (DMEM): M199 supplementato con 10%FBS e 1% Pen / Strep.
    2. In un bagno d'acqua a 37 ° C, pre-calda ex vivo terreno di coltura e 100 ml HBSS.
    3. Aliquota 1 ml di mezzo preriscaldata in 8-12 pozzetti di una piastra ben 24.
    4. Trasferimento pre-riscaldato HBSS per due 10 cm 2 piastre, contenente 50 ml ciascuno.
  2. Isolare topo cuori embrionali in HBSS (come descritto in 1.2) da dighe in gravidanza a 12.5 dpc.
  3. Trasferire ogni cuore ad un singolo pozzetto della piastra ben 24 contenente ex vivo terreno di coltura. Incubare la piastra a 37 ° C, 5% CO 2 con delicata dondolo manualmente o tramite una piattaforma oscillante per prevenire l'adesione. procedere immediatamente al punto 7.1.

7. epicardico Etichettatura e EMT induzione in Culture ex vivo

  1. Per etichettare il epicardium, preparare 12 ml di 37 ° C ex vivo terreno di coltura integrato con 3,0 x 10 6 pfu / ml di Ad / GFP. Per l'ablazione mirata di alleli floxed, trasferimento 6 ml di Ad / GFP integrato terreno di coltura in un tubo da 15 ml. Aggiungere Ad / Cre o controllare adenovirus ad una concentrazione finale di 1,5 x 10 6 pfu / ml.
    Nota: guadagno di funzione analisi può essere effettuata anche con adeguata adenovirale consegna del gene mediato.
  2. Rimuovere con attenzione il terreno di coltura da ciascun pozzetto della piastra 24 e con una punta P 1.000 pipetta.
  3. aggiungere delicatamente terreno di coltura integrato con adenovirus (ES) in ciascun pozzetto.
  4. Incubare la piastra a 37 ° C, 5% di CO 2 per 24 ore con il dolce dondolio.
  5. Per EMT induzione, preparare 12 ml di 37 ° C ex vivo mezzo di coltura contenente 10 ng / ml di TGF-β1 e 20 ng / ml fattore di crescita derivato dalle piastrine (PDGF) -BB o veicolo (4 mM HCl contenente 1 mg / ml BSA ).
  6. Rimuovere con cautela terreno di coltura da ciascun pozzetto della piastra 24 e con una punta P 1.000 pipetta. Lavare delicatamente i cuori con 1 ml di DPBS.
  7. Rimuovere le DPBS e riempire i cuori con ex vivo cultura meDIUM contenente TGF-β1 e PDGF-BB o di un veicolo.
  8. Incubare per 24 ore a 37 ° C, 5% CO 2 con dolce dondolio.

8. crioconservazione e immunoistochimica delle Culture ex vivo

  1. Preparare i cuori per la crioconservazione.
    1. Rimuovere il terreno di coltura e lavare i cuori due volte con DPBS gelide.
    2. Aggiungere 1 ml di 4% (v / v) paraformaldeide ad ogni cuore e fissare per 2 ore a 4 ° C con dolce dondolio.
    3. Rimuovere il fissativo e lavare i cuori due volte con DPBS. Trasferire i cuori di pozzetti freschi con 1 ml di 10% (w / v) di saccarosio preparata in DPBS. Incubare la piastra di notte a 4 ° C con dolce dondolio.
    4. Trasferire accuratamente i cuori di nuovi pozzi con il 18% (w / v) di saccarosio preparato in DPBS. Incubare la piastra di notte a 4 ° C con dolce dondolio.
    5. Trasferire ogni cuore ad un cryomold contenente tessuto medio di congelamento. congelare immediatamente blocchi utilizzando azoto liquido e conservare a -80 & #176; C.
  2. cuori Sezione a 5 micron utilizzando un criostato e luogo sezioni di tessuto su vetrini da microscopio con carica positiva. Conservare scivola a -80 ° C fino a colorazione.
  3. Eseguire immunoistochimica sulle sezioni per la rilevazione della membrana basale sub-epicardico.
    1. Scongelare vetrini per almeno 30 minuti a temperatura ambiente.
    2. Reidratare sezioni lavando due volte in DPBS per 5 minuti con dolce dondolio.
    3. sezione permeabilize con 0,1% (v / v) Triton X-100 in PBS per 5 minuti a temperatura ambiente.
    4. Lavare i vetrini due volte in DPBS per 5 minuti con dolce dondolio.
    5. Blot off DPBS eccesso e definire la regione colorazione con una penna di etichettatura idrofoba. sezioni di blocco con il 10% di siero in DPBS per 30 min a temperatura ambiente.
    6. Rimuovere blocco e applicare collagene tipo IV anticorpi (ColIV, 1: 200) diluito in blocco. Incubare per una notte a 4 ° C in una camera ad umidità controllata.
    7. Lavare i vetrini tre volte in DPBS per5 minuti con dolce dondolio.
    8. Diluire fluorescente anticorpo coniugato secondario (1: 500) e DAPI (1: 5.000) in DPBS e applicare alle diapositive. Incubare per 1 ora a temperatura ambiente. Scegliere un anticorpo secondario adeguato con una lunghezza d'onda di emissione e di eccitazione distinto da GFP.
    9. Lavare i vetrini tre volte in PBS per 5 minuti con dolce dondolio. Montare i vetrini con mezzo di montaggio.

9. Imaging e quantificazione delle Culture ex vivo

  1. Avere un'immagine utente cieco e quantificare sezioni colorate. Immagine almeno cinque sezioni di tessuto non consecutive da un dato di cuore in 4-5 posizioni arbitrarie lungo il epicardio (bordo del cuore) utilizzando un microscopio a fluorescenza o confocale a 40X di ingrandimento. I risultati tipici sono mostrati nella Figura 3B usando invertito microscopio confocale a scansione.
  2. contare manualmente il numero totale di cellule positive GFP in una data immagine. Identificare la migrazione EPDC come GFP Pocellule sitive situati all'interno o al di là della membrana subepicardico seminterrato ColIV. Determinare la percentuale di GFP migrazione delle cellule come il numero di migrazione di GFP cellule positive rispetto al numero totale di cellule positive GFP in una data immagine. I risultati tipici sono mostrati nella Figura 3C-D utilizzando invertito microscopio confocale a scansione.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

L'epicardio può essere isolato in modo efficiente utilizzando un test cultura conseguenza, approfittando della sua posizione esterna e sfruttando la plasticità dello sviluppo e comportamento migratorio intrinseca EPDC. Cuori embrionali murini sono isolate a E11.5 prima EMT epicardico e lato dorsale coltivate sul camera di diapositive collagene rivestite con 26 (Figura 1A, B). cuori espiantati continueranno a contrarsi; tuttavia, l'epicardio aderirà alla matrice di collagene e migrare fuori dal miocardio entro 24 ore di coltura (Figura 1C). Cellule epicardici si possono osservare che emana dal cuore con ciottoli-come morfologia, indicativo di identità mesoteliali (Figure 1C-E). Dopo 24 ore di cultura, cuori epicardium-impoverito vengono rimossi per l'analisi del gene o della proteina espressione.

Oltre ad osservare epithelial morfologia, la purezza delle colture cellulari epicardici può essere ulteriormente convalidata dalla espressione di marcatori di geni e proteine ​​limitato epicardici. Espianti cellulari epicardici visualizzare robusta espressione di marcatori epicardici e mesothelial (Aldh1a2, Tcf21, e WT1) e bassa espressione di geni cardiomiociti (NKX2-5 e MYH7) rispetto ai cuori all'epicardio-impoverito (Figura 2A). Per verificare ulteriormente l'identità, colture cellulari epicardici sono fissi 48 ore dopo la rimozione del cuore e co-macchiato con anticorpi contro il tumore di Wilm 1 (WT1) e zona occludere proteina 1 (ZO1) per etichettare le cellule mesoteliali e giunzioni strette intercellulari, rispettivamente 37,38 ( Figura 2B). Questo metodo di coltura conseguenza produce una relativamente elevata purezza di cellule mesoteliali; tuttavia, gli utenti possono osservare una piccola percentuale di contaminazione delle cellule. I fibroblasti e cellule muscolari lisce esibiscono un fenotipo mesenchimale allungato con una notevole assenza di Nuclear WT1 e giunzioni strette organizzati (Figura 2C). Risoluzione dei problemi tecniche per limitare la quantità di contaminazione di cellule non-epicardica sono espanse nella discussione.

Il saggio espianto escrescenza è un sistema di coltura utile per interrogare biologia epicardico in vitro. Per dimostrare epicardico la plasticità delle cellule, espianti sono state stimolate con TGF-β1 [10 ng / ml] per indurre transdifferenziazione in cellule mesenchimali 26,28. Dopo 24 ore di stimolazione, EPDC adottare un fenotipo mesenchimale con ridotta colorazione ZO1 e robusta de novo formazione delle fibre muscolari lisce alfa-actina positivi stress (ACTA2 o SMA), particolarmente in corrispondenza della periferia della cultura 39 (Figura 2D, rosso). In contrasto sottolineare gruppo di fibre alla periferia di espianti, cellule confluenti epicardial con contatti intercellulari più definiti (ZO1, verde) al centro di un monolayeespressione della proteina ACTA2 visualizzazione r in actina corticale.

Oltre a subire EMT, EPDC invaderà il miocardio e differenziare, che costituisce una parte sostanziale di popolazioni non cardiomiociti. La motilità di EPDC può essere valutata utilizzando un ex vivo sistema di coltura di organi precedentemente stabilito per cui l'esterno di cuori E12.5 sono etichettati con un adenovirus che esprimono GFP 9,18 (Figura 3A). cuori etichettati vengono ulteriormente coltivate per tre giorni in presenza di TGF-β1 [10 ng / ml] e PDGF-BB [20 ng / ml] per promuovere la migrazione EPDC. Colture d'organo vengono periodicamente ruotate per impedire l'adesione della ex vivo cuori alla superficie delle piastre di coltura. Questo sistema permette di etichettatura efficiente dell'intera epicardio e valutazione EPDC motilità in un modello tridimensionale rispetto alla migrazione direzionale con saggi in vitro antigraffio. La migrazione di EPDC è osserved come l'invasione delle cellule GFP epicardici positive all'interno o al di là del ColIV (rosso) subepicardico membrana basale 16 (figure 3B, C). Per illustrare l'utilità di questo sistema, abbiamo recentemente dimostrato che la manipolazione dell'asse segnalazione MRTF / SRF può influenzare la motilità EPDC 9. Soppressione di Mrtfa e Mrtfb da escissione Cre-mediata di alleli floxed (MRTFdKO) attenua la migrazione di EPDC nello spazio subepicardico. Al contrario, l'espressione di MRTF-A (Ad / MRTF-A) in C57BL / 6 hearts traduce in un aumento della migrazione EPDC e la rottura della membrana basale ColIV (figure 3C, D) forzata.

Gene Inoltrare Inverso NCBI adesione
Aldh1a2 GGCACTGTGTGGATCAACTG TCACTTCTGTGTACGCCTGC NM_009656
GAPDH CGTGCCGCCTGGAGAAAC TGGGAGTTGCTGTTGAAGTCG NM_001289726
MYH7 GTGGCTCCGAGAAAGGAAG GAGCCTTGGATTCTCAAACG NM_080728
NKX2-5 GACGTAGCCTGGTGTCTCG GTGTGGAATCCGTCGAAAGT NM_008700
Tcf21 CATTCACCCAGTCAACCTGA CCACTTCCTTCAGGTCATTCTC NM_011545
WT1 ATCCGCAACCAAGGATACAG GGTCCTCGTGTTTGAAGGAA NM_144783

Tabella 1: Sequenze di avanti e indietro primer utilizzati per la convalida dei epicardico escrescenza cultura purezza, in Analisi di dell'epicardio e del miocardio ristretta Gene Expression espressione genica è determinato dal wi qRT-PCR.th i seguenti parametri: denaturazione a 95 ° C per 10 sec; ricottura a 60 ° C per 30 sec; ripetere 50x cicli.

Figura 1
Figura 1: Isolamento di cellule primarie epicardici Utilizzando una conseguenza Culture Assay (A) Una rappresentazione schematica del saggio escrescenza espianto epicardica con un calendario raccomandato per modulazione e analisi epicardico.. (B - E) immagini campo chiaro rappresentativi di vari intervalli di tempo durante il test espianto. (B) embrionali giorno E11.5 cuori murini sono posizionati lato dorsale verso il basso su un substrato di collagene. Cellule (C) epicardici (punte di freccia bianca) inizierà a migrare fuori cuore entro 3-4 ore della cultura. Le cellule del sangue (frecce nere) possono accumularsi nelle vicinanze o coprire espianti durante escrescenza epicardico. (D, E) Dopocirca 24 ore di cultura, cuori vengono rimossi e monostrati epicardici rimanere aderito alla diapositiva da camera. escrescenze cellulari mostrano la morfologia epiteliale con una disposizione ciottoli simile di cellule. Barre di scala = 250 micron (BD) o 50 micron (C, E). H = cuore, LA = atrio sinistro, LV = ventricolo sinistro, OFT = tratto di efflusso, RA = atrio destro, RV = ventricolo destro. Fai clic qui per vedere una versione più grande di questa figura.

figura 2
Figura 2: Valutazione di epicardico cellulare escrescenza Purezza (A) convalida qRT-PCR di epicardici limitato marcatori (Tcf21, Aldh1a2, e WT1) nelle culture escrescenza rispetto alla espressione genica miocardica (NKX2-5 e MYH7) in epicardium impoverito E11.. 5 cuori. rappre datit la media ± SEM (n = 8 per gruppo). Gli asterischi indicano significatività statistica utilizzando una T-test di Student con **** p <0,0001. (B) Rappresentante co-immunofluorescenza colorazione di escrescenze non stimolati per l'espressione epicardico (WT1, rosso), giunzioni strette intercellulari (ZO1, verde), e nuclei (DAPI, blu). (C) Un esempio di contaminazione di cellule in una cultura conseguenza. Cellule epicardial (asterisco) sono osservate per la destra del pannello con la caratteristica identità mesoteliali (WT1 nucleare, rosso) e organizzati giunzioni strette epiteliali (ZO1, verde). Le celle adiacenti al centro (frecce bianche) presentano una morfologia mesenchimali allungato, illustrato da immagini differenziale contrasto interferenziale (DIC), con il minimo di proteine ​​WT1 nucleare e disorganizzata colorazione ZO1. (D) colture cellulari epicardici sono state stimolate con veicolo (4 mm HCl a 1 mg / ml BSA) o TGF-β1 [10 ng / ml] per indurre epicardicoEMT. stimolazione TGF-β1 promuove robusta espressione di ACTA2 (rosso) nelle regioni corticali di cellule confluenti al centro di espianti o in fibre di stress di cellule migrano alla periferia o al perimetro del monostrato. aderenze cellulari sono etichettati da ZO1 (verde). Scala bar = 25 micron (BD). Clicca qui per vedere una versione più grande di questa figura.

Figura 3
Figura 3: Ex Vivo Valutazione della EPDC motilità (A) Una cronologia schematica del saggio coltura ex vivo cuore.. (B) Un rappresentante 5 micron sezione di un C57BL / 6 E12.5 cuore trasdotte con AD / GFP (verde) per 24 ore per etichettare l'esterno del cuore. Ex vivo cuori erano successivamente in coltura per un ulteriore 48 ore con TGF- β1 [10 ng / ml]e PDGF-BB [20 ng / ml] per stimolare la migrazione EPDC. Le sezioni sono state co-colorate per ColIV (rosso) per etichettare la membrana basale subepicardico e nuclei (DAPI, blu). Ex vivo cuore cultura morfologia è mostrato da DIC. LV = ventricolo sinistro, RV = ventricolo destro, RA = atrio destro. (C, D) Un esempio di applicazione della vivo test ex migrazione modulando l'asse normativo MRTF / SRF. Questo dato è stato modificato da [9]. Cuori E12.5 sono stati isolati da Mrtfa - / -;. Mrtfb fl / fl embrioni e trasdotte con Ad / GFP e un virus di controllo o di un adenovirus che esprime Cre ricombinasi per 24 ore ex vivo colture sono state poi stimolati con TGF-β1 [10 ng / ml] e PDGF-BB [20 ng / ml] per un ulteriore 48 ore. EPDC motilità (frecce bianche) si osserva come la migrazione di GFP cellule positive (verde) all'interno o al di là della ColIV (rosso). L'eliminazione di Mrtfb Cre-mediata nel <em> Mrtfa - / - sfondo (MRTFdKO) si traduce in attenuazione delle migrazioni EPDC rispetto ai controlli cuori. Al contrario, forzata espressione di MRTF-A (Ad / MRTF-A) in E12.5 C57BL / 6 cuori migliora la migrazione EPDC. (D) Quantificazione della migrazione delle cellule positiva% GFP. I dati sono presentati come media ± SEM (n = 4 cuori per ciascuna condizione). I dati sono stati analizzati utilizzando un one-way ANOVA con asterischi denotano significatività statistica per i test post-hoc Tukey con **** p <0,0001. Barre di scala = 200 micron (B) o 25 micron (C). Tutte le immagini sono state acquisite utilizzando invertito la microscopia confocale a scansione laser. Cliccate qui per vedere una versione più grande di questa figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Qui descriviamo metodi dettagliati per isolare cellule epicardico primaria escrescenza e monitorare la migrazione EPDC in ex vivo culture cuore. Per culture escrescenza, il momento opportuno per rimuovere il cuore dell'epicardio-impoverito varia leggermente tra esperimenti. Monitoraggio periodico degli espianti, dopo una notte di incubazione si raccomanda di valutare il grado di escrescenza epicardico e per estrarre il cuore prima che appaiano i fibroblasti. Per garantire la purezza, cuori devono essere rimossi entro 24 ore di espianto per evitare l'accumulo di lignaggi non epicardici. Taglio via il tratto di efflusso e due atri prima di trasferire il cuore di un vetrino da camera può anche ridurre contaminanti tipi di cellule 27,40. Poiché cuori fetali sono isolati da una cucciolata mouse durante una stretta finestra di tempo e coltivate nelle stesse condizioni, il tempo per escrescenze a comparire è relativamente simile da un cuore all'altro all'interno di un esperimento. Pertanto, tutti i cuori dovrebbero be rimosso quando la maggior parte degli espianti esporre escrescenze epicardici. In alcuni casi, le cellule epicardial non migrano in maniera efficiente da un cuore che si contrae con maggior vigore rispetto agli altri, nel qual caso questo espianto devono essere esclusi dal l'esperimento.

L'accumulo di cellule del sangue può spesso nascondere un monostrato di cellule piatta epicardici (frecce, figura 1C), rendendo così difficile per visualizzare escrescenze. Per evitare un eccessivo contributo globuli, cuori possono rimanere in HBSS per alcuni minuti su dissezione dall'embrione. Questo permette di tempo sufficiente per il cuore fetale di pompare il sangue residuo camere cardiache prima di essere trasferito a una diapositiva camera. In alternativa, che integra le culture con medie espianto A dopo la prima notte di incubazione aiuterà a lavare via un po 'di sangue in eccesso e rivelare escrescenze; Tuttavia, il livello di media non deve superare il cuore come la tensione superficiale può causare il cuorea tirare via dal substrato. Robuste escrescenze epicardici sono osservate con collagene di tipo I, come il substrato della cultura; Tuttavia, altri substrati sono stati riportati seconda dell'organismo e / o applicazione 27,40-42. Usando questo protocollo, le cellule fetali epicardial primarie possono prosperare per 4 giorni dopo la rimozione del cuore e la ricarica medio giornaliero; tuttavia, disegni sperimentali che richiedono periodi di cultura più lunghi devono essere determinati da parte dell'utente finale. Poiché EMT epicardico è fortemente attivato durante lo sviluppo embrionale, la tecnica di coltura escrescenza è limitata ad arricchire cellule epicardici fetali. Altri gruppi hanno descritto metodi per isolare le cellule adulte epicardial 43,44.

Per ex vivo saggi di migrazione, estrazione del cuore e di etichettatura delle cellule epicardico sono raccomandati a E12.5 per due ragioni. In primo luogo, cuori isolati dopo E12.5 sono più grandi e quindi richiedono più perfusione per sostenere la vitalità. Semplice diffusione di nutrientis non è sufficiente a mantenere colture d'organo da cuori grandi. In secondo luogo, EMT epicardico e migrazione EPDC si verificano intorno E12.5. Pertanto, l'epicardio deve essere etichettato con un adenovirus che esprimono una proteina fluorescente immediatamente dopo l'estrazione cuore per massimizzare la rilevazione di EPDC. In alternativa, carboxyfluorescein diacetato succinimidyl estere (CFSE) è stato riportato in precedenza per etichettare l'esterno del cuore e tracciare EPDC migrazione 10,45.

In contrasto con saggi escrescenza, ex vivo le colture devono essere scosso periodicamente per evitare di attacco di cuore e escrescenza cellulare epicardico. Culture potrebbero anche essere continuamente agitati in un incubatore dotato di un bilanciere sulla velocità più bassa. Gli utenti noteranno cambiamenti nella morfologia cardiaca entro un paio di giorni di coltura d'organo e dovrebbero evitare di analisi oltre 72 ore di isolamento cuore. Usando questo test, EPDC invasione si osserva entro 48 a 72 ore di cultura. Mentre il sistema Cre-loxPè stato utilizzato in vivo per mappare la localizzazione del EPDC al sistema vascolare coronarico, l'interstizio miocardio, e il setto interventricolare 7,22, questa tecnica ex vivo è limitata alla migrazione EPDC pochi strati di cellule dello spazio sub-epicardico. Pertanto, questo metodo è più adatto per la determinazione regolatori di EPDC motilità e invasione invece di determinare la destinazione finale di migrazione EPDC.

Isolamenti cellulari epicardici e ex vivo saggi di migrazione, in combinazione con il guadagno o la perdita di approcci funzionali, hanno già dimostrato utile per valutare geni candidati che potrebbero avere un impatto EPDC biologia 9,18,46. Questi metodi forniscono anche una piattaforma per il guadagno-di-funzione o schermi perdita-di-funzione per identificare nuovi regolatori della migrazione EPDC. Questa strategia, in collaborazione con fluorescenza attivato l'ordinamento delle cellule o singola cellula RNA-sequenziamento, può anche fornire l'occasione per sondare l'eterogeneità epicardicoe differenziazione EPDC in maggior dettaglio. Infine, le modifiche di queste procedure potrebbero essere utilizzati per sviluppare schermi di piccole molecole che hanno un impatto cella epicardico e biologia EPDC ai fini della medicina rigenerativa cardiaca.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno nulla da rivelare.

Acknowledgements

EMS è stata sostenuta da sovvenzioni dal National Institutes of Health (NIH) [codice di autorizzazione R01HL120919]; l'American Heart Association [codice di autorizzazione 10SDG4350046]; Università di Rochester premio CTSA dal NIH [codice di autorizzazione UL1 TR000042]; e fondi di avvio del Aab CVRI. MAT è stato sostenuto in parte da una sovvenzione per l'Università di Rochester Scuola di Medicina e Odontoiatria del Howard Hughes Medical Institute Med-In-Grad iniziativa; e un Istituzionale Ruth L. Kirschstein Nazionale premio di servizio di ricerca dal NIH [codice di autorizzazione GM068411].

Materials

Name Company Catalog Number Comments
Dulbecco's Modified Eagle Medium Hyclone  SH3002201 DMEM
Hanks' Balanced Salt Solution Hyclone SH3003102 HBSS
Medium 199 Hyclone SH3025301 M199
Dulbecco’s Phosphate-Buffered Saline  Hyclone SH3002802 DPBS
Fetal Bovine Serum  Gemini  100-106 FBS
Penicillin/Streptomycin Solution Hyclone SV30010
Corning Biocoat Collagen I, 4-Well Culture Slides Corning 354557
Multiwell 24-well plates Falcon 08-772-1
Dissecting microscope Leica M50 Equipped with Leica KL300 LED might source
Confocal miscroscope Olympus 1X81 Equipped with muli-argon laser 405/488/515, FV10-MCPSU laser 405/440/635, 559 laser, and mercury lamp
Bioruptor Diagenode  UCD-200
Transforming growth factor beta 1 R&D Systems 100-B-001 TGF-β1
Platelet-derived growth factor BB R&D Systems 220-BB-010 PDGF-BB
Trizol Reagent Applied Biosystems 15596-026 Caution, hazardous material
TURBO DNA-free Kit Life Technologies AM1907 DNaseI
iScript cDNA Synthesis Kit BioRad 1708891
UltraPure Glycogen Life Technologies 10814-010
SYBR Green BioRad 170-8880
Protease inhibtor cocktail tablets Roche 11836170001
Alexa Goat-anti-rabbit 488 Life Technologies A11008 Secondary antibody
Alexa Goat anti-rabbit 594 Life Technologies A-11012 Secondary antibody
Alexa Goat anti-mouse 594 Life Technologies A-11005 Secondary antibody
Mouse anti-smooth muscle alpha actin, Cy3-conjugated  Sigma-Aldrich C6198 monoclonal antibody, clone 1A4
Mouse anti-Wilms tumor 1 (WT1) Life Technologies MA1-46028 monoclonal antibody, clone 6F-H2
Rabbit anti-ZO1 Life Technologies 40-2200 polyclonal antibody
Rabbit anti-Collagen Type 4 Millipore AB756P polyclonal antibody
4',6-Diamidino-2-Phenylindole, Dihydrochloride  Life Technologies D1306 DAPI
Fluorescent mounting medium  DAKO S3023
16% Paraformaldehyde solution Electron Microscopy Sciences 15710 PFA diluted to 4% in DPBS. Caution, hazardous material
Sucrose Sigma-Aldrich S0389
Tissue Freezing Medium Triangle Biomedical Sciences TFM-B
Pap pen DAKO S2002
Disposable mictrotome blades  Sakura Finetek 4689
Microscope slides Globe Scientific 1358W positively charged, 25 mm x 75 mm x 1 mm
Cryostat  Leica CM1950
Forceps Fine Science Tools 11295-00
Surgical Scissors Fine Science Tools 91460-11
Disposable base molds Fisher Scientific 22-363-553
Ketamine Hospira NDC 0409-2051-05
Xylazine Akorn NADA 139-236

DOWNLOAD MATERIALS LIST

References

  1. von Gise, A., Pu, W. T. Endocardial and epicardial epithelial to mesenchymal transitions in heart development and disease. Circ Res. 110, 1628-1645 (2012).
  2. Martinez-Estrada, O. M., et al. Wt1 is required for cardiovascular progenitor cell formation through transcriptional control of Snail and E-cadherin. Nat Genet. 42, 89-93 (2010).
  3. Gittenberger-de Groot, A. C., Vrancken Peeters, M. P., Mentink, M. M., Gourdie, R. G., Poelmann, R. E. Epicardium-derived cells contribute a novel population to the myocardial wall and the atrioventricular cushions. Circ Res. 82, 1043-1052 (1998).
  4. Katz, T. C., et al. Distinct compartments of the proepicardial organ give rise to coronary vascular endothelial cells. Dev Cell. 22, 639-650 (2012).
  5. Mikawa, T., Gourdie, R. G. Pericardial mesoderm generates a population of coronary smooth muscle cells migrating into the heart along with ingrowth of the epicardial organ. Dev Biol. 174, 221-232 (1996).
  6. Wilm, B., Ipenberg, A., Hastie, N. D., Burch, J. B., Bader, D. M. The serosal mesothelium is a major source of smooth muscle cells of the gut vasculature. Development. 132, 5317-5328 (2005).
  7. Zhou, B., et al. Epicardial progenitors contribute to the cardiomyocyte lineage in the developing heart. Nature. 454, 109-113 (2008).
  8. Dettman, R. W., Denetclaw, W., Ordahl, C. P., Bristow, J. Common epicardial origin of coronary vascular smooth muscle, perivascular fibroblasts, and intermyocardial fibroblasts in the avian heart. Dev Biol. 193, 169-181 (1998).
  9. Trembley, M. A., Velasquez, L. S., de Mesy Bentley, K. L., Small, E. M. Myocardin-related transcription factors control the motility of epicardium-derived cells and the maturation of coronary vessels. Development. 142, 21-30 (2015).
  10. Mellgren, A. M., et al. Platelet-derived growth factor receptor beta signaling is required for efficient epicardial cell migration and development of two distinct coronary vascular smooth muscle cell populations. Circ Res. 103, 1393-1401 (2008).
  11. von Gise, A., et al. WT1 regulates epicardial epithelial to mesenchymal transition through beta-catenin and retinoic acid signaling pathways. Dev Biol. 356, 421-431 (2011).
  12. Lavine, K. J., et al. Endocardial and Epicardial Derived FGF Signals Regulate Myocardial Proliferation and Differentiation In Vivo. Dev Cell. 8, 85-95 (2005).
  13. Sanchez, N. S., Barnett, J. V. TGFbeta and BMP-2 regulate epicardial cell invasion via TGFbetaR3 activation of the Par6/Smurf1/RhoA pathway. Cell Signal. 24, 539-548 (2012).
  14. Dettman, R. W., Pae, S. H., Morabito, C., Bristow, J. Inhibition of 4-integrin stimulates epicardial-mesenchymal transformation and alters migration and cell fate of epicardially derived mesenchyme. Dev Biol. 257, 315-328 (2003).
  15. Rhee, D. Y., et al. Connexin 43 regulates epicardial cell polarity and migration in coronary vascular development. Development. 136, 3185-3193 (2009).
  16. Wu, M., et al. Epicardial spindle orientation controls cell entry into the myocardium. Dev Cell. 19, 114-125 (2010).
  17. Hirose, T., et al. PAR3 is essential for cyst-mediated epicardial development by establishing apical cortical domains. Development. 133, 1389-1398 (2006).
  18. Baek, S. T., Tallquist, M. D. Nf1 limits epicardial derivative expansion by regulating epithelial to mesenchymal transition and proliferation. Development. 139, 2040-2049 (2012).
  19. Lu, J., et al. Coronary smooth muscle differentiation from proepicardial cells requires rhoA-mediated actin reorganization and p160 rho-kinase activity. Dev Biol. 240, 404-418 (2001).
  20. Combs, M. D., Braitsch, C. M., Lange, A. W., James, J. F., Yutzey, K. E. NFATC1 promotes epicardium-derived cell invasion into myocardium. Development. 138, 1747-1757 (2011).
  21. Acharya, A., et al. The bHLH transcription factor Tcf21 is required for lineage-specific EMT of cardiac fibroblast progenitors. Development. 139, 2139-2149 (2012).
  22. Zhou, B., von Gise, A., Ma, Q., Hu, Y. W., Pu, W. T. Genetic fate mapping demonstrates contribution of epicardium-derived cells to the annulus fibrosis of the mammalian heart. Dev Biol. 338, 251-261 (2010).
  23. Zhou, B., et al. Adult mouse epicardium modulates myocardial injury by secreting paracrine factors. J Clin Invest. 121, 1894-1904 (2011).
  24. Singh, M., Epstein, J. Epicardial Lineages and Cardiac Repair. Journal of Developmental Biology. 1, 141-158 (2013).
  25. Braitsch, C. M., Combs, M. D., Quaggin, S. E., Yutzey, K. E. Pod1/Tcf21 is regulated by retinoic acid signaling and inhibits differentiation of epicardium-derived cells into smooth muscle in the developing heart. Dev Biol. 368, 345-357 (2012).
  26. Austin, A. F., Compton, L. A., Love, J. D., Brown, C. B., Barnett, J. V. Primary and immortalized mouse epicardial cells undergo differentiation in response to TGFbeta. Developmental dynamics : an official publication of the American Association of Anatomists. 237, 366-376 (2008).
  27. Kim, J., Rubin, N., Huang, Y., Tuan, T. L., Lien, C. L. In vitro culture of epicardial cells from adult zebrafish heart on a fibrin matrix. Nat Protoc. 7, 247-255 (2012).
  28. Compton, L. A., Potash, D. A., Mundell, N. A., Barnett, J. V. Transforming growth factor-beta induces loss of epithelial character and smooth muscle cell differentiation in epicardial cells. Developmental dynamics : an official publication of the American Association of Anatomists. 235, 82-93 (2006).
  29. Smith, C. L., Baek, S. T., Sung, C. Y., Tallquist, M. D. Epicardial-derived cell epithelial-to-mesenchymal transition and fate specification require PDGF receptor signaling. Circ Res. 108, 15-26 (2011).
  30. Shea, K., Geijsen, N. Dissection of 6.5 dpc Mouse Embryos. JOVE. 2, (2007).
  31. Witty, A. D., et al. Generation of the epicardial lineage from human pluripotent stem cells. Nature biotechnology. 32, 1026-1035 (2014).
  32. Iyer, D., et al. Robust derivation of epicardium and its differentiated smooth muscle cell progeny from human pluripotent stem cells. Development. 142, 1528-1541 (2015).
  33. Takeichi, M., Nimura, K., Mori, M., Nakagami, H., Kaneda, Y. The transcription factors Tbx18 and Wt1 control the epicardial epithelial-mesenchymal transition through bi-directional regulation of Slug in murine primary epicardial cells. PloS one. 8, e57829 (2013).
  34. Wong, M. L., Medrano, J. F. Real-time PCR for mRNA quantitation. BioTechniques. 39, 75-85 (2005).
  35. Schmittgen, T. D., Livak, K. J. Analyzing real-time PCR data by the comparative CT method. Nature Protocols. 3, 1101-1108 (2008).
  36. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical biochemistry. 72, 248-254 (1976).
  37. Moore, A. W., McInnes, L., Kreidberg, J., Hastie, N. D., Schedl, A. YAC complementation shows a requirement for Wt1 in the development of epicardium, adrenal gland and throughout nephrogenesis. Development. 126, 1845-1857 (1999).
  38. Kim, J., et al. PDGF signaling is required for epicardial function and blood vessel formation in regenerating zebrafish hearts. Proc Natl Acad Sci U S A. 107, 17206-17210 (2010).
  39. Kalluri, R., Weinberg, R. A. The basics of epithelial-mesenchymal transition. J Clin Invest. 119, 1420-1428 (2009).
  40. Dong, X. R., Maguire, C. T., Wu, S. P., Majesky, M. W. Chapter 9 Development of Coronary Vessels. Methods in Enzymology. 445, 209-228 (2008).
  41. Ruiz-Villalba, A., Ziogas, A., Ehrbar, M., Perez-Pomares, J. M. Characterization of epicardial-derived cardiac interstitial cells: differentiation and mobilization of heart fibroblast progenitors. PLoS One. 8, e53694 (2013).
  42. Garriock, R. J., Mikawa, T., Yamaguchi, T. P. Isolation and culture of mouse proepicardium using serum-free conditions. Methods. 66, 365-369 (2014).
  43. Smart, N., Riley, P. Derivation of epicardium-derived progenitor cells (EPDCs) from adult epicardium. Curr Protoc Stem Cell Biol. (2009).
  44. Zhou, B., Pu, W. T. Isolation and characterization of embryonic and adult epicardium and epicardium-derived cells. Methods Mol Biol. 843, 155-168 (2012).
  45. Morabito, C. J., Dettman, R. W., Kattan, J., Collier, J. M., Bristow, J. Positive and negative regulation of epicardial-mesenchymal transformation during avian heart development. Dev Biol. 234, 204-215 (2001).
  46. Grieskamp, T., Rudat, C., Ludtke, T. H., Norden, J., Kispert, A. Notch signaling regulates smooth muscle differentiation of epicardium-derived cells. Circ Res. 108, 813-823 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics