Epicárdio Conseqüência Cultura Ensaio e

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Trembley, M. A., Velasquez, L. S., Small, E. M. Epicardial Outgrowth Culture Assay and Ex Vivo Assessment of Epicardial-derived Cell Migration. J. Vis. Exp. (109), e53750, doi:10.3791/53750 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Uma única camada de linhas de células do epicárdio do coração, proporcionando factores parácrinos que estimulam a proliferação de cardiomiócitos e que contribui directamente progenitores cardiovasculares durante o desenvolvimento e a doença. Embora um certo número de factores têm sido implicados na célula (EPDC) mobilização derivado do epicárdio, os mecanismos que regem a sua migração e diferenciação subsequente são mal compreendidos. Aqui, apresentamos in vitro e as estratégias ex vivo para estudar EPDC motilidade e diferenciação. Em primeiro lugar, descreve-se um método de obtenção de células do epicárdio primárias por cultura excrescência do coração embrionário do rato. Nós também introduzir um protocolo detalhado para avaliar a migração tridimensional de EPDC marcado num sistema de cultura de órgãos. Nós fornecemos provas usando essas técnicas que deleção genética dos fatores de transcrição relacionados com myocardin no epicárdio atenua a migração EPDC. Esta abordagem serve como uma plataforma para avaliar modificadores candidatos da EPDCbiologia e pode ser utilizado para desenvolver telas genéticos ou químicas para identificar novos reguladores de EPDC mobilização que possam ser úteis para a reparação cardíaca.

Introduction

O epicárdio é uma única camada de células mesoteliais que reveste o coração e impactos cardíaca desenvolvimento, maturação e reparação. Através de uma troca altamente coordenada de sinais parácrinos, o diálogo íntimo entre o miocárdio e epicárdio é indispensável para o crescimento cardíaco e a formação de não-miócitos cardíacos linhagens 1. Células derivadas de epicárdio (EPDC) emergir a partir de um subconjunto de células do epicárdio através de um epitelial-a-mesenquimal transição (EMT) 2, invadem o espaço subepicárdico e miocárdio subjacente, e se diferenciam em grande parte, em células murais vasculares coronárias e fibroblastos cardíacos, e para uma menor extensão, células endoteliais e cardiomiócitos 3-9.

Os mecanismos que regulam EMT epicárdico e EPDC invasão têm sido atribuídas à acção coordenada de vários ligandos, incluindo as moléculas segregadas 10-13, receptores da superfície das células e moléculas de adesão, 14,15 mentoLators de polaridade apical-basal, 16,17, 18,19 GTPases pequenas, e factores de transcrição 2,20,21. Enquanto muitos dos efectores moleculares de migração EPDC ter sido definida, uma melhor compreensão dos sinais fisiológicos que estimulam EPDC mobilização no embrião pode acelerar o desenvolvimento de estratégias para manipular este processo no adulto para melhorar a reparação cardíaca.

Estudos destinadas a identificação de novos reguladores de EPDC mobilização dependem de purificação desta população de células ou traçando a migração de células do epicárdio individuais. Um ou uma combinação de genes marcadores, incluindo WT1, Tcf21, Tbx18, e / ou ALDH1A2, é vulgarmente utilizada para identificar o epicárdio fetal 1. No entanto, a utilização destes marcadores para controlar a migração EPDC não é óptima quanto a expressão de marcadores do epicárdio diminui ao longo do desenvolvimento do coração e é muitas vezes perdida quando as células do epicárdio submetidos a transdifdiferen- em células mesenquimais.

A aplicação do sistema Cre / loxP, em conjunto com os repórteres de rastreamento de linhagem, tem sido útil na rotulagem permanentemente o epicárdio e seus descendentes durante o desenvolvimento do coração e após a lesão isquêmica no adulto 7,22,23. Várias linhas de Cre-restrito do epicárdio foram geradas e são amplamente usadas para rotular EPDC e para o gene condicional estratégias de exclusão 1. Estes estudos levaram à caracterização de várias linhagens do epicárdio, e a identificação de mediadores críticos de EPDC motilidade e diferenciação. No entanto, evidências acumuladas também sugere o epicárdio é uma população heterogênea de células progenitoras 4,24,25. Deste modo, apenas um subconjunto de células do epicárdio vai ser alvo utilizando um determinado condutor de Cre.

A fim de marcar todo o epicárdio independentemente da especificidade de Cre, um número de laboratórios utilizaram cul excrescênciasistemas tura ou ex vivo métodos de cultura de órgão para isolar fielmente ou marcar as células do epicárdio sem depender da expressão genética de uma linhagem marcadores 26-28. Para ex vivo estudos de migração, corações embrionárias são isoladas antes da EMT epicárdio e cultivadas em meio suplementado com uma proteína verde fluorescente (GFP) -expressing adenovirus (Ad / GFP) 9,18. Esta abordagem permite a marcação eficiente de todo o epicárdio ao invés de um subconjunto de células, a recombinação mediada por Cre. Culturas cardíacos são subsequentemente expostas a indutores conhecidos de EMT para estimular a mobilização de EPDC 28,29. Ex vivo e in vivo são complementadas por análises in vitro Culturas de explantes do epicárdio, que são uma abordagem particularmente útil para explorar mecanismos detalhados condução migração EPDC.

Aqui, descrevemos métodos para isolar as células do epicárdio primárias para estudos in vitro de epicardiai EMT, bem como um sistema de cultura de órgãos ex vivo para análises de EPDC motilidade. Recentemente, demonstrou a utilidade e robustez deste método pelo geneticamente modulando o factor relacionado com myocardin transcrição (MRTF) / factor de resposta do soro (SRF) eixo sinalização para manipular a migração baseado em actina de EPDC 9. Enquanto nossos resultados destacam uma via de sinalização necessária para regular a migração EPDC, estes métodos são adequados para desvendar os mecanismos que coletivamente orquestram a migração EPDC e diferenciação. Além disso, o ex vivo sistemas de cultura de explante e poderia ser implementado em telas funcionais para identificar novos reguladores de EPDC mobilização para aplicações terapêuticas em regeneração cardíaca.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

NOTA: Todas as experiências com camundongos foram aprovados pelo Comitê da Universidade de Recursos Animais da Universidade de Rochester.

1. epicárdica Conseqüência Cultura Ensaio (Figura 1A)

  1. preparativos
    1. Prepare 5 ml de meio A para o isolamento de células do epicárdio primária suplementando o meio 199 (M199) com 5% de soro fetal de bovino (FBS) e 1% de penicilina / estreptomicina (Pen / Strep).
    2. Pré-aquecido meio A e 100 mL de Hanks Solução Salina Equilibrada (SSHE) num banho de água a 37 ° C.
    3. Permitir lâminas de câmara revestidas com colagénio a aquecer até à temperatura ambiente durante 30 min.
    4. Adicionar 100 ul de meio A a cada poço da câmara de corrediça e rodar cuidadosamente para revestimento uniformemente a superfície do colagénio. Repita o procedimento para 8-12 poços. Remova a mídia depois de câmaras de revestimento.
    5. Aliquota pré-aquecido HBSS em duas placas de 10 cm2 contendo 50 ml de cada vez de HBSS.
  2. Isolar embrionárias Corações de Dam gravida em 11,5 dias post coitum (DPC).30
    1. Anestesiar rato com 0,5 mL de 13 mg / ml de cetamina / 0,88 mg / ml de cocktail de xilazina em 1x de Dulbecco tamponada com fosfato salino (DPBS) através de injecção intraperitoneal. Confirmar anesthetization adequada usando um teste toe pitada. Uma pitada suave é suficiente para determinar se o mouse é sensível. Qualquer movimento ou pata retirar indica que o animal não está suficientemente anestesiados para fazer a cirurgia. Eutanásia por deslocamento cervical.
    2. Coloque o rato que enfrenta o lado ventral para cima e pulverizar o abdômen com 70% de etanol para reduzir a contaminação pelo cabelo.
    3. Comprimir a pele com uma pinça e cortar uma incisão lateral no abdômen com uma tesoura cirúrgica. Segure a pele firmemente e puxe para além de indicações para a cabeça ea cauda de oposição.
    4. Comprima o peritoneu com uma pinça e cortado com uma tesoura para expor a cavidade abdominal.
    5. Remova cuidadosamente a decídua cortando ao longo da mesométrio. Transferir a decidua dissecados para pré-aquecido HBSS no primeiro10 cm 2 prato.
    6. Separe a decídua pelo corte entre embriões.
    7. Transferir um embrião para a segunda placa de 10 cm2 com HBSS pré-aquecido sob um microscópio de dissecação. Remova cuidadosamente o tecido e saco vitelino extraembryonic, então decapitar o embrião.
    8. Beliscar a parede torácica com uma pinça e rasgar o tecido distante na linha média, expondo a cavidade torácica.
    9. Coloque a pinça por trás do coração. Segure a via de saída e puxe o coração longe do embrião. Separar o trato pulmonar e pulmões do coração, se ainda ligado.
  3. Transferir o coração a um único poço da lâmina revestida de colagénio e coloque-o lado dorsal para baixo (Figura 1B). Repetir passos 1.2.7-1.3 para cada embrião.
  4. Uma vez que todos os corações foram transferidas para poços individuais, incubar a corrediça câmara durante 30 min a 37 ° C, 5% de CO2 para permitir a adesão suficiente para a matriz de colagénio.
  5. cuidadosamente adicionar20-50 mL de pré-aquecido meio de explante A volta de cada coração. Importante: Não adicione o meio demasiado depressa ou a um nível acima do coração, caso contrário corações pode soltar-se o substrato de colágeno.
  6. Cultura os corações a 37 ° C, 5% de CO 2 durante cerca de 24 h, para permitir crescimento do epicárdio. Nota: excrescências podem ser observadas tão cedo quanto 3-4 horas de cultura (Figura 1C) e consiste principalmente de células de mesotélio que exibem morfologia de paralelepípedo, com a contaminação de células mesenquimais mínima (Figuras 1D, E). Os resultados representativos foram adquiridos utilizando um microscópio de dissecção equipado com uma câmara.

2. A ablação genética e indução de EMT em epicárdicas excrescências

Cuidado: Pega adenovírus com cuidado de acordo com as diretrizes de biossegurança aprovados.

  1. Preparar 15 ml de meio B (M199 suplementado com 1% FBS e 1% de Pen / Strep) e pré-aquecido a 37 ° C num banho de água.
  2. Para excisãoalelos floxed, prepare explante meio B suplementado com 2,5 x 10 4 ufc / ml de adenovírus que expressam Cre recombinase (Ad / CRE) ou vírus controle.
    Nota: sobreexpressão mediada adenoviral de genes candidatos pode também ser levada a cabo para avaliar o ganho de fenótipos funcionais. títulos virais deve ser determinada pelo utilizador final.
  3. Remova cuidadosamente corações empobrecido-epicárdio de culturas de crescimento usando uma pinça. corações de transferência para tubos de 1,5 ml com 800 ul de Trizol e armazenar a -80 ° C para posterior isolamento do ARN e análise de expressão génica.
  4. Lavar cada poço com DPBS para eliminar as células do sangue e excesso de detritos celulares.
  5. Adicionar 500 ul de explante meio B, suplementado com adenovírus (es) a cada cultura de crescimento e incubar durante 24 horas a 37 ° C, 5% de CO 2.
  6. Para a indução de EMT, remova o material e encher com 37 ° C explante meio B, suplementado com factor de crescimento de transformação recombinante (TGF) -β1 [10 ng / ml] ou veículo (h 4mMácido ydrochloric (HCl) contendo 1 mg / ml de albumina de soro bovino (BSA)). Explantes de cultura para uma 24 horas adicionais a 37 ° C, 5% de CO 2. Proceda com gene / proteína analisa expressão ou imunocitoquímica, conforme detalhado nos protocolos subsequentes.
    Nota: A indução de EMT epicárdica foi estimulada com várias concentrações de TGF-β1 variando de 0,5 ng / mL - 10 ng / ml 26,31-33. Concentrações mais elevadas de ligando pode resultar na ligação não específica a todos os receptores de TGF-β. A concentração de TGF-β1 deve refletir os objetivos experimentais específicos.

Análise Expression 3. Gene de epicárdicas excrescências

  1. corações empobrecido-epicárdio descongelamento previamente armazenadas em Trizol (2.2).
  2. Aspirar meios de culturas EPDC e lavar duas vezes com DPBS.
  3. Adicionar 800 mL Trizol temperatura ambiente para explante culturas.
  4. Incubar corações empobrecido-epicárdio e culturas EPDC em Trizol por 5 min a temperatu quarto ré. Pipeta cima e para baixo dez vezes para homogeneizar a amostra lisadas.
    Nota: Os corações pode exigir mais de pipetagem para homogeneizar completamente.
  5. Transferir os lisados ​​para tubos de 1,5 ml e completar o isolamento de RNA total acordo com as instruções do fabricante. Adicionam-se 10 ug de glicogénio antes da precipitação para aumentar o rendimento de ARN. Um explante dado irá produzir cerca de 0,5-1,0 ug de ARN.
  6. Remover o ADN contaminante, com a ADNase I e a transcrição reversa mRNA de 0,5 ug acordo com as instruções do fabricante.
  7. Validar a pureza de explantes e / ou indução de EMT com transcrição reversa quantitativa do epicárdio (qRT) -PCR 34 utilizando SYBR Green e os marcadores descritos na Tabela 1. Os níveis de ARNm Normalizar a gliceraldeído-3-fosfato desidrogenase (GAPDH) e calcular a expressão relativa usando o 2 - método ΔΔCt 35. Os resultados típicos são mostrados na Figura 2A.
title "> 4. análise de proteínas de epicárdicas excrescências

  1. Aspirar meios de culturas EPDC e lavar duas vezes com DPBS.
  2. Adicionar 10 ul de tampão de lise proteína arrefecido com gelo (Tris 50 mM, pH 7,5, cloreto de sódio 150 mM, 1 mM de ácido etilenodiaminotetraacético pH 8,0, 1% de Triton X-100, cocktail 1x inibidor da protease) a cada câmara bem e coloque a lâmina Secção de gelo. Cortar cerca de ¼ do fundo em uma ponta da pipeta P200 e usar a parte restante para raspar as células fora do slide. Pipeta cima e para baixo para as células do epicárdio lisar e transferência para um tubo de 1,5 ml.
  3. Sonicate explantes lisadas em baixa (160 W) durante 5 min em um banho de água gelada com 30 ciclos seg ON e OFF.
  4. Centrifugar os lisados ​​durante 10 minutos a 10000 xg, 4 ° C. Transferir o sobrenadante para um tubo fresco e determinar a concentração de proteína utilizando um ensaio de proteína de 36.
    Nota: A explante dada vai render até 1,5 ug de proteína total. Descobrimos que pooling explantes de dois corações umd carga de proteína de 2 ug por poço é suficiente para detectar o músculo liso α-actina (ACTA2) e GAPDH 9. A detecção de outras proteínas alvo podem exigir reunindo múltiplas amostras de explante tal como determinado pelo utilizador final.

5. Imunocitoqu�ica de epicárdicas excrescências

  1. Remova a mídia da cultura de explantes e lavar duas vezes com DPBS.
  2. Suavemente adicionar 500 uL de paraformaldeído a 4% (v / v) ou de metanol arrefecido em gelo a cada poço e corrigir explantes durante 5 min à temperatura ambiente ou 10 min a -20 ° C, respectivamente. Fix acordo com as especificações de anticorpo, tal como recomendado pelo fabricante.
  3. Remover fixador e lavar cada poço com DPBS três vezes durante 5 min.
  4. Permeabilizar as células com 500 ul de 0,1% (v / v) de Triton X-100 em DPBS durante 5 min.
  5. Remoção da solução de permeabilização e enxaguar com DPBS três vezes por 5 min.
  6. Bloquear as células com soro a 10% em DPBS durante 30 minutos à temperatu quartoré.
  7. Continuar com coloração de anticorpo primário acordo com as recomendações do fabricante e as condições óptimas como determinado pelo utilizador final.
  8. Remoção da solução de anticorpo e lavar com DPBS três vezes durante 5 min.
  9. Aplicar anticorpo secundário por instruções do fabricante e contrastante com um corante nuclear apropriado.
  10. Remoção da solução de anticorpo e lavar com DPBS três vezes durante 5 min.
  11. Remover paredes deslizantes câmara de acordo com as instruções do fabricante e adicionar meio de montagem aquoso directamente para as células. Coloque uma lamela sobre as células e selar com unha polonês. Os resultados típicos são mostrados na Figura 2B - 2D utilizando microscopia confocal invertido.

6. Cultura Ensaio Ex Vivo (Figura 3A)

  1. preparativos
    1. Preparar 12 ml de meio de cultura ex vivo usando um (1: 1) mistura de Dulbecco Modified Eagle Médium (DMEM): M199 suplementado com 10%FBS e 1% de Pen / Strep.
    2. Em um banho de água a 37 ° C, pré-aquecido ex vivo meio de cultura e 100 ml de HBSS.
    3. Alíquotas de 1 ml meio de pré-aquecida em 8-12 poços de uma placa de 24 poços.
    4. Transferência de HBSS pré-aquecido a duas 2 placas de 10 cm, contendo 50 ml de cada vez.
  2. Isolar rato corações embrionárias em HBSS (como descrito em 1.2) a partir de vacas prenhes em 12,5 dpc.
  3. Transferir cada coração para um único poço da placa de 24 poços contendo meio de cultura ex vivo. Incubar a placa a 37 ° C, 5% de CO2 com agitação suave manualmente ou utilizando uma plataforma de agitação para evitar a adesão. proceder imediatamente para o passo 7.1.

7. Epicárdica Labeling e EMT Indução em culturas ex vivo

  1. Para identificar o epicárdio, prepare-se 12 ml de meio de cultura C 37 ° ex vivo suplementado com 3,0 x 10 6 ufc / ml de Ad / GFP. Para ablação direccionada de alelos floxed, transferência de 6 ml de umad / GFP suplementado meio de cultura para um novo tubo de 15 ml. Adicionar Ad / Cre ou controlar adenovírus a uma concentração final de 1,5 x 10 6 pfu / ml.
    Nota: O ganho de função análises também pode ser levada a cabo com a entrega de genes mediada por adenovírus apropriado.
  2. Cuidadosamente remover o meio de cultura de cada poço da placa de 24 poços utilizando uma ponta de pipeta P1,000.
  3. Adicionar cuidadosamente meio de cultura suplementado com adenovírus (es) a cada poço.
  4. Incubar a placa a 37 ° C, 5% de CO 2 durante 24 horas com agitação suave.
  5. Para a indução de EMT, preparar 12 ml de 37 ° C ex vivo meio de cultura contendo 10 ng / ml de TGF-β1 e ml de factor de crescimento de 20 ng / derivado de plaquetas (PDGF) ou -BB veículo (HCl 4 mM contendo 1 mg / ml de BSA ).
  6. Cuidadosamente remover o meio de cultura de cada poço da placa de 24 poços utilizando uma ponta de pipeta P1,000. Lave os corações com 1 ml de DPBS.
  7. Retire os DPBS e encher os corações com a cultura ex vivo medium contendo TGF-β1 e PDGF-BB ou veículo.
  8. Incubar durante 24 horas a 37 ° C, 5% de CO2 com agitação suave.

8. A crioconservação e imuno-histoquímica de culturas ex vivo

  1. Preparar os corações para a criopreservação.
    1. Remover o meio de cultura e lava-se duas vezes com corações DPBS arrefecido com gelo.
    2. Adicionar 1 mL de 4% (v / v) de paraformaldeído a cada coração e fixar durante 2 horas a 4 ° C com agitação suave.
    3. Remover o fixador e lava-se duas vezes com DPBS corações. Transferir os corações para poços frescas com 1 ml de 10% (w / v) de sacarose preparado em DPBS. Incubar a placa durante a noite a 4 ° C com agitação suave.
    4. transferir cuidadosamente corações para novos poços com 18% (w / v) de sacarose preparado em DPBS. Incubar a placa durante a noite a 4 ° C com agitação suave.
    5. Transferir cada coração a uma cryomold contendo meio de congelamento de tecidos. congelar imediatamente blocos usando azoto líquido e armazenar a -80 & #176; C.
  2. Seção corações em 5 mm, utilizando um criostato e colocar secções de tecido em lâminas de microscópio carregados positivamente. Loja desliza a -80 ° C até à coloração.
  3. Realizar imuno-histoquímica em secções de detecção da membrana basal sub-epicárdico.
    1. Descongelar as lâminas durante pelo menos 30 min à temperatura ambiente.
    2. Reidratar as seções por lavagem duas vezes em DPBS durante 5 minutos com balanço suave.
    3. secção permeabilizar com 0,1% (v / v) de Triton X-100 em PBS durante 5 min à temperatura ambiente.
    4. Lavar as lâminas duas vezes em DPBS durante 5 minutos com balanço suave.
    5. Seque o DPBS excesso e definir a região de coloração com uma caneta rotulagem hidrofóbica. secções de bloco com soro a 10% em DPBS durante 30 minutos à temperatura ambiente.
    6. Remova o bloco e aplicar anticorpo colágeno tipo IV (ColIV, 1: 200) diluído em bloco. Incubar durante a noite a 4 ° C numa câmara com humidade controlada.
    7. Lavam-se as lâminas três vezes em DPBS durante5 min com balanço suave.
    8. Dilui-se o anticorpo secundário conjugado com fluorescência (1: 500) e DAPI (1: 5000) em DPBS e aplicam-se as lâminas. Incubar durante 1 h à temperatura ambiente. Escolha um anticorpo secundário apropriado com um comprimento de onda de emissão e de excitação distinta da GFP.
    9. Lavam-se as lâminas três vezes em PBS durante 5 min com agitação suave. Mount slides com meio de montagem.

9. Imagem e Quantificação de culturas ex vivo

  1. Ter uma imagem de usuário cego e quantificar secções coradas. Imagem pelo menos cinco secções de tecido não-consecutivos de um dado coração em 4-5 locais arbitrários ao longo do epicárdio (extremidade do coração), utilizando um microscópio de fluorescência confocal ou na 40X. Os resultados típicos são mostrados na Figura 3B usando microscopia confocal invertido.
  2. contagem manual do número total de células positivas para GFP em uma dada imagem. Identificar migrando EPDC como GFP pocélulas sitive localizados dentro ou fora da membrana basal subepicárdico ColIV. Determinar a percentagem de migração de células de GFP, como o número de células positivas para GFP migrar sobre o número total de células positivas para GFP em uma dada imagem. Os resultados típicos são mostrados na Figura 3C-D, utilizando microscopia confocal invertido.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

O epicárdio pode ser eficazmente isolados utilizando um ensaio de cultura de crescimento, tirando partido da sua localização exterior e explorando a plasticidade do desenvolvimento e do comportamento migratório intrínseca de EPDC. Corações embrionárias murinas são isolados em E11.5 antes EMT epicárdico e o lado dorsal para baixo cultivadas em lâminas de câmaras revestidas com colagénio 26 (Figura 1A, B). corações explantados continuará a se contrair; No entanto, o epicárdio irá aderir à matriz de colagénio e migrar fora do miocárdio dentro de 24 horas da cultura (Figura 1C). Células do epicárdio pode ser observado que emanam para fora do coração com morfologia de calçada semelhante, indicativa da identidade mesotelial (Figuras 1C-E). Após 24 horas de cultura, corações empobrecido-epicárdio são removidos para análise gene ou proteína expressão.

Além de observar epithelimorfologia ai, a pureza das culturas de células do epicárdio pode ser adicionalmente validado pela expressão de marcadores de genes e proteínas do epicárdio restritos. Explantes celulares epicárdio exibir expressão robusta de marcadores do epicárdio e mesoteliais (ALDH1A2, Tcf21 e WT1) e baixa expressão de genes de cardiomiócitos (Nkx2-5 e MYH7) em comparação com corações empobrecido-epicárdio (Figura 2A). Para comprovar a identidade, culturas de células do epicárdio são fixas 48 horas após a remoção do coração e co-corados com anticorpos contra o tumor de Wilms 1 (WT1) e zona occludens proteína 1 (ZO1) para rotular células mesoteliais e junções apertadas intercelulares, respectivamente 37,38 ( A Figura 2B). Este método de cultura de crescimento produz uma pureza relativamente elevada de células mesoteliais; no entanto, os usuários podem observar uma pequena porcentagem de contaminação celular. Fibroblastos e células musculares lisas exibem um fenótipo mesenquimal alongada com uma notável ausência de NucleAR WT1 e junções apertadas organizados (Figura 2C). Solução de problemas técnicas para limitar a quantidade de contaminação de células não-epicárdica são expandidas na discussão.

O ensaio de explante excrescência é um sistema de cultura útil para interrogar epicárdico biologia in vitro. Para demonstrar a plasticidade de células do epicárdio, os explantes foram estimuladas com TGF-β1 [10 ng / mL] para induzir a transdiferenciação de células mesenquimais em 26,28. Após 24 h de estimulação, EPDC adoptar um fenótipo mesenquimal com coloração ZO1 reduzida e robusta formação de novo de fibras musculares lisas a-actina positivas stress (ACTA2 ou SMA), em particular na periferia da cultura 39 (Figura 2D, vermelho). Em contraste com a tensão de montagem de fibra na periferia do explante, as células do epicárdio confluentes com contactos intercelulares mais definidas (ZO1, verde) no centro de um monolayea expressão da proteína ACTA2 visor r em actina cortical.

Além de sofrer EMT, EPDC vai invadir o miocárdio e diferenciar, constituindo uma proporção substancial de populações não-cardiomiócitos. A motilidade do EPDC pode ser avaliada in vivo utilizando um sistema de cultura estabelecido anteriormente ex órgão no qual o exterior do E12.5 corações são rotulados com um adenovirus expressando GFP 9,18 (Figura 3A). corações marcadas são ainda cultivadas durante três dias na presença de TGF-β1 [10 ng / ml] e PDGF-BB [20 ng / mL] de promover a migração EPDC. Culturas de órgãos são periodicamente girado para impedir a adesão ex vivo de corações para a superfície de placas de cultura. Este sistema permite a rotulagem eficiente de toda a epicárdio e avaliação da motilidade EPDC em um modelo tridimensional em oposição a migração direcional com ensaios in vitro de zero. A migração de EPDC é observed como a invasão de células do epicárdio GFP positivas para dentro ou para além do ColIV (vermelho) da membrana basal subepicárdico 16 (Figuras 3B e C). Para ilustrar a utilidade do presente sistema, que demonstraram recentemente que a manipulação do eixo de sinalização MRTF / SRF pode influenciar a motilidade do EPDC 9. Supressão de Mrtfa e Mrtfb por excisão mediada por Cre de alelos floxed (MRTFdKO) atenua a migração de EPDC no espaço subepicárdico. Por outro lado, a expressão de MRTF-A (Ad / MRTF-A), em ratinhos C57BL / 6 corações resulta num aumento da migração e EPDC ruptura da membrana basal ColIV (Figuras 3C, D) forçado.

Gene para a frente Reverso Acesso NCBI
ALDH1A2 GGCACTGTGTGGATCAACTG TCACTTCTGTGTACGCCTGC NM_009656
GAPDH CGTGCCGCCTGGAGAAAC TGGGAGTTGCTGTTGAAGTCG NM_001289726
MYH7 GTGGCTCCGAGAAAGGAAG GAGCCTTGGATTCTCAAACG NM_080728
Nkx2-5 GACGTAGCCTGGTGTCTCG GTGTGGAATCCGTCGAAAGT NM_008700
Tcf21 CATTCACCCAGTCAACCTGA CCACTTCCTTCAGGTCATTCTC NM_011545
WT1 ATCCGCAACCAAGGATACAG GGTCCTCGTGTTTGAAGGAA NM_144783

Tabela 1: Sequências de forward e reverse primers utilizados para a Validação de Epicárdica Conseqüência Cultura Pureza por Análise de Epicárdio e Gene Restricted Miocárdio Expressão A expressão genética é determinada pela wi qRT-PCR.th os seguintes parâmetros: desnaturação a 95 ° C durante 10 seg; recozimento a 60 ° C durante 30 seg; repetir ciclos de 50x.

figura 1
Figura 1: Isolamento de células primárias epicárdico com uma Cultura Ensaio Conseqüência (A) Representação esquemática do ensaio de crescimento do explante epicárdico com uma linha de tempo recomendado para a modulação e a análise do epicárdio.. (B - E) imagens de campo claro representativos de vários pontos do tempo durante o ensaio de explante. (B) embrionário E11.5 dia corações de murino são colocados lado dorsal para baixo sobre um substrato de colagénio. Células (C) epicárdicas (setas brancas) vão começar a migrar fora do coração dentro de 3-4 horas de cultura. As células do sangue (setas pretas) pode acumular-se nas proximidades ou cobrir explantes durante a excrescência do epicárdio. (D, E) Depoiscerca de 24 horas de cultura, corações são removidos e monocamadas epicárdio permanece aderida ao slide câmara. outgrowths celulares exibir morfologia epitelial com um arranjo de paralelepípedos-like de células. Barras de escala = 250 mm (BD) ou 50 mm (C, E). H = coração, LA = átrio esquerdo, LV = ventrículo esquerdo, OFT = via de saída, RA = átrio direito, RV = ventrículo direito. Por favor clique aqui para ver uma versão maior desta figura.

Figura 2
Figura 2: Avaliação da epicárdica celular Conseqüência Pureza (A) validação qRT-PCR do epicárdio restrito marcadores (Tcf21, ALDH1A2, e WT1) em culturas de crescimento em comparação com a expressão do gene do miocárdio (Nkx2-5 e MYH7) no E11 empobrecido-epicárdio.. 5 corações. represen dadost a média ± SEM (n = 8 por grupo). Os asteriscos indicam significância estatística usando um teste t de Student com **** P <0,0001. (B) coloração co-imunofluorescência Representante da outgrowths não estimuladas para a expressão do epicárdio (WT1, vermelho), junções apertadas intercelulares (ZO1, verde) e núcleos (DAPI, azul). (C) Um exemplo de contaminação de células numa cultura de crescimento. Células do epicárdio (asterisco) são observados para a direita do painel com a identidade característica mesotelial (WT1 nuclear, vermelho) e organizados junções apertadas epiteliais (ZO1, verde). As células adjacentes no centro (setas brancas) exibem uma morfologia mesenquimal alongada, mostrada por imagem de contraste de interferência diferencial (DIC), com o mínimo de proteína WT1 nuclear e coloração ZO1 desorganizada. (D) as culturas de células foram estimuladas com epicárdicas veículo (HCl 4 mM em 1 mg / ml de BSA) ou TGF-β1 [10 ng / mL] para induzir epicárdicoEMT. a estimulação de TGF-β1 promove a expressão robusta de ACTA2 (vermelho) em regiões corticais de células confluentes no centro de explantes ou em fibras de stress de células que migram na borda ou periferia da monocamada. adesões celulares são marcados por ZO1 (verde). Barras de escala = 25 mm (BD). Por favor clique aqui para ver uma versão maior desta figura.

Figura 3
Figura 3: Ex Vivo Avaliação do EPDC Motilidade (A) Uma linha de tempo esquemática do ensaio de cultura ex vivo do coração.. (B) Um representante 5 um corte de um C57BL / 6 E12.5 coração transduzidas com Ad / GFP (verde) durante 24 horas para marcar o exterior do coração. Ex vivo corações foram subsequentemente cultivadas durante um adicional de 48 h com TGF- β1 [10 ng / ml]e PDGF-BB [20 ng / mL] para estimular a migração EPDC. Os cortes foram co-corados para ColIV (vermelho) para rotular a membrana basal subepicárdica e núcleos (DAPI, azul). Ex vivo coração morfologia cultura é mostrado pelo DIC. LV = ventrículo esquerdo, RV = ventrículo direito, RA = átrio direito. (C, D) Um exemplo de aplicação do ensaio in vivo de ex migração através da modulação do eixo reguladora MRTF / SRF. Esta figura foi modificado a partir de [9]. Corações E12.5 foram isolados a partir Mrtfa - / -;. Mrtfb fl / fl embriões e transduzidas com Ad / GFP e um vírus de controlo ou um adenovírus que expressa a recombinase Cre, durante 24 h ex vivo culturas foram então estimuladas com TGF-β1 [10 ng / ml] e PDGF-BB [20 ng / mL] para uma 48 horas adicionais. EPDC motilidade (setas brancas) é observado como a migração de células GFP positivas (verde) para dentro ou para fora do ColIV (vermelho). Exclusão de Mrtfb Cre-mediada na <em> Mrtfa - / - fundo (MRTFdKO) resulta em atenuação da migração EPDC relação ao controle corações. Por outro lado, forçado expressão de MRTF-A (Ad / MRTF-A) em E12.5 C57BL / 6 corações aumenta a migração EPDC. (D) A quantificação da% de migração de células positivas para GFP. Os dados são apresentados como a média ± SEM (n = 4 corações para cada condição). Os dados foram analisados ​​usando um one-way ANOVA com asteriscos que denota significância estatística por testes post-hoc de Tukey com **** P <0,0001. Barras de escala = 200 um (B) ou 25 um (C). Todas as imagens foram obtidas por microscopia de varredura a laser confocal invertido. Por favor clique aqui para ver uma versão maior desta figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Aqui destacamos métodos detalhados para isolar células do epicárdio primária por conseqüência e controlar a migração EPDC em ex vivo culturas cardíacos. Para as culturas conseqüência, o tempo apropriado para remover o coração empobrecido-epicárdio varia ligeiramente entre os experimentos. A monitorização periódica dos explantes após uma incubação durante a noite é recomendado para avaliar a extensão da excrescência do epicárdio e para extrair o coração diante de fibroblastos aparecer. Para garantir a pureza, corações deve ser removido dentro de 24 horas de explante para evitar a acumulação de linhagens não-epicárdio. Aparamento de distância da via de saída e ambos os átrios antes de transferir o coração para um slide câmara também pode reduzir contaminantes tipos de células 27,40. Uma vez que corações fetais são isolados a partir de uma ninhada de rato durante um período de tempo limitado e cultivadas sob as mesmas condições, o tempo de excrescências a aparecer é relativamente semelhante de um coração para outro dentro de uma experiência. Portanto, todos os corações se be removido quando a maioria dos explantes exibem excrescências epicárdio. Em alguns casos, as células do epicárdio não migram de forma eficiente a partir de um coração que está se contraindo de forma mais vigorosa do que os outros, caso em que este explante devem ser excluídos do experimento.

A acumulação de células do sangue muitas vezes pode esconder uma monocamada plana de células do epicárdio (setas, Figura 1C), tornando-o difícil de visualizar excrescências. Para evitar a contribuição de células de sangue excessiva, corações pode permanecer em HBSS durante alguns minutos após dissecação do embrião. Isto permite tempo suficiente para que o coração fetal para bombear o sangue residual nas câmaras cardíacas, antes de ser transferido para uma lâmina de câmara. Alternativamente, completando as culturas com meio explante A após a primeira incubação durante a noite irá ajudar a lavar afastado algum excesso de sangue e revelar outgrowths; No entanto, o nível de meios não deve subir acima do coração como a tensão superficial pode fazer com que o coraçãoa afastar-se do substrato. outgrowths epicárdio robustos são observados usando colágeno tipo I como o substrato de cultura; No entanto, outros substratos foram relatados dependendo do organismo e / ou a aplicação 27,40-42. Usando este protocolo, as células do epicárdio fetais primários pode prosperar por 4 dias após a remoção do coração e reposição média diária; no entanto, modelos experimentais que necessitam de longos períodos de cultura deve ser determinada pelo utilizador final. Desde EMT epicárdica é fortemente activado durante o desenvolvimento embrionário, este técnica de cultura em crescimento é limitado para o enriquecimento de células fetais do epicárdio. Outros grupos têm descrito métodos para isolar adultas células do epicárdio 43,44.

Para ex vivo ensaios de migração, extração de coração e de rotulagem de células do epicárdio são recomendados em E12.5 por duas razões. Em primeiro lugar, os corações isolados após E12.5 são maiores e, portanto, requerem mais de perfusão para suportar a viabilidade. A difusão simples de nutrientes não é suficiente para manter culturas de órgãos de corações maiores. Em segundo lugar, EMT epicárdico e migração EPDC ocorrer em torno E12.5. Portanto, o epicárdio deve ser marcado com um adenovírus que expressa uma proteína fluorescente imediatamente após a extracção do coração para maximizar a detecção de EPDC. Alternativamente, o éster de succinimidilo diacetato de carboxifluoresceína (CFSE) foi previamente relatada para rotular o exterior do coração e rastrear EPDC migração 10,45.

Em contraste com ensaios de crescimento, ex vivo as culturas devem ser balançado periodicamente para evitar a penhora coração e crescimento de células do epicárdio. Culturas também pode ser agitado continuamente em uma incubadora equipado com uma cadeira de balanço na configuração de velocidade mais baixa. Os utilizadores irão notar alterações na morfologia cardíaca dentro de alguns dias de cultura de órgãos e deve evitar análises para além de 72 horas de isolamento coração. Usando este ensaio, EPDC invasão é observado dentro de 48 a 72 horas de cultura. Enquanto o sistema Cre-loxPtem sido utilizado in vivo para mapear a localização de EPDC à vasculatura coronária, o interstício miocárdio, e o septo interventricular 7,22, esta técnica ex vivo, limita-se a migração EPDC dentro de poucas camadas celulares do espaço sub-epicárdico. Assim, este método é mais adequado para determinar os reguladores de EPDC motilidade e invasão em vez de definir o destino final da migração EPDC.

Isolamentos de células do epicárdio e ex vivo ensaios de migração, em combinação com ganho ou perda de abordagens de função, já provaram úteis para avaliar genes candidatos que podem afetar EPDC biologia 9,18,46. Estes métodos também fornecer uma plataforma para o ganho de função ou telas de perda de função para identificar novos reguladores da migração EPDC. Esta estratégia, em conjunto com fluorescência activado separação de células ou célula de RNA-sequenciamento único, também pode constituir uma oportunidade para sondar a heterogeneidade do epicárdioe diferenciação EPDC em maior detalhe. Finalmente, as modificações destes processos pode ser utilizado para desenvolver telas para pequenas moléculas que têm impacto sobre células do epicárdio e EPDC biologia para fins de medicina regenerativa cardíaca.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Os autores não têm nada a revelar.

Acknowledgements

EMS foi apoiado por bolsas de Institutos Nacionais de Saúde (NIH) [número de concessão R01HL120919]; a American Heart Association [número de concessão 10SDG4350046]; Universidade de Rochester prêmio CTSA do NIH [número de concessão UL1 TR000042]; e os fundos de inicialização do Aab CVRI. MAT foi apoiado em parte por uma bolsa para a Universidade de Rochester Faculdade de Medicina e Odontologia da Med Into--Grad Iniciativa Howard Hughes Medical Institute; e um Prêmio de Serviço Institucional Ruth L. Kirschstein Nacional de Pesquisa do NIH [número de concessão GM068411].

Materials

Name Company Catalog Number Comments
Dulbecco's Modified Eagle Medium Hyclone  SH3002201 DMEM
Hanks' Balanced Salt Solution Hyclone SH3003102 HBSS
Medium 199 Hyclone SH3025301 M199
Dulbecco’s Phosphate-Buffered Saline  Hyclone SH3002802 DPBS
Fetal Bovine Serum  Gemini  100-106 FBS
Penicillin/Streptomycin Solution Hyclone SV30010
Corning Biocoat Collagen I, 4-Well Culture Slides Corning 354557
Multiwell 24-well plates Falcon 08-772-1
Dissecting microscope Leica M50 Equipped with Leica KL300 LED might source
Confocal miscroscope Olympus 1X81 Equipped with muli-argon laser 405/488/515, FV10-MCPSU laser 405/440/635, 559 laser, and mercury lamp
Bioruptor Diagenode  UCD-200
Transforming growth factor beta 1 R&D Systems 100-B-001 TGF-β1
Platelet-derived growth factor BB R&D Systems 220-BB-010 PDGF-BB
Trizol Reagent Applied Biosystems 15596-026 Caution, hazardous material
TURBO DNA-free Kit Life Technologies AM1907 DNaseI
iScript cDNA Synthesis Kit BioRad 1708891
UltraPure Glycogen Life Technologies 10814-010
SYBR Green BioRad 170-8880
Protease inhibtor cocktail tablets Roche 11836170001
Alexa Goat-anti-rabbit 488 Life Technologies A11008 Secondary antibody
Alexa Goat anti-rabbit 594 Life Technologies A-11012 Secondary antibody
Alexa Goat anti-mouse 594 Life Technologies A-11005 Secondary antibody
Mouse anti-smooth muscle alpha actin, Cy3-conjugated  Sigma-Aldrich C6198 monoclonal antibody, clone 1A4
Mouse anti-Wilms tumor 1 (WT1) Life Technologies MA1-46028 monoclonal antibody, clone 6F-H2
Rabbit anti-ZO1 Life Technologies 40-2200 polyclonal antibody
Rabbit anti-Collagen Type 4 Millipore AB756P polyclonal antibody
4',6-Diamidino-2-Phenylindole, Dihydrochloride  Life Technologies D1306 DAPI
Fluorescent mounting medium  DAKO S3023
16% Paraformaldehyde solution Electron Microscopy Sciences 15710 PFA diluted to 4% in DPBS. Caution, hazardous material
Sucrose Sigma-Aldrich S0389
Tissue Freezing Medium Triangle Biomedical Sciences TFM-B
Pap pen DAKO S2002
Disposable mictrotome blades  Sakura Finetek 4689
Microscope slides Globe Scientific 1358W positively charged, 25 mm x 75 mm x 1 mm
Cryostat  Leica CM1950
Forceps Fine Science Tools 11295-00
Surgical Scissors Fine Science Tools 91460-11
Disposable base molds Fisher Scientific 22-363-553
Ketamine Hospira NDC 0409-2051-05
Xylazine Akorn NADA 139-236

DOWNLOAD MATERIALS LIST

References

  1. von Gise, A., Pu, W. T. Endocardial and epicardial epithelial to mesenchymal transitions in heart development and disease. Circ Res. 110, 1628-1645 (2012).
  2. Martinez-Estrada, O. M., et al. Wt1 is required for cardiovascular progenitor cell formation through transcriptional control of Snail and E-cadherin. Nat Genet. 42, 89-93 (2010).
  3. Gittenberger-de Groot, A. C., Vrancken Peeters, M. P., Mentink, M. M., Gourdie, R. G., Poelmann, R. E. Epicardium-derived cells contribute a novel population to the myocardial wall and the atrioventricular cushions. Circ Res. 82, 1043-1052 (1998).
  4. Katz, T. C., et al. Distinct compartments of the proepicardial organ give rise to coronary vascular endothelial cells. Dev Cell. 22, 639-650 (2012).
  5. Mikawa, T., Gourdie, R. G. Pericardial mesoderm generates a population of coronary smooth muscle cells migrating into the heart along with ingrowth of the epicardial organ. Dev Biol. 174, 221-232 (1996).
  6. Wilm, B., Ipenberg, A., Hastie, N. D., Burch, J. B., Bader, D. M. The serosal mesothelium is a major source of smooth muscle cells of the gut vasculature. Development. 132, 5317-5328 (2005).
  7. Zhou, B., et al. Epicardial progenitors contribute to the cardiomyocyte lineage in the developing heart. Nature. 454, 109-113 (2008).
  8. Dettman, R. W., Denetclaw, W., Ordahl, C. P., Bristow, J. Common epicardial origin of coronary vascular smooth muscle, perivascular fibroblasts, and intermyocardial fibroblasts in the avian heart. Dev Biol. 193, 169-181 (1998).
  9. Trembley, M. A., Velasquez, L. S., de Mesy Bentley, K. L., Small, E. M. Myocardin-related transcription factors control the motility of epicardium-derived cells and the maturation of coronary vessels. Development. 142, 21-30 (2015).
  10. Mellgren, A. M., et al. Platelet-derived growth factor receptor beta signaling is required for efficient epicardial cell migration and development of two distinct coronary vascular smooth muscle cell populations. Circ Res. 103, 1393-1401 (2008).
  11. von Gise, A., et al. WT1 regulates epicardial epithelial to mesenchymal transition through beta-catenin and retinoic acid signaling pathways. Dev Biol. 356, 421-431 (2011).
  12. Lavine, K. J., et al. Endocardial and Epicardial Derived FGF Signals Regulate Myocardial Proliferation and Differentiation In Vivo. Dev Cell. 8, 85-95 (2005).
  13. Sanchez, N. S., Barnett, J. V. TGFbeta and BMP-2 regulate epicardial cell invasion via TGFbetaR3 activation of the Par6/Smurf1/RhoA pathway. Cell Signal. 24, 539-548 (2012).
  14. Dettman, R. W., Pae, S. H., Morabito, C., Bristow, J. Inhibition of 4-integrin stimulates epicardial-mesenchymal transformation and alters migration and cell fate of epicardially derived mesenchyme. Dev Biol. 257, 315-328 (2003).
  15. Rhee, D. Y., et al. Connexin 43 regulates epicardial cell polarity and migration in coronary vascular development. Development. 136, 3185-3193 (2009).
  16. Wu, M., et al. Epicardial spindle orientation controls cell entry into the myocardium. Dev Cell. 19, 114-125 (2010).
  17. Hirose, T., et al. PAR3 is essential for cyst-mediated epicardial development by establishing apical cortical domains. Development. 133, 1389-1398 (2006).
  18. Baek, S. T., Tallquist, M. D. Nf1 limits epicardial derivative expansion by regulating epithelial to mesenchymal transition and proliferation. Development. 139, 2040-2049 (2012).
  19. Lu, J., et al. Coronary smooth muscle differentiation from proepicardial cells requires rhoA-mediated actin reorganization and p160 rho-kinase activity. Dev Biol. 240, 404-418 (2001).
  20. Combs, M. D., Braitsch, C. M., Lange, A. W., James, J. F., Yutzey, K. E. NFATC1 promotes epicardium-derived cell invasion into myocardium. Development. 138, 1747-1757 (2011).
  21. Acharya, A., et al. The bHLH transcription factor Tcf21 is required for lineage-specific EMT of cardiac fibroblast progenitors. Development. 139, 2139-2149 (2012).
  22. Zhou, B., von Gise, A., Ma, Q., Hu, Y. W., Pu, W. T. Genetic fate mapping demonstrates contribution of epicardium-derived cells to the annulus fibrosis of the mammalian heart. Dev Biol. 338, 251-261 (2010).
  23. Zhou, B., et al. Adult mouse epicardium modulates myocardial injury by secreting paracrine factors. J Clin Invest. 121, 1894-1904 (2011).
  24. Singh, M., Epstein, J. Epicardial Lineages and Cardiac Repair. Journal of Developmental Biology. 1, 141-158 (2013).
  25. Braitsch, C. M., Combs, M. D., Quaggin, S. E., Yutzey, K. E. Pod1/Tcf21 is regulated by retinoic acid signaling and inhibits differentiation of epicardium-derived cells into smooth muscle in the developing heart. Dev Biol. 368, 345-357 (2012).
  26. Austin, A. F., Compton, L. A., Love, J. D., Brown, C. B., Barnett, J. V. Primary and immortalized mouse epicardial cells undergo differentiation in response to TGFbeta. Developmental dynamics : an official publication of the American Association of Anatomists. 237, 366-376 (2008).
  27. Kim, J., Rubin, N., Huang, Y., Tuan, T. L., Lien, C. L. In vitro culture of epicardial cells from adult zebrafish heart on a fibrin matrix. Nat Protoc. 7, 247-255 (2012).
  28. Compton, L. A., Potash, D. A., Mundell, N. A., Barnett, J. V. Transforming growth factor-beta induces loss of epithelial character and smooth muscle cell differentiation in epicardial cells. Developmental dynamics : an official publication of the American Association of Anatomists. 235, 82-93 (2006).
  29. Smith, C. L., Baek, S. T., Sung, C. Y., Tallquist, M. D. Epicardial-derived cell epithelial-to-mesenchymal transition and fate specification require PDGF receptor signaling. Circ Res. 108, 15-26 (2011).
  30. Shea, K., Geijsen, N. Dissection of 6.5 dpc Mouse Embryos. JOVE. 2, (2007).
  31. Witty, A. D., et al. Generation of the epicardial lineage from human pluripotent stem cells. Nature biotechnology. 32, 1026-1035 (2014).
  32. Iyer, D., et al. Robust derivation of epicardium and its differentiated smooth muscle cell progeny from human pluripotent stem cells. Development. 142, 1528-1541 (2015).
  33. Takeichi, M., Nimura, K., Mori, M., Nakagami, H., Kaneda, Y. The transcription factors Tbx18 and Wt1 control the epicardial epithelial-mesenchymal transition through bi-directional regulation of Slug in murine primary epicardial cells. PloS one. 8, e57829 (2013).
  34. Wong, M. L., Medrano, J. F. Real-time PCR for mRNA quantitation. BioTechniques. 39, 75-85 (2005).
  35. Schmittgen, T. D., Livak, K. J. Analyzing real-time PCR data by the comparative CT method. Nature Protocols. 3, 1101-1108 (2008).
  36. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical biochemistry. 72, 248-254 (1976).
  37. Moore, A. W., McInnes, L., Kreidberg, J., Hastie, N. D., Schedl, A. YAC complementation shows a requirement for Wt1 in the development of epicardium, adrenal gland and throughout nephrogenesis. Development. 126, 1845-1857 (1999).
  38. Kim, J., et al. PDGF signaling is required for epicardial function and blood vessel formation in regenerating zebrafish hearts. Proc Natl Acad Sci U S A. 107, 17206-17210 (2010).
  39. Kalluri, R., Weinberg, R. A. The basics of epithelial-mesenchymal transition. J Clin Invest. 119, 1420-1428 (2009).
  40. Dong, X. R., Maguire, C. T., Wu, S. P., Majesky, M. W. Chapter 9 Development of Coronary Vessels. Methods in Enzymology. 445, 209-228 (2008).
  41. Ruiz-Villalba, A., Ziogas, A., Ehrbar, M., Perez-Pomares, J. M. Characterization of epicardial-derived cardiac interstitial cells: differentiation and mobilization of heart fibroblast progenitors. PLoS One. 8, e53694 (2013).
  42. Garriock, R. J., Mikawa, T., Yamaguchi, T. P. Isolation and culture of mouse proepicardium using serum-free conditions. Methods. 66, 365-369 (2014).
  43. Smart, N., Riley, P. Derivation of epicardium-derived progenitor cells (EPDCs) from adult epicardium. Curr Protoc Stem Cell Biol. (2009).
  44. Zhou, B., Pu, W. T. Isolation and characterization of embryonic and adult epicardium and epicardium-derived cells. Methods Mol Biol. 843, 155-168 (2012).
  45. Morabito, C. J., Dettman, R. W., Kattan, J., Collier, J. M., Bristow, J. Positive and negative regulation of epicardial-mesenchymal transformation during avian heart development. Dev Biol. 234, 204-215 (2001).
  46. Grieskamp, T., Rudat, C., Ludtke, T. H., Norden, J., Kispert, A. Notch signaling regulates smooth muscle differentiation of epicardium-derived cells. Circ Res. 108, 813-823 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics