Epikardiale Outgrowth Kulturtest und

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Trembley, M. A., Velasquez, L. S., Small, E. M. Epicardial Outgrowth Culture Assay and Ex Vivo Assessment of Epicardial-derived Cell Migration. J. Vis. Exp. (109), e53750, doi:10.3791/53750 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Eine einzelne Schicht aus epikardialen Zelllinien das Herz, parakrine Faktoren, die die Bereitstellung von Kardiomyozyten Proliferation stimulieren und Herz-Kreislauf-Vorläufern während der Entwicklung und Krankheit direkt beitragen. Während eine Anzahl von Faktoren in Epikard abgeleitete Zelle (EPDC) Mobilisierungs gebracht wurde, werden die Mechanismen ihrer späteren Migration und Differenzierung regeln schlecht verstanden. Hier stellen wir in vitro und ex vivo - Strategien EPDC Motilität und Differenzierung zu studieren. Zunächst beschreiben wir ein Verfahren zur primären epikardialen Zellen durch Auswachsen aus der Kultur embryonaler Mäuseherzen erhalten. Außerdem stellen wir ein detailliertes Protokoll dreidimensionale Migration von markierten EPDC in einem Organkultursystem zu bewerten. Wir bieten Beweise für diese Techniken, die genetische Deletion von myocardin bezogenen Transkriptionsfaktoren im Epikard EPDC Migration abschwächt. Dieser Ansatz dient als Plattform Kandidat Modifikatoren der EPDC zu bewertenBiologie und könnte verwendet werden, genetische oder chemische Bildschirme zu entwickeln neuartigen Regulatoren der EPDC Mobilisierung zu identifizieren, die für die Herzreparatur nützlich sein könnten.

Introduction

Das Epikard ist eine einzelne Schicht aus Mesothelzellen, die Linien das Herz und die Auswirkungen Herz Entwicklung, Reifung und Reparatur. Durch eine hoch koordinierten Austausch von parakrine Signale ist die innige Dialog zwischen dem Myokard und Epikard unverzichtbar für kardiale Wachstum und der Bildung von Nicht-Myozyten - Herzabstammungslinien 1. Epikardiale abgeleiteten Zellen (EPDC) ergeben sich aus einer Untergruppe von epikardialen Zellen durch eine epitheliale zu mesenchymale Transition (EMT) 2, dringen in den subepikardialen Raum und das darunter liegende Myokard und unterscheiden weitgehend in koronaren Gefäßwandzellen und kardialen Fibroblasten, und ein geringerem Maße, Endothelzellen und Kardiomyozyten 3-9.

Die Regulierungsmechanismen epikardialen EMT und EPDC Invasion haben die koordinierte Aktion verschiedener Moleküle einschließlich sezerniert Liganden 10-13, Zelloberflächenrezeptoren und Adhäsionsmoleküle 14,15, regel zugeschrieben wordenToren der apikal-basale Polarität 16,17, kleine GTPasen 18,19 und Transkriptionsfaktoren 2,20,21. Während viele der molekularen Effektoren der EPDC Migration definiert wurden, ein besseres Verständnis der physiologischen Signale, die EPDC Mobilisierung im Embryo stimulieren kann die Entwicklung von Strategien beschleunigen diesen Prozess bei Erwachsenen für eine verbesserte Herz-Reparatur zu manipulieren.

Ziel Studien neue Regulatoren der EPDC Mobilisierung zu identifizieren, verlassen sich auf die Reinigung von dieser Zellpopulation oder die Migration einzelner epikardialen Zellen zu verfolgen. Eine oder eine Kombination von Markergenen, einschließlich Wt1, Tcf21, Tbx18 und / oder Aldh1a2, wird üblicherweise um die fötale Epikard 1 zu identifizieren. die Verwendung dieser Marker jedoch zu verfolgen EPDC Migration nicht optimal ist, als Ausdruck der epikardialen Markierungen im Laufe der Herzentwicklung nachlässt und wird oft verloren, wenn epikardialen Zellen transdif laufenferenzierung in mesenchymalen Zellen.

Die Anwendung des Cre / loxP - System in Verbindung mit lineage-Tracing - Reporter wurde in permanent Markierung des Epikard und seine Abkömmlinge während Herzentwicklung und nach ischämischer Verletzung im erwachsenen 7,22,23 nützlich. Mehrere epikardialen beschränkten Cre Linien wurden 1 erzeugt und verwendet werden , weit EPDC und für die bedingte Gen - Deletion Strategien zu beschriften. Diese Studien haben die Charakterisierung verschiedener Abstammungen epikardialen geführt, und die Identifizierung von kritischen Mediatoren von EPDC Motilität und Differenzierung. Allerdings akkumulieren Hinweise darauf , auch die Epikard eine heterogene Population von Vorläuferzellen 4,24,25 ist. Somit wird nur eine Teilmenge von epikardialen Zellen gerichtet werden, um einen gegebenen Cre-Treiber.

Um die gesamte Epikard unabhängig von Cre Spezifität, eine Reihe von Labors zu beschriften haben Auswuchs cul genutztture Systeme oder ex - vivo - Verfahren der Organkultur zu epikardialen Zellen treu zu isolieren oder zu beschriften , ohne in Abhängigkeit von der Expression eines genetischen Abstammungslinie Marker 26-28. Für die Ex - vivo - Migrationsstudien, sind embryonale Herzen vor dem epikardialen EMT und in Medium mit einem grün fluoreszierenden Protein (GFP) exprimierenden Adenovirus (Ad / GFP) 9,18 ergänzt isoliert. Dieser Ansatz ermöglicht eine effiziente Markierung des gesamten Epikard eher als eine Untergruppe von Zellen, die durch Cre-vermittelte Rekombination. Herz - Kulturen werden anschließend mit bekannten Induktoren von EMT ausgesetzt , um die Mobilisierung von EPDC 28,29 zu stimulieren. Ex - vivo und in - vivo - Analysen werden ergänzt durch in vitro epikardialen Explantation Kulturen, die sind ein besonders nützlicher Ansatz für die Erkundung detaillierten Mechanismen der Fahrt EPDC Migration.

Hier beschreiben wir Verfahren zur Isolierung von primären epikardialen Zellen für in vitro - Studien von epicardial EMT sowie ein Organkultursystem für die ex vivo - Analysen von EPDC Motilität. Wir haben vor kurzem gezeigt , den Nutzen und die Robustheit dieser Methode durch genetisch die myocardin-related transcription factor Modulation (MRTF) / Serum Response Factor (SRF) Signalisierungsachse 9 Aktin-basierte Migration von EPDC zu manipulieren. Während unsere Ergebnisse notwendig für die Regulierung EPDC Migration eines Signalwegs zu markieren, sind diese Verfahren geeignet ist, die Mechanismen zu entwirren, die gemeinsam EPDC Migration und Differenzierung zu orchestrieren. Darüber hinaus könnte das Explantat und ex vivo - Kultursystemen in Funktionsbildschirme implementiert werden , um neue Regulatoren der EPDC Mobilisierung für therapeutische Anwendungen in der Herzregeneration zu identifizieren.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

HINWEIS: Alle Experimente mit Mäusen von der Universität Ausschuss für Tier Ressourcen an der Universität von Rochester genehmigt.

1. Epicardial Outgrowth Kulturassay (1A)

  1. Die Vorbereitungen
    1. Bereiten Sie 5 ml Medium A für die primäre epikardialen Zellisolierung durch Ergänzung Medium 199 (M199) mit 5% fötalem Rinderserum (FBS) und 1% Penicillin / Streptomycin (Pen / Strep).
    2. Vorwärmen Medium A und 100 ml Hanks 'Balanced Salt Solution (HBSS) in einem 37 ° C Wasserbad °.
    3. Erlauben kollagenbeschichtete chamber slides für 30 min auf Raumtemperatur erwärmen.
    4. 100 l Medium A in jede Vertiefung der Kammer Rutsche und sanft drehen, um die Kollagenoberfläche gleichmäßig zu beschichten. Wiederholen Sie dies für 8-12 Brunnen. Entfernen Sie das Medium nach dem Beschichtungskammern.
    5. Aliquot vorgewärmte HBSS in zwei 10 cm 2 Platten mit jeweils 50 ml HBSS.
  2. Isolieren Embryonale Herzen von schwangeren Mutter auf 11,5 Tage post coitum (DPC).30
    1. Anästhesieren Maus mit 0,5 ml von 13 mg / ml Ketamin / 0,88 mg / ml Xylazin Cocktail in 1x Dulbecco-Phosphat-gepufferter Saline (DPBS) über intraperitoneale Injektion. Bestätigen Sie die richtige anesthetization einen Zeh Prise Test. Eine sanfte pinch ist ausreichend, um zu bestimmen, ob die Maus anspricht. Jede Bewegung oder Pfote zurückzuziehen zeigt das Tier nicht ausreichend zu tun Operation narkotisiert. Euthanize durch zervikale Dislokation.
    2. Legen Sie die Maus Bauchseite nach oben und sprühen Sie den Bauch mit 70% Ethanol Kontamination durch Haare zu reduzieren.
    3. Drücken Sie die Haut mit einer Pinzette und schneiden einen seitlichen Schnitt am Bauch mit chirurgischen Schere. Halten Sie die Haut fest und ziehen Sie dann auseinander Richtungen in Richtung Kopf und Schwanz in entgegenwirkt.
    4. Pinch das Peritoneum mit einer Zange und Schneiden mit einer Schere in die Bauchhöhle zu belichten.
    5. Entfernen Sie vorsichtig die Decidua entlang der Mesometrium durch Schneiden. Übertragen Sie die seziert Decidua auf vorgewärmt HBSS im ersten10 cm 2 - Platte.
    6. Trennen Sie die Decidua von zwischen Embryonen zu schneiden.
    7. Übertragen eines Embryos in die zweite 10 cm 2 - Platte mit vorgewärmter HBSS unter einem Binokular. Entfernen Sie vorsichtig die extraembryonic Gewebe und Dottersack, dann den Embryo enthaupten.
    8. Klemmen Sie die Brustwand mit einer Pinzette und reißen das Gewebe auseinander an der Mittellinie, Freilegung der Brusthöhle.
    9. Legen Sie die Zange hinter dem Herzen. Fassen Sie den Ausflusstrakt und ziehen Sie das Herz weg vom Embryo. Trennen Sie die Lungenwege und Lunge aus dem Herzen, wenn noch angebracht.
  3. Übertragen Sie das Herz auf eine einzelne Vertiefung der Kollagen-beschichteten Objektträger und legen Sie es dorsalen Seite nach unten (Abbildung 1B). Wiederholen Sie die Schritte 1.2.7-1.3 für jeden Embryo.
  4. Sobald alle Herzen zu einzelnen Vertiefungen übertragen worden ist , die Kammer inkubieren Rutsche für 30 min bei 37 ° C, 5% CO 2 ausreichende Haftung an der Kollagenmatrix zu ermöglichen.
  5. sorgfältig hinzufügen20-50 & mgr; l vorgewärmtes Medium Explantat A um jedes Herz. Wichtig: Nehmen Sie das Medium nicht addieren sich zu schnell oder zu einem Niveau oberhalb des Herzens, sonst Herzen, die von Kollagen Substrat ablösen kann.
  6. Kultur die Herzen bei 37 ° C, 5% CO 2 für ungefähr 24 Stunden epikardialen Auswuchs zu ermöglichen. Anmerkung: Auswüchse kann bereits 3-4 h der Kultur (1C) und in erster Linie besteht aus Mesothelzellen Anzeige cobblestoned Morphologie mit minimaler mesenchymale Zellkontamination (Figuren 1D, E) beobachtet werden. Repräsentative Ergebnisse wurden mit einem Präpariermikroskop mit einer Kamera ausgestattet erworben.

2. Genetische Ablation und Induktion der EMT in Epikardiale Auswüchse

Vorsicht: Behandeln Sie Adenoviren mit Sorgfalt nach anerkannten Richtlinien der biologischen Sicherheit.

  1. Bereiten Sie 15 ml Medium B (M199 mit 1% FBS und 1% Pen / Strep) und Pre-warm bis 37 ° C in einem Wasserbad.
  2. Für Exzisionfloxed Allele, bereiten Explantation Medium B , ergänzt mit 2,5 x 10 4 pfu / ml Adenovirus exprimieren Cre - Rekombinase (Ad / CRE) oder Kontrollvirus.
    Hinweis: Adenovirale vermittelte Überexpression von Kandidatengenen können auch gain of function Phänotypen zu bewerten durchgeführt werden. Virustiter sollte durch den Endverbraucher bestimmt.
  3. mit einer Pinzette vorsichtig Epikard abgereicherte Herzen aus Auswuchs Kulturen zu entfernen. Übertragen Herzen auf 1,5-ml-Röhrchen mit 800 ul Trizol und bei -80 ° C für eine spätere RNA-Isolierung und Genexpressionsanalyse.
  4. Waschen jeder Vertiefung mit DPBS Blutzellen und überschüssige Zelltrümmer zu entfernen.
  5. Hinzufügen 500 ul Explantat - Medium B mit Adenovirus ergänzt (n) zu jedem Auswachsen der Kultur und Inkubieren für 24 Stunden bei 37 ° C, 5% CO 2.
  6. Für EMT Induktion entfernen Medien und füllt mit 37 ° C Explantation Medium B ergänzt mit rekombinanten Transforming Growth Factor (TGF) -β1 [10 ng / ml] oder Vehikel (4 mM hydrochloric Säure (HCl), enthaltend 1 mg / ml Rinderserumalbumin (BSA)). Kultur Explantate für weitere 24 h bei 37 ° C, 5% CO 2. Fahren Sie mit dem Gen / Protein-Expressionsanalysen oder Immunzytochemie, wie in den nachfolgenden Protokollen beschrieben.
    Anmerkung: Die Induktion der epikardialen EMT wurde mit verschiedenen Konzentrationen von TGF-β1 im Bereich von 0,5 ng / ml stimuliert worden - 10 ng / ml 26,31-33. Höhere Konzentrationen von Liganden in unspezifischen führen kann an alle TGF-β-Rezeptoren binden. Die Konzentration von TGF-β1 sollten die spezifischen experimentellen Ziele widerspiegeln.

3. Genexpressionsanalyse von Epikardiale Auswüchse

  1. Thaw Epikard verarmten Herzen zuvor in Trizol gespeichert (2.2).
  2. Absaugen Medien aus EPDC Kulturen und waschen zweimal mit DPBS.
  3. In 800 ul Raumtemperatur Trizol Kulturen bis zur Explantation.
  4. Inkubieren Epikard abgereicherte Herzen und EPDC Kulturen in Trizol für 5 min bei Raum temperatu Re. Pipette nach oben und unten das Zehnfache der lysierten Probe zu homogenisieren.
    Hinweis: Innere weitere Pipettieren erfordern, um vollständig zu homogenisieren.
  5. Übertragen Lysate bis 1,5-ml-Röhrchen und fahren Sie mit der Gesamt-RNA Isolierung pro Anweisungen des Herstellers. In 10 ug Glykogen vor der Fällung RNA-Ausbeute zu erhöhen. Eine gegebene Explantation wird etwa 0,5 bis 1,0 & mgr; g RNA ergeben.
  6. Entfernen Sie kontaminieren DNA mit DNase I und Reverse transkribieren 0,5 ug mRNA pro Anweisungen des Herstellers.
  7. Überprüfen Sie die Reinheit der epikardialen Explantate und / oder Induktion von EMT mit quantitativen reversen Transkription (qRT) -PCR 34 mit SYBR grün und die in der Tabelle beschriebenen Marker 1. Normalisieren - mRNA - Spiegel zu Glycerinaldehyd - 3-Phosphat - Dehydrogenase (GAPDH) und berechnen relativen Expression unter Verwendung von die 2 - ΔΔCt Verfahren 35. Typische Ergebnisse sind in 2A gezeigt.
title "> 4. Protein-Analyse von Epikardiale Auswüchse

  1. Absaugen Medien aus EPDC Kulturen und waschen zweimal mit DPBS.
  2. In 10 ul eiskaltem Protein Lysepuffer (50 mM Tris pH 7,5, 150 mM Natriumchlorid, 1 mM Ethylendiamintetraessigsäure, pH 8,0, 1% Triton X-100, 1x Protease-Inhibitor-Cocktail) zu jeder Kammer gut und legen Sie die Kammer gleiten auf Eis. Schneiden Sie ca. ¼ des Bodens auf einer P200 Pipettenspitze ab und verwenden Sie das restliche Stück der Zellen aus der Folie zu kratzen. Pipette nach oben und unten zu lysieren epikardialen Zellen und in ein 1,5-ml-Röhrchen.
  3. Beschallen lysiert Explantate auf niedrig (160 W) für 5 min in einem Bad Eiswasser mit 30 Sekunden EIN und AUS-Zyklen.
  4. Zentrifuge Lysate 10 min bei 10000 · g, 4 ° C. Überstand in ein frisches Röhrchen und Bestimmung der Proteinkonzentration unter Verwendung eines Protein - Assay 36.
    Hinweis: Eine gegebene Explantation wird Ausbeute von bis zu 1,5 & mgr; g Gesamtprotein. Wir haben gefunden, dass die Bündelung Explantate von zwei Herzen eind Beladung 2 ug Protein pro Vertiefung ist ausreichend glatten Muskulatur α-Aktin (ACTA2) und 9 GAPDH zu erkennen. Die Detektion von anderen Zielproteine ​​erfordern können mehrere Proben Explantat Pooling wie durch den Endverbraucher bestimmt.

5. Immuncytochemie von Epikardiale Auswüchse

  1. Entfernen Sie das Medium aus Explantation Kulturen und waschen zweimal mit DPBS.
  2. Fügen Sie vorsichtig 500 ul 4% (v / v) Paraformaldehyd oder eiskaltem Methanol in jede Vertiefung und fixieren Explantate für 5 Minuten bei Raumtemperatur oder 10 min bei -20 ° C. Fix nach Antikörper-Spezifikationen, wie vom Hersteller empfohlen.
  3. Entfernen Fixiermittel und spülen jede Vertiefung mit DPBS dreimal 5 min.
  4. Permeabilisierung der Zellen mit 500 ul 0,1% (v / v) Triton X-100 in DPBS für 5 min.
  5. Entfernen Permeabilisierung Lösung und Spülen mit DPBS dreimal 5 min.
  6. Blockieren die Zellen mit 10% Serum in DPBS für 30 min bei Raum temperatuRe.
  7. Fahren Sie mit dem primären Antikörperfärbung pro Herstellerempfehlungen und optimale Bedingungen, wie durch den Endverbraucher bestimmt.
  8. Entfernen Antikörperlösung und Spülen mit DPBS dreimal 5 min.
  9. Bewerben sekundären Antikörper den Anweisungen des Herstellers und counterstain mit einem geeigneten Kern Farbstoff.
  10. Entfernen Antikörperlösung und Spülen mit DPBS dreimal 5 min.
  11. Entfernen Kammer Gleitwänden den Anweisungen des Herstellers und fügen Medium wässrige Montage direkt an die Zellen. Legen Sie ein Deckglas über die Zellen und Dichtung mit Nagellack. 2D unter Verwendung von invertierten konfokalen Rastermikroskopie - Typische Ergebnisse sind in Figur 2B gezeigt.

6. Ex Vivo Kulturassay (3A)

  1. Die Vorbereitungen
    1. Vorbereitung 12 ml ex vivo - Kulturmedium unter Verwendung eines (1: 1) -Mischung aus Dulbeccos modifiziertem Eagle Medium (DMEM): M199 , ergänzt mit 10%FBS und 1% Pen / Strep.
    2. In einem 37 ° C Wasserbad, vorwärmen ex vivo Kulturmedium und 100 ml HBSS.
    3. Aliquot 1 ml vorgewärmtes Medium in 8-12 Vertiefungen einer 24-Well-Platte.
    4. Transfer vorgewärmt HBSS auf zwei 10 cm 2 Platten, mit je 50 ml.
  2. Isolieren embryonalen Maus-Herzen in HBSS von schwangeren Dämme bei 12,5 dpc (wie in 1.2 beschrieben).
  3. Übertragen jedes Herz zu einer einzigen Vertiefung der 24 - Well - Platte , die ex vivo Kulturmedium. Inkubieren der Platte bei 37 ° C, 5% CO 2 unter leichtem Schaukeln oder manuell eine Schaukelplattform Anhaften zu verhindern. Ab sofort gehen 7.1 zu treten.

7. Epikardiale Labeling und EMT Induktion in Ex - vivo - Kulturen

  1. Um das Epikard etikettieren, bereiten 12 ml 37 ° C ex vivo - Kulturmedium , supplementiert mit 3,0 x 10 6 pfu / ml Ad / GFP. Für die gezielte Ablation von floxed Allele, Transfer 6 ml Ad / GFP Kulturmedium in ein neues 15 ml konischen Röhrchen ergänzt. Hinzufügen Ad / Cre oder Kontroll - Adenovirus zu einer Endkonzentration von 1,5 x 10 6 pfu / ml.
    Note: Verstärkung von Funktionsanalysen können auch mit geeigneten Adenovirus-vermittelte Genübertragung durchgeführt werden.
  2. Entfernen Sie vorsichtig von jeder Vertiefung der 24-Well-Platte mit einer P1,000 Pipettenspitze mit dem Kulturmedium.
  3. Sanft Kulturmedium mit Adenovirus (n) in jede Vertiefung ergänzt hinzuzufügen.
  4. Die Platte bei 37 ° C, 5% CO 2 für 24 Stunden unter leichtem Schütteln.
  5. Für EMT Induktions bereiten 12 ml 37 ° C ex vivo - Kulturmedium , enthaltend 10 ng / ml TGF-β1 und 20 ng / ml platelet-derived growth factor (PDGF) -BB oder Vehikel (4 mM HCl , enthaltend 1 mg / ml BSA ).
  6. Kulturmedium aus jeder Vertiefung der 24-Well-Platte mit einer P1,000 Pipettenspitze vorsichtig entfernen. Spülen Sie leicht die Herzen mit 1 ml DPBS.
  7. Entfernen Sie die DPBS und ergänzen Herzen mit ex vivo Kultur michdium enthaltend TGF-β1 und PDGF-BB oder Vehikel.
  8. Inkubieren für 24 Stunden bei 37 ° C, 5% CO 2 unter leichtem Schütteln.

8. Kryokonservierung und Immunhistochemie von Ex Vivo Cultures

  1. Bereiten Sie die Herzen für die Kryokonservierung.
    1. Entfernen Sie das Kulturmedium und waschen Herzen zweimal mit eiskaltem DPBS.
    2. 1 ml 4% (v / v) Paraformaldehyd zu jedem Herzen und fixieren für 2 Stunden bei 4 ° C unter leichtem Schütteln.
    3. Entfernen Sie die Fixiermittel und waschen Herzen zweimal mit DPBS. Übertragen Sie die Herzen an die frische Brunnen mit 1 ml 10% (w / v) Saccharose in DPBS. Die Platte über Nacht bei 4 ° C unter leichtem Schütteln.
    4. Sorgfältig übertragen Herzen neue Brunnen mit 18% (w / v) Saccharose in DPBS vorbereitet. Die Platte über Nacht bei 4 ° C unter leichtem Schütteln.
    5. Übertragen jedes Herz zu einem cryomold haltiges Gewebe Einfriermedium. Sofort Blöcke einfrieren flüssigem Stickstoff und bei -80 & # verwenden176; C.
  2. Abschnitt Herzen bei 5 um ein Kryostat und Platz Gewebeschnitte auf positiv geladene Objektträger verwenden. Shop gleitet bei -80 ° C bis zur Färbung.
  3. Führen Immunhistochemie auf Abschnitte zur Erfassung des Unter epikardialen Basalmembran.
    1. Auftauen Folien für Temperatur mindestens 30 min bei Raum.
    2. Rehydrieren die Abschnitte durch zweimal in DPBS für 5 min unter leichtem Schütteln waschen.
    3. Permeabilisieren Abschnitt mit 0,1% (v / v) Triton X-100 in PBS für 5 min bei Raumtemperatur.
    4. Waschen Sie die Objektträger zweimal in DPBS für 5 min unter leichtem Schütteln.
    5. Blot überschüssige DPBS und definieren die Färbung Region mit einem hydrophoben Markierungsstift. Blockabschnitte mit 10% Serum in DPBS für 30 min bei Raumtemperatur.
    6. Entfernen Block und anwenden Kollagen Typ IV-Antikörper (ColIV, 1: 200) in Block verdünnt. Inkubieren über Nacht bei 4 ° C in einer feuchtigkeitsgesteuerten Kammer.
    7. Waschen Sie die Objektträger dreimal in DPBS für5 min unter leichtem Schütteln.
    8. Verdünnte fluoreszenz konjugierten sekundären Antikörper (1: 500) und DAPI (1: 5.000) in DPBS und gelten für den Folien. Inkubieren für 1 h bei Raumtemperatur. Wählen Sie einen geeigneten sekundären Antikörper mit einem Emissions- und Anregungswellenlänge verschieden von GFP.
    9. Waschen Sie die Objektträger dreimal in PBS für 5 min unter leichtem Schütteln. Berg Träger mit Eindeckmediums.

9. Imaging und Quantifizierung von Ex - vivo - Kulturen

  1. Haben Sie einen verblendet Benutzer Bild und zu quantifizieren gefärbten Schnitten. Bild mindestens fünf nicht aufeinanderfolgende Gewebeschnitte aus einem gegebenen Herz in 4-5 beliebigen Stellen entlang der Epikard (Rand des Herzens) mit einem fluoreszierenden oder konfokalen Mikroskop bei 40-facher Vergrößerung. Typische Ergebnisse sind in Figur 3B Verwendung invertierter konfokalen Rastermikroskopie gezeigt.
  2. Zählen Sie manuell die Gesamtzahl der GFP-positiven Zellen in einem gegebenen Bild. Identifizieren EPDC als GFP po Migrationsitive Zellen innerhalb oder außerhalb des subepikardialen Basalmembran ColIV entfernt. Bestimmen den Prozentsatz der GFP-Zellen, wie die Anzahl von migrierenden GFP positive Zellen über die Gesamtzahl der GFP-positiven Zellen in einem gegebenen Bild migrieren. Typische Ergebnisse sind in 3C-D mit invertierten konfokalen Rastermikroskopie gezeigt.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Das Epikard effizient sein kann mit einem Auswuchs Kulturtest isoliert durch Ausnutzung seiner äußeren Stelle zu nehmen und die Entwicklungs Plastizität und intrinsische Zugverhalten der EPDC nutzen. Murinen embryonalen Herzen werden bei E11.5 vor epikardialen EMT und kultivierten dorsalen Seite nach unten auf kollagenbeschichteten chamber slides 26 (1A, B) isoliert. Explantierte Herz wird schrumpfen weiter; jedoch wird das Epikard zu der Kollagenmatrix haften und migrieren aus dem Myokard innerhalb von 24 h der Kultur (1C) ab. Epikardiale Zellen können aus dem Herzen mit pflastersteinartige Morphologie, was auf eine mesothelial Identität (1C-E) ausgeht , weg zu beachten. Nach 24 Stunden der Kultur, Epikard verarmten Herzen sind für Gen- oder Proteinexpressionsanalyse entfernt.

Zusätzlich zu beobachten epithelial Morphologie kann die Reinheit der epikardialen Zellkulturen weiter durch die Expression von epikardialen eingeschränktem Gen- und Proteinmarker validiert werden. Epikardiale Zelle Explantaten zeigen robuste Expression von epikardialen und mesothelial Markern (Aldh1a2, Tcf21 und Wt1) und niedriger Expression von Kardiomyozyten - Gene (NKX2-5 und MYH7) im Vergleich zu Epikard verarmten Herzen (2A). Zur weiteren Identität verifizieren, werden epikardialen Zellkulturen 48 Stunden nach Herz Entfernung fixiert und Co-gefärbt mit Antikörpern gegen Wilms-Tumor 1 (WT1) und zona occludens protein 1 (ZO1) Mesothelzellen und interzellulären tight junctions zu beschriften bzw. 37,38 ( 2B). Dieser Auswuchs Kulturverfahren ergibt sich eine relativ hohe Reinheit von Mesothelzellen; jedoch können Benutzer einen kleinen Prozentsatz der Zellkontamination zu beobachten. Fibroblasten und glatte Muskelzellen zeigen einen länglichen mesenchymalen Phänotyp mit einer bemerkenswerten Abwesenheit von nuclear WT1 und organisiert Tight Junctions (Abbildung 2C). Techniken zur Fehlerbehebung die Menge an nicht-epikardialen Zelle Kontamination zu begrenzen, sind in der Diskussion erweitert.

Das Explantat - Auswuchs - Assay ist ein nützliches Kultursystem für die in vitro epikardialen biology abfrage. Zur epikardialen Zellplastizität zeigen, wurden Explantate mit TGF-β1 [10 ng / ml] zu stimulierenden transdifferentiation in Mesenchymzellen 26,28 induzieren. Nach 24 Stunden der Stimulation EPDC einen mesenchymalen Phänotyp mit reduzierter ZO1 Färbung und robust de novo Bildung von glatten Muskelzellen α-Actin positive Stressfasern (ACTA2 oder SMA), insbesondere an der Peripherie der Kultur 39 (2D, rot) annehmen. Im Gegensatz Faseranordnung an der Peripherie der Explantate, konfluente epikardialen Zellen mit definierter interzellularen Kontakten (ZO1, grün) in der Mitte eines monolaye betonenr Anzeige ACTA2 Protein-Expression in kortikalen Aktin.

Darüber hinaus EMT zu unterziehen, das Myokard und zu unterscheiden, bilden einen wesentlichen Anteil an nicht-Kardiomyozyten Populationen EPDC wird überfallen. Die Motilität von EPDC kann unter Verwendung einer zuvor festgelegten ex vivo - Organkultursystem bewertet werden , wobei die Außenseite des E12.5 Herzen mit einem Adenovirus markiert sind, die GFP 9,18 (3A). Etikettiert Herzen sind weiter kultiviert für drei Tage in Gegenwart von TGF-β1 [10 ng / ml] und PDGF-BB [20 ng / ml] EPDC Migration zu fördern. Organkulturen werden regelmäßig zur Verhinderung von Adhäsion ex vivo Herzen an die Oberfläche der Kulturplatten gedreht. Dieses System ermöglicht eine effiziente Markierung des gesamten Epikard und Beurteilung der EPDC Motilität in einem Modell dreidimensionalen wie bei in vitro - Assays zur Kratz gerichtete Migration entgegengesetzt. Die Migration von EPDC ist Observed wie die Invasion von GFP positive epikardialen Zellen in oder über die ColIV (rot) subepikardialen Basalmembran 16 (3B, C). Um die Nützlichkeit dieses Systems veranschaulichen, haben wir vor kurzem , dass Manipulation des MRTF / SRF Signalisierungs Achse dargestellt 9 die Motilität von EPDC beeinflussen. Löschen von Mrtfa und Mrtfb durch Cre-vermittelte Exzision floxed Allele (MRTFdKO) dämpft die Migration von EPDC in den subepikardialen Raum. Im Gegensatz dazu gezwungen Expression MRTF-A (Ad / MRTF-A) in C57BL / 6 Herzen führt zu einer erhöhten EPDC Migration und Störungen des ColIV Basalmembran (3C, D).

Gen Vorwärts Umkehren NCBI Zugangs
Aldh1a2 GGCACTGTGTGGATCAACTG TCACTTCTGTGTACGCCTGC NM_009656
GAPDH CGTGCCGCCTGGAGAAAC TGGGAGTTGCTGTTGAAGTCG NM_001289726
MYH7 GTGGCTCCGAGAAAGGAAG GAGCCTTGGATTCTCAAACG NM_080728
NKX2-5 GACGTAGCCTGGTGTCTCG GTGTGGAATCCGTCGAAAGT NM_008700
Tcf21 CATTCACCCAGTCAACCTGA CCACTTCCTTCAGGTCATTCTC NM_011545
Wt1 ATCCGCAACCAAGGATACAG GGTCCTCGTGTTTGAAGGAA NM_144783

Tabelle 1: Sequenzen von Vorwärts- und Rückwärts - Primer verwendet für die Validierung von Epikardiale Outgrowth Kultur Reinheit durch Analyse von Epikard und Myokard Restricted Genexpression Die Genexpression durch die qRT-PCR wi bestimmt wird.th die folgenden Parameter: 10 s bei 95 ° C denaturieren; Tempern bei 60 ° C für 30 sec; wiederholen 50x Zyklen.

Abbildung 1
Abbildung 1: Isolierung von primären Epikardiale Zellen unter Verwendung von Auswuchs Kulturtest (A) eine schematische Darstellung der epikardialen Auswuchs Explantat - Test mit einer empfohlenen Zeitplan für die epikardiale Modulation und Analyse.. (B - E) Repräsentative Hell- Bilder von verschiedenen Zeitpunkten während der Explantation Assays. (B) Embryonale Tag E11.5 Maus - Herzen sind dorsalen Seite nach unten auf einem Kollagensubstrat angeordnet. (C) Epikardiale Zellen (weiße Pfeile) beginnt das Herz innerhalb von 3-4 Stunden der Kultur zu wandern ab. Die Blutzellen (schwarze Pfeile) können in der Nähe akkumulieren oder Explantate während epikardialen Auswuchs decken. (D, E) Nachetwa 24 Stunden der Kultur, Herzen entfernt und epikardialen Monolayern bleiben an der Kammer Rutsche geklebt. Cellular Auswüchse zeigen epitheliale Morphologie mit einer gepflasterten artigen Anordnung von Zellen. Maßstabsbalken = 250 & mgr; m (BD) oder 50 & mgr; m (C, E). H = Herz, LA = linker Vorhof, LV = linker Ventrikel, OFT = Ausflusstraktes, RA = rechten Vorhof, RV = rechten Ventrikels. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Figur 2
Abbildung 2: Bewertung der Epikardiale Zellauswuchs Reinheit (A) qRT-PCR Validierung von epikardialen beschränkt Markern (Tcf21, Aldh1a2 und Wt1) in Auswuchs Kulturen im Vergleich zu myokardialen Genexpression (NKX2-5 und MYH7) in Epikard verarmten E11.. 5 Herzen. Daten VertreT die mittlere ± SEM (n = 8 pro Gruppe). Sternchen bezeichnen statistische Signifikanz ein Student T-Test mit **** P <0,0001 verwenden. (B) Repräsentative Co-Immunfluoreszenzanfärbung von unstimulierten Auswüchsen für epikardiale Ausdruck (WT1, rot), interzellulären tight junctions (ZO1, grün) und Zellkerne (DAPI, blau). (C) Ein Beispiel für Zellkontamination in Auswuchs Kultur. Epikardiale Zellen (Stern) sind auf der rechten Seite der Platte mit charakteristischen mesothelial Identität (Kern WT1, rot) und organisiert epitheliale Tight Junctions (ZO1, grün) beobachtet. Die benachbarten Zellen in der Mitte (weiße Pfeilspitzen) zeigen eine längliche mesenchymalen Morphologie, durch Differentialinterferenzkontrast (DIC) Bildgebung gezeigt, mit minimaler Kern WT1-Protein und unorganisierte ZO1 Färbung. (D) Epicardial Zellkulturen wurden mit Vehikel (4 mM HCl in 1 mg / ml BSA) oder TGF-β1 [10 ng / ml] stimuliert epikardialen zu induzierenEMT. TGF-β1-Stimulation fördert robuste Expression ACTA2 (rot) in kortikalen Regionen von konfluenten Zellen im Zentrum der Explantate oder in Stressfasern von Zellen am Rand bzw. Umfang des einschichtigen migrieren. Zell Adhäsionen werden durch ZO1 (grün) markiert. Maßstabsbalken = 25 & mgr; m (BD). Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Figur 3
Abbildung 3: Ex - vivo - Bewertung der EPDC Motilität (A) Eine schematische Zeitleiste der ex vivo Herz Kulturtest.. (B) Ein Vertreter 5 um Schnitt einer C57BL / 6 E12.5 Herz transduziert mit Ad / GFP (grün) für 24 Stunden das Äußere des Herzens zu beschriften. Ex - vivo - Herzen wurden anschließend für weitere 48 Stunden mit TGF- β1 [10 ng / ml]und PDGF-BB [20 ng / ml] EPDC Migration zu stimulieren. Die Schnitte wurden für ColIV (rot) zusammen gefärbt , um die subepikardialen Basalmembran und Kerne (DAPI, blau) zu beschriften. Ex - vivo - Herz Kulturmorphologie wird durch DIC gezeigt. LV = linker Ventrikel, RV = rechte Ventrikel, RA = rechten Vorhof. (C, D) Eine beispielhafte Anwendung der ex vivo Migrationstest durch die MRTF / SRF Regulierungsachse moduliert. Diese Zahl wurde von [9] geändert. E12.5 Herzen wurden aus Mrtfa isoliert - / -;. Mrtfb fl / fl Embryonen und transduziert mit Ad / GFP und einem Kontrollvirus oder ein Adenovirus exprimieren Cre - Rekombinase für 24 hr Ex vivo - Kulturen wurden dann mit TGF-β1 stimuliert [10 ng / ml] und PDGF-BB [20 ng / ml] für weitere 48 hr. EPDC Motilität (weiße Pfeile) wird als die Migration von GFP-positiven Zellen (grün) in die oder jenseits der ColIV (rot) beobachtet. Cre-vermittelte Deletion von Mrtfb in der <em> Mrtfa - / - Hintergrund (MRTFdKO) führt zu einer Abschwächung der EPDC Migration im Vergleich Herzen zu steuern. Im Gegensatz dazu gezwungen Ausdruck von MRTF-A (Ad / MRTF-A) in E12,5 C57BL / 6 Herzen verbessert EPDC Migration. (D) Quantifizierung von% GFP positiven Zellmigration. Daten sind als Mittelwert ± SEM (n = 4 Herzen für jede Bedingung) dargestellt. Die Daten wurden unter Verwendung eines Einweg-ANOVA analysiert mit Sternchen bezeichnet eine statistische Signifikanz von Tukey post-hoc-Tests mit **** P <0,0001. Maßstabsbalken = 200 & mgr; m (B) oder 25 & mgr; m (C). Alle Bilder wurden mit invertierten konfokalen Laser - Scanning - Mikroskopie erfasst. Bitte klicken Sie hier , um eine größere Version dieser Figur zu sehen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Hier haben wir detaillierte Methoden skizzieren primäre epikardialen Zelle durch Auswuchs zu isolieren und EPDC Migration in ex vivo Herz Kulturen verfolgen. Für Auswuchs Kulturen variiert die geeignete Zeit, um das Epikard abgereicherte Herz zu entfernen leicht zwischen den Experimenten. Eine regelmäßige Überwachung der Explantate nach einer Inkubation über Nacht wird empfohlen, um das Ausmaß der epikardialen Auswuchs zu messen und um das Herz zu extrahieren, bevor Fibroblasten erscheinen. Um sicherzustellen, Reinheit, sollte Herzen innerhalb von 24 h entfernt werden Explantation Anhäufung von nicht-epikardialen Abstammungslinien zu verhindern. Trimmen des Ausflusstraktes entfernt und die beiden Atrien vor das Herz zu einer Kammer Schieber übertragen kann auch 27,40 verunreinigenden Zelltypen zu reduzieren. Da fetalen Herzen von einer Maus Wurf während eines schmalen Zeitfenster und kultiviert unter den gleichen Bedingungen isoliert werden, ist die Zeit für Auswüchse erscheinen relativ ähnlich von einem Herz zu einer anderen innerhalb eines Experiments. Daher sollten alle Herzen be entfernt, wenn die Mehrheit der Explantate epikardialen Auswüchse zeigen. In einigen Fällen gibt es in epikardialen Zellen nicht effizient migrieren aus einem Herzen, das stärker ist als die anderen Vertrags, wobei dieser Explantation muss aus dem Experiment ausgeschlossen werden.

Die Ansammlung von Blutzellen kann oft eine flache Monoschicht von epikardialen Zellen (Pfeile, 1C) verbergen, wodurch es schwierig Auswüchse zu visualisieren. Um eine übermäßige Blutzell Beitrag zu vermeiden, können Herzen für ein paar Minuten auf Dissektion aus dem Embryo in HBSS bleiben. Dies ermöglicht es genügend Zeit für die fetale Herzrestblut in die Herzkammern zu pumpen, bevor zu einer Kammer Träger übertragen werden. Alternativ Medium A die Kulturen mit Explantation Ergänzung nach der ersten Inkubation über Nacht wird dazu beitragen, einige überschüssige Blut wegzuspülen und Auswüchse zeigen; jedoch kann die Höhe der Medien sollte nicht über dem Herzen steigen, da die Oberflächenspannung des Herzens verursachenzu ziehen, weg von dem Substrat. Robust epikardialen Auswüchse verwenden Kollagen Typ I als Kultursubstrat beobachtet; jedoch sind andere Substrate wurden in Abhängigkeit von dem Organismus gemeldet und / oder Anwendungs ​​27,40-42. Mit diesem Protokoll können primäre fetale epikardialen Zellen für 4 Tage nach einer Herzentfernung und tägliche mittlere Nachschub gedeihen; jedoch experimentellen Designs längere Kultur erfordern, sollten durch den Endverbraucher bestimmt. Da epikardialen EMT stark während der embryonalen Entwicklung, diese Auswuchs Kulturtechnik aktiviert wird, wird auf die Anreicherung von fetalen Zellen epikardialen begrenzt. Andere Gruppen haben Methoden beschrieben Erwachsenen zu isolieren epikardialen Zellen 43,44.

Für die Ex - vivo - Migrationsassays, Herz - Extraktion und epikardialen Zellmarkierung sind bei E12,5 aus zwei Gründen empfohlen. Zunächst isolierten Herzen nach E12,5 sind größer und damit mehr Perfusion erfordern Lebensfähigkeit zu unterstützen. Einfache Diffusion von Nährstoffens ist nicht ausreichend, um Organkulturen aus größeren Herzen aufrechtzuerhalten. Zweitens treten epikardialen EMT und EPDC Migration um E12,5. Daher sollte das Epikard mit einem Adenovirus markiert werden, um ein fluoreszierendes Protein unmittelbar nach dem Herz Extraktion die Detektion von EPDC zu maximieren auszudrücken. Alternativ dazu wurde berichtet , um das Äußere des Herzens Carboxyfluoresceindiacetat Succinimidylester (CFSE) früher zu etikettieren und EPDC Migration 10,45 verfolgen.

Im Gegensatz zu Auswuchs Assays, ex vivo Kulturen sollten in regelmäßigen Abständen Herz Befestigung und epikardialen Zellauswuchs geschaukelt werden , um zu vermeiden. Kulturen auch in einem Inkubator kontinuierlich gerührt mit einer Wippe auf der niedrigsten Geschwindigkeitseinstellung ausgestattet werden könnte. Die Nutzer werden Änderungen in der Herzmorphologie innerhalb weniger Tage der Orgelkultur feststellen und sollten Analysen über 72 Stunden von Herz Isolation zu vermeiden. Unter Verwendung dieses Tests wird EPDC invasion innerhalb von 48 bis 72 Stunden der Kultur beobachtet. Während die Cre-loxP-Systemwurde in vivo abzubilden die Lokalisierung von EPDC zur koronaren Vaskulatur, das Myokard Interstitium und dem interventrikulären Septum 7,22 Diese ex vivo Technik ist beschränkt auf EPDC Migration innerhalb weniger Zellschichten des Teil epikardialen Raum verwendet. Somit ist dieses Verfahren besser geeignet für die Regulatoren der EPDC Motilität und Invasion statt Festlegung der endgültigen Bestimmung der Migration EPDC bestimmen.

Epikardiale Zelle Isolationen und ex vivo Migrationsassays, in Kombination mit Gewinn oder Verlust der Funktion Ansätze haben sich bereits bewährt , für die Kandidaten - Gene bewerten, die EPDC Biologie 9,18,46 beeinflussen könnten. Diese Methoden bieten auch eine Plattform für gain-of-function oder loss-of-function-Bildschirme neuartigen Regulatoren der EPDC Migration zu identifizieren. Diese Strategie in Verbindung mit Fluoreszenz-aktivierte Zellsortierung oder Einzelzell-RNA-Sequenzierung, können ferner die Möglichkeit epikardialen Heterogenität zu sondierenund EPDC Differenzierung in größerem Detail. Schließlich könnten Modifikationen dieser Verfahren verwendet werden Screens für kleine Moleküle zu entwickeln, die epikardiale Zelle und EPDC biology zum Zwecke der Herz regenerative Medizin beeinflussen.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts zu offenbaren.

Acknowledgements

EMS wurde durch Zuschüsse aus den National Institutes of Health (NIH) [Grant-Nummer R01HL120919] unterstützt; der American Heart Association [Gewährungsnummer 10SDG4350046]; University of Rochester CTSA Auszeichnung von der NIH [Grant-Nummer UL1 TR000042]; und Startup-Mittel aus dem Aab CVRI. MAT wurde zum Teil durch einen Zuschuss an die University of Rochester School of Medicine and Dentistry vom Howard Hughes Medical Institute Med-In-Grad-Initiative unterstützt; und eine institutionelle Ruth L. Kirschstein National Research Service Award von der NIH [Grant-Nummer GM068411].

Materials

Name Company Catalog Number Comments
Dulbecco's Modified Eagle Medium Hyclone  SH3002201 DMEM
Hanks' Balanced Salt Solution Hyclone SH3003102 HBSS
Medium 199 Hyclone SH3025301 M199
Dulbecco’s Phosphate-Buffered Saline  Hyclone SH3002802 DPBS
Fetal Bovine Serum  Gemini  100-106 FBS
Penicillin/Streptomycin Solution Hyclone SV30010
Corning Biocoat Collagen I, 4-Well Culture Slides Corning 354557
Multiwell 24-well plates Falcon 08-772-1
Dissecting microscope Leica M50 Equipped with Leica KL300 LED might source
Confocal miscroscope Olympus 1X81 Equipped with muli-argon laser 405/488/515, FV10-MCPSU laser 405/440/635, 559 laser, and mercury lamp
Bioruptor Diagenode  UCD-200
Transforming growth factor beta 1 R&D Systems 100-B-001 TGF-β1
Platelet-derived growth factor BB R&D Systems 220-BB-010 PDGF-BB
Trizol Reagent Applied Biosystems 15596-026 Caution, hazardous material
TURBO DNA-free Kit Life Technologies AM1907 DNaseI
iScript cDNA Synthesis Kit BioRad 1708891
UltraPure Glycogen Life Technologies 10814-010
SYBR Green BioRad 170-8880
Protease inhibtor cocktail tablets Roche 11836170001
Alexa Goat-anti-rabbit 488 Life Technologies A11008 Secondary antibody
Alexa Goat anti-rabbit 594 Life Technologies A-11012 Secondary antibody
Alexa Goat anti-mouse 594 Life Technologies A-11005 Secondary antibody
Mouse anti-smooth muscle alpha actin, Cy3-conjugated  Sigma-Aldrich C6198 monoclonal antibody, clone 1A4
Mouse anti-Wilms tumor 1 (WT1) Life Technologies MA1-46028 monoclonal antibody, clone 6F-H2
Rabbit anti-ZO1 Life Technologies 40-2200 polyclonal antibody
Rabbit anti-Collagen Type 4 Millipore AB756P polyclonal antibody
4',6-Diamidino-2-Phenylindole, Dihydrochloride  Life Technologies D1306 DAPI
Fluorescent mounting medium  DAKO S3023
16% Paraformaldehyde solution Electron Microscopy Sciences 15710 PFA diluted to 4% in DPBS. Caution, hazardous material
Sucrose Sigma-Aldrich S0389
Tissue Freezing Medium Triangle Biomedical Sciences TFM-B
Pap pen DAKO S2002
Disposable mictrotome blades  Sakura Finetek 4689
Microscope slides Globe Scientific 1358W positively charged, 25 mm x 75 mm x 1 mm
Cryostat  Leica CM1950
Forceps Fine Science Tools 11295-00
Surgical Scissors Fine Science Tools 91460-11
Disposable base molds Fisher Scientific 22-363-553
Ketamine Hospira NDC 0409-2051-05
Xylazine Akorn NADA 139-236

DOWNLOAD MATERIALS LIST

References

  1. von Gise, A., Pu, W. T. Endocardial and epicardial epithelial to mesenchymal transitions in heart development and disease. Circ Res. 110, 1628-1645 (2012).
  2. Martinez-Estrada, O. M., et al. Wt1 is required for cardiovascular progenitor cell formation through transcriptional control of Snail and E-cadherin. Nat Genet. 42, 89-93 (2010).
  3. Gittenberger-de Groot, A. C., Vrancken Peeters, M. P., Mentink, M. M., Gourdie, R. G., Poelmann, R. E. Epicardium-derived cells contribute a novel population to the myocardial wall and the atrioventricular cushions. Circ Res. 82, 1043-1052 (1998).
  4. Katz, T. C., et al. Distinct compartments of the proepicardial organ give rise to coronary vascular endothelial cells. Dev Cell. 22, 639-650 (2012).
  5. Mikawa, T., Gourdie, R. G. Pericardial mesoderm generates a population of coronary smooth muscle cells migrating into the heart along with ingrowth of the epicardial organ. Dev Biol. 174, 221-232 (1996).
  6. Wilm, B., Ipenberg, A., Hastie, N. D., Burch, J. B., Bader, D. M. The serosal mesothelium is a major source of smooth muscle cells of the gut vasculature. Development. 132, 5317-5328 (2005).
  7. Zhou, B., et al. Epicardial progenitors contribute to the cardiomyocyte lineage in the developing heart. Nature. 454, 109-113 (2008).
  8. Dettman, R. W., Denetclaw, W., Ordahl, C. P., Bristow, J. Common epicardial origin of coronary vascular smooth muscle, perivascular fibroblasts, and intermyocardial fibroblasts in the avian heart. Dev Biol. 193, 169-181 (1998).
  9. Trembley, M. A., Velasquez, L. S., de Mesy Bentley, K. L., Small, E. M. Myocardin-related transcription factors control the motility of epicardium-derived cells and the maturation of coronary vessels. Development. 142, 21-30 (2015).
  10. Mellgren, A. M., et al. Platelet-derived growth factor receptor beta signaling is required for efficient epicardial cell migration and development of two distinct coronary vascular smooth muscle cell populations. Circ Res. 103, 1393-1401 (2008).
  11. von Gise, A., et al. WT1 regulates epicardial epithelial to mesenchymal transition through beta-catenin and retinoic acid signaling pathways. Dev Biol. 356, 421-431 (2011).
  12. Lavine, K. J., et al. Endocardial and Epicardial Derived FGF Signals Regulate Myocardial Proliferation and Differentiation In Vivo. Dev Cell. 8, 85-95 (2005).
  13. Sanchez, N. S., Barnett, J. V. TGFbeta and BMP-2 regulate epicardial cell invasion via TGFbetaR3 activation of the Par6/Smurf1/RhoA pathway. Cell Signal. 24, 539-548 (2012).
  14. Dettman, R. W., Pae, S. H., Morabito, C., Bristow, J. Inhibition of 4-integrin stimulates epicardial-mesenchymal transformation and alters migration and cell fate of epicardially derived mesenchyme. Dev Biol. 257, 315-328 (2003).
  15. Rhee, D. Y., et al. Connexin 43 regulates epicardial cell polarity and migration in coronary vascular development. Development. 136, 3185-3193 (2009).
  16. Wu, M., et al. Epicardial spindle orientation controls cell entry into the myocardium. Dev Cell. 19, 114-125 (2010).
  17. Hirose, T., et al. PAR3 is essential for cyst-mediated epicardial development by establishing apical cortical domains. Development. 133, 1389-1398 (2006).
  18. Baek, S. T., Tallquist, M. D. Nf1 limits epicardial derivative expansion by regulating epithelial to mesenchymal transition and proliferation. Development. 139, 2040-2049 (2012).
  19. Lu, J., et al. Coronary smooth muscle differentiation from proepicardial cells requires rhoA-mediated actin reorganization and p160 rho-kinase activity. Dev Biol. 240, 404-418 (2001).
  20. Combs, M. D., Braitsch, C. M., Lange, A. W., James, J. F., Yutzey, K. E. NFATC1 promotes epicardium-derived cell invasion into myocardium. Development. 138, 1747-1757 (2011).
  21. Acharya, A., et al. The bHLH transcription factor Tcf21 is required for lineage-specific EMT of cardiac fibroblast progenitors. Development. 139, 2139-2149 (2012).
  22. Zhou, B., von Gise, A., Ma, Q., Hu, Y. W., Pu, W. T. Genetic fate mapping demonstrates contribution of epicardium-derived cells to the annulus fibrosis of the mammalian heart. Dev Biol. 338, 251-261 (2010).
  23. Zhou, B., et al. Adult mouse epicardium modulates myocardial injury by secreting paracrine factors. J Clin Invest. 121, 1894-1904 (2011).
  24. Singh, M., Epstein, J. Epicardial Lineages and Cardiac Repair. Journal of Developmental Biology. 1, 141-158 (2013).
  25. Braitsch, C. M., Combs, M. D., Quaggin, S. E., Yutzey, K. E. Pod1/Tcf21 is regulated by retinoic acid signaling and inhibits differentiation of epicardium-derived cells into smooth muscle in the developing heart. Dev Biol. 368, 345-357 (2012).
  26. Austin, A. F., Compton, L. A., Love, J. D., Brown, C. B., Barnett, J. V. Primary and immortalized mouse epicardial cells undergo differentiation in response to TGFbeta. Developmental dynamics : an official publication of the American Association of Anatomists. 237, 366-376 (2008).
  27. Kim, J., Rubin, N., Huang, Y., Tuan, T. L., Lien, C. L. In vitro culture of epicardial cells from adult zebrafish heart on a fibrin matrix. Nat Protoc. 7, 247-255 (2012).
  28. Compton, L. A., Potash, D. A., Mundell, N. A., Barnett, J. V. Transforming growth factor-beta induces loss of epithelial character and smooth muscle cell differentiation in epicardial cells. Developmental dynamics : an official publication of the American Association of Anatomists. 235, 82-93 (2006).
  29. Smith, C. L., Baek, S. T., Sung, C. Y., Tallquist, M. D. Epicardial-derived cell epithelial-to-mesenchymal transition and fate specification require PDGF receptor signaling. Circ Res. 108, 15-26 (2011).
  30. Shea, K., Geijsen, N. Dissection of 6.5 dpc Mouse Embryos. JOVE. 2, (2007).
  31. Witty, A. D., et al. Generation of the epicardial lineage from human pluripotent stem cells. Nature biotechnology. 32, 1026-1035 (2014).
  32. Iyer, D., et al. Robust derivation of epicardium and its differentiated smooth muscle cell progeny from human pluripotent stem cells. Development. 142, 1528-1541 (2015).
  33. Takeichi, M., Nimura, K., Mori, M., Nakagami, H., Kaneda, Y. The transcription factors Tbx18 and Wt1 control the epicardial epithelial-mesenchymal transition through bi-directional regulation of Slug in murine primary epicardial cells. PloS one. 8, e57829 (2013).
  34. Wong, M. L., Medrano, J. F. Real-time PCR for mRNA quantitation. BioTechniques. 39, 75-85 (2005).
  35. Schmittgen, T. D., Livak, K. J. Analyzing real-time PCR data by the comparative CT method. Nature Protocols. 3, 1101-1108 (2008).
  36. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical biochemistry. 72, 248-254 (1976).
  37. Moore, A. W., McInnes, L., Kreidberg, J., Hastie, N. D., Schedl, A. YAC complementation shows a requirement for Wt1 in the development of epicardium, adrenal gland and throughout nephrogenesis. Development. 126, 1845-1857 (1999).
  38. Kim, J., et al. PDGF signaling is required for epicardial function and blood vessel formation in regenerating zebrafish hearts. Proc Natl Acad Sci U S A. 107, 17206-17210 (2010).
  39. Kalluri, R., Weinberg, R. A. The basics of epithelial-mesenchymal transition. J Clin Invest. 119, 1420-1428 (2009).
  40. Dong, X. R., Maguire, C. T., Wu, S. P., Majesky, M. W. Chapter 9 Development of Coronary Vessels. Methods in Enzymology. 445, 209-228 (2008).
  41. Ruiz-Villalba, A., Ziogas, A., Ehrbar, M., Perez-Pomares, J. M. Characterization of epicardial-derived cardiac interstitial cells: differentiation and mobilization of heart fibroblast progenitors. PLoS One. 8, e53694 (2013).
  42. Garriock, R. J., Mikawa, T., Yamaguchi, T. P. Isolation and culture of mouse proepicardium using serum-free conditions. Methods. 66, 365-369 (2014).
  43. Smart, N., Riley, P. Derivation of epicardium-derived progenitor cells (EPDCs) from adult epicardium. Curr Protoc Stem Cell Biol. (2009).
  44. Zhou, B., Pu, W. T. Isolation and characterization of embryonic and adult epicardium and epicardium-derived cells. Methods Mol Biol. 843, 155-168 (2012).
  45. Morabito, C. J., Dettman, R. W., Kattan, J., Collier, J. M., Bristow, J. Positive and negative regulation of epicardial-mesenchymal transformation during avian heart development. Dev Biol. 234, 204-215 (2001).
  46. Grieskamp, T., Rudat, C., Ludtke, T. H., Norden, J., Kispert, A. Notch signaling regulates smooth muscle differentiation of epicardium-derived cells. Circ Res. 108, 813-823 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics