Epikardiella utväxt Kultur-analys och

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Trembley, M. A., Velasquez, L. S., Small, E. M. Epicardial Outgrowth Culture Assay and Ex Vivo Assessment of Epicardial-derived Cell Migration. J. Vis. Exp. (109), e53750, doi:10.3791/53750 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Ett enda skikt av epikardiella cellinjer hjärtat, vilket ger parakrina faktorer som stimulerar cardiomyocyte proliferation och direkt bidrar kardiovaskulära progenitorer under utveckling och sjukdom. Medan ett antal faktorer har varit inblandade i epikardium härrörande cell (EPDC) mobilisering är de mekanismer som styr deras efterföljande migration och differentiering dåligt kända. Här presenterar vi in vitro och ex vivo strategier för att studera EPDC motilitet och differentiering. Först beskriver vi en metod för att erhålla primära epikardiella celler genom utväxt kultur från den embryonala mus hjärta. Vi presenterar också ett detaljerat protokoll för att bedöma tredimensionella migration av märkt EPDC i ett organkultursystem. Vi styrka med hjälp av dessa tekniker som genetisk deletion av myocardin relaterade transkriptionsfaktorer i epikardium dämpar EPDC migration. Denna strategi fungerar som en plattform för att utvärdera kandidatmodifierings av EPDCbiologi och skulle kunna användas för att utveckla genetiska eller kemiska skärmar för att identifiera nya regulatorer av EPDC mobilisering som kan vara användbara för hjärt reparation.

Introduction

Epikardium är ett enda skikt av mesotelceller som linjer hjärtat och effekter hjärt utveckling, mognad och reparation. Genom ett starkt samordnat utbyte av parakrina signaler, är oumbärlig för hjärt tillväxt och bildandet av icke-myocyt hjärt linjer 1 intim dialog mellan hjärtmuskeln och epikardium. Epikardiella härledda celler (EPDC) dyker upp från en delmängd av epikardiella celler genom en epitelial-till-mesenkymala övergång (EMT) 2, invadera subepicardial utrymme och underliggande myokardium, och differentierar till stor del in i krans vaskulära väggceller och hjärt fibroblaster, och till en mindre utsträckning, endotelceller och kardiomyocyter 3-9.

De mekanismer som reglerar epikardiell EMT och EPDC invasion har tillskrivits den samordnade åtgärder av olika molekyler inkluderande utsöndrade ligander 10-13, cellytreceptorer och adhesionsmolekyler 14,15, förordrer av apikal-basal polaritet 16,17, små GTPases 18,19, och transkriptionsfaktorer 2,20,21. Även om många av de molekylära effektorer av EPDC migration har definierats, till en bättre förståelse av de fysiologiska signaler som stimulerar EPDC mobilisering i embryot kan påskynda utvecklingen av strategier manipulera denna process i den vuxna för förbättrad hjärt reparation.

Studier som syftar till att identifiera nya regulatorer av EPDC mobilisering lita på rening av denna cellpopulation eller spåra migration av enskilda epikardiella celler. En eller en kombination av markörgener, inklusive WT1, Tcf21, Tbx18, och / eller Aldh1a2, används ofta för att identifiera den fetala epikardium 1. Emellertid till användningen av dessa markörer spåra migrera EPDC inte är optimal eftersom uttryck av epikardiella markörer avtar under loppet av hjärtutveckling och är ofta förlorade när epikardiella celler undergår transdifpassad in i mesenkymala celler.

Tillämpningen av Cre / loxP-systemet, i samband med linje-spårning reportrar, har varit till nytta för permanent märkning av epikardium och dess ättlingar under hjärt utveckling och efter ischemisk skada i vuxen 7,22,23. Har genererats flera epikardiella begränsade Cre linjer och används ofta för att märka EPDC och för villkorlig gendeletion strategier 1. Dessa studier har lett till karakteriseringen av olika epikardiella linjer, och identifiering av kritiska förmedlare av EPDC motilitet och differentiering. Tyder emellertid på att ackumulera bevis också epikardium är en heterogen population av progenitorceller 4,24,25. Således kommer endast en delmängd av epikardiella celler målsökas med användning av en given Cre förare.

För att märka hela epikardium oavsett Cre specificitet, har ett antal laboratorier utnyttjade utväxt culture system eller ex vivo organodlingsmetoder för att troget isolera eller märka epikardiska celler utan beroende på uttrycket av en genetisk härstamning markörer 26-28. För ex vivo studier migration, är embryonala hjärtan isoleras före epikardiell EMT och odlades i medium kompletterat med ett grönt fluorescerande protein (GFP) -uttryckande adenovirus (Ad / GFP) 9,18. Detta tillvägagångssätt möjliggör effektiv märkning av hela epikardium i stället för en underuppsättning av celler genom Cre-medierad rekombination. Hjärta kulturer därefter utsätts för kända inducerare av EMT att stimulera mobiliseringen av EPDC 28,29. Ex vivo och in vivo analyser kompletteras med in vitro epikardiella Explantation kulturer, som är en särskilt användbar metod för att utforska detaljerade mekanismer som driver EPDC migration.

Här beskriver vi metoder för att isolera primära epikardiella celler för in vitro studier av epicardial EMT, samt ett organ odlingssystem för ex vivo-analyser av EPDC motilitet. Vi har nyligen visat nyttan och robusthet denna metod genom genetiskt modulera myocardin relaterade transkriptionsfaktor (MRTF) / serumresponsfaktorn (SRF) signalerar axel för att manipulera aktin baserad migrering av EPDC 9. Medan våra iakttagelser markerar en reaktionsväg som är nödvändiga för att reglera EPDC migration signalering, är dessa metoder är lämpliga för unraveling de mekanismer som kollektivt orkestrera EPDC migration och differentiering. Vidare kan explantatet och ex vivo kultursystem implementeras i funktionella skärmar för att identifiera nya regulatorer av EPDC mobilisering för terapeutiska tillämpningar i hjärtregenerering.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

OBS: Alla experiment med möss godkändes av University kommittén för djurs Resources vid University of Rochester.

1. epikardiella utväxt Culture Assay (Figur 1A)

  1. preparat
    1. Förbereda 5 ml medium A för primär epikardiell cellisolering genom att komplettera medium 199 (M199) med 5% fetalt bovint serum (FBS) och 1% penicillin / streptomycin (Pen / Strep).
    2. Pre-varmt medium A och 100 ml Hanks balanserade saltlösning (HBSS) i en 37 ° C vattenbad.
    3. Tillåta kollagenbelagda kammarglas värmas till rumstemperatur under 30 min.
    4. Tillsätt 100 | il medium A till varje brunn i kammarobjektglas och försiktigt rotera för att jämnt belägga kollagenytan. Upprepa för 8-12 brunnar. Ta bort media efter beläggningskammare.
    5. Alikvotera förvärmas HBSS i två 10 cm 2 plattor innehållande 50 ml vardera av HBSS.
  2. Isolera embryonala hjärtan från gravida dammen vid 11,5 dagar Post Coitum (DPC).30
    1. Söva mus med 0,5 ml av 13 mg / ml ketamin / 0,88 mg / ml xylazin cocktail i 1x Dulbeccos fosfatbuffrad saltlösning (DPBS) via intraperitoneal injektion. Bekräfta korrekt anesthetization med hjälp av en tå nypa test. En mild nypa är tillräcklig för att avgöra om musen reagerar. Varje förflyttning eller tass återkalla indikerar djuret inte är tillräckligt sövda att göra operationen. Avliva genom cervikal dislokation.
    2. Lägg musen vänd ventrala sidan uppåt och spraya buken med 70% etanol för att minska kontaminering av hår.
    3. Nyp ihop huden med pincett och skär ett lateralt snitt på buken med kirurgisk sax. Håll huden ordentligt och sedan dra isär i motsatta riktningar mot huvud och svans.
    4. Nyp bukhinnan med pincett och skars med sax för att exponera bukhålan.
    5. Försiktigt bort decidua genom att skära längs mesometrium. Överför dissekerade decidua att förvärmas HBSS i första10 cm 2 tallrik.
    6. Separera decidua genom att skära mellan embryon.
    7. Överför ett embryo till den andra 10 cm 2 tallrik med förvärmda HBSS under ett dissektionsmikroskop. Försiktigt bort extraembryonic vävnad och gulesäcken, sedan halshugga embryot.
    8. Nyp bröstkorgens vägg med pincett och riva vävnaden isär vid mittlinjen, utsätta brösthålan.
    9. Placera pincetten bakom hjärtat. Ta tag i utflöde och dra hjärtat bort från embryot. Separera den lungvägarna och lungorna från hjärtat, om det fortfarande fäst.
  3. Överför hjärtat till en enda brunn i kollagenbelagda bild och placera den ryggsidan nedåt (Figur 1B). Upprepa steg 1.2.7-1.3 för varje embryo.
  4. När väl alla hjärtan har överförts till enskilda brunnar, inkubera kammarobjektglas för 30 min vid 37 ° C, för att 5% CO2 medge tillräcklig vidhäftning till kollagenmatrisen.
  5. tillsätt försiktigt20-50 pl förvärmda Explantation medium A runt varje hjärta. Viktigt: Lägg inte till mediet för snabbt eller till en nivå ovanför hjärtat, annars hjärtan kan lossna från kollagensubstrat.
  6. Kultur hjärtan vid 37 ° C, 5% CO 2 för cirka 24 timmar för att tillåta epikardiell utväxt. Obs: utväxter kan observeras så tidigt som 3-4 timmar av kultur (Figur 1C) och huvudsakligen består av mesotelceller visar kullerstensbelagd morfologi, med minimal förorenings mesenkymala cell (figur 1D, E). Representativa resultat har förvärvats med hjälp av en dissektion mikroskop utrustat med en kamera.

2. Genetisk ablation och induktion av EMT i epikardial utväxter

Varning: Hantera adenovirus med vård enligt godkända riktlinjer biosäkerhet.

  1. Förbered 15 ml medium B (M199 som kompletterats med 1% FBS och 1% Pen / Strep) och pre-värm till 37 ° C i ett vattenbad.
  2. För excision avfloxed alleler, förbereda Explantation medium B kompletterat med 2,5 x 10 4 pfu / ml adenovirus som uttrycker Cre rekombinas (Ad / CRE) eller kontrollvirus.
    Notera: Adenoviral medierad överexpression av kandidatgener kan också utföras för att utvärdera förstärkningen av funktions fenotyper. Virustitrar bör bestämmas av slutanvändaren.
  3. Försiktigt bort epikardium utarmade hjärtan från utväxt kulturer med hjälp av pincett. Överför hjärtan till 1,5 ml rör med 800 l Trizol och förvara vid -80 ° C för senare RNA-isolering och genuttryck analys.
  4. Tvätta varje brunn med DPBS för att avlägsna blodkroppar och överskott cellrester.
  5. Tillsätt 500 | il explantat-medium B med tillsats av adenovirus (es) till varje utväxt kulturen och inkubera i 24 h vid 37 ° C, 5% CO2.
  6. För EMT induktion, ta bort media och fylla med 37 ° C Explantation medium B kompletterat med rekombinant transformerande tillväxtfaktor (TGF) -β1 [10 ng / ml] eller fordon (4 mM hydrochloric syra (HCl) innehållande 1 mg / ml bovint serumalbumin (BSA)). Odlings explantat för en ytterligare 24 h vid 37 ° C, 5% CO2. Fortsätt med gen / proteinuttryck analyser eller immunocytokemi som beskrivs i de efterföljande protokoll.
    Anmärkning: Induktion av epikardiell EMT har stimulerats med olika koncentrationer av TGF-β1 som sträcker sig från 0,5 ng / ml - 10 ng / ml 26,31-33. Högre koncentrationer av ligand kan resultera i icke-specifik bindning till alla TGF-β-receptorer. Koncentrationen av TGF-β1 bör avspegla de särskilda experimentella mål.

3. Gene Expression Analys av epikardiella utväxter

  1. Tina epikardium utarmade hjärtan tidigare lagrats i Trizol (2,2).
  2. Aspirera media från EPDC kulturer och tvätta två gånger med DPBS.
  3. Tillsätt 800 | il rumstemperatur Trizol att explantation kulturer.
  4. Inkubera epikardium utarmade hjärtan och EPDC kulturer i Trizol under 5 minuter vid rumstemp re. Pipettera upp och ner tio gånger för att homogenisera den lyserade provet.
    Obs: Hearts kan kräva ytterligare pipettering helt homogenisera.
  5. Överför lysat till 1,5 ml rör och fortsätt med total RNA isolering enligt tillverkarens anvisningar. Tillsätt 10 mikrogram glykogen före utfällning att öka RNA avkastning. En given explantatet kommer att ge cirka 0,5-1,0 mikrogram RNA.
  6. Avlägsna kontaminerande DNA med DNas I och omvänt transkribera 0,5 pg mRNA enligt tillverkarens anvisningar.
  7. Validera renheten hos epikardiella explantat och / eller induktion av EMT med kvantitativ omvänd transkription (QRT) -PCR 34 med användning av SYBR grön och markörerna beskrivna i tabell 1. Normalisera mRNA-nivåer till glyceraldehyd 3-fosfatdehydrogenas (GAPDH) och beräkna relativa uttryck med hjälp av 2 - ΔΔCt metod 35. Typiska resultat visas i figur 2A.
Titeln "> 4. Proteinanalys av epikardiella utväxter

  1. Aspirera media från EPDC kulturer och tvätta två gånger med DPBS.
  2. Tillsätt 10 | il iskall protein lysbuffert (50 mM Tris pH 7,5, 150 mM natriumklorid, 1 mM etylendiamintetraättiksyra pH 8,0, 1% Triton X-100, 1x proteasinhibitorcocktail) till varje kammare väl och placera kammaren glida på is. Skär av ungefär en fjärdedel av botten på en P200 pipettspets och använda de återstående bit för att skrapa cellerna bort av bilden. Pipettera upp och ner för att lysa epikardiella celler och överföring till ett 1,5 ml rör.
  3. Sonikera lyserade explantat på låg (160 W) under 5 min i ett isvattenbad med 30 sek ON och OFF cykler.
  4. Centrifugera lysates under 10 minuter vid 10.000 xg, 4 ° C. Överför supernatanten till ett nytt rör och bestämma proteinkoncentrationen med användning av en proteinanalys 36.
    Obs: En given explantatet kommer att ge upp till 1,5 mikrogram totalt protein. Vi har funnit att poola explants från två hjärtan ettd lastning 2 mikrogram protein per brunn är tillräckligt för att upptäcka glatt muskulatur α-aktin (ACTA2) och GAPDH 9. Detektering av andra målproteiner kan kräva att samla flera Explantation prover bestäms av slutanvändaren.

5. Immuncytokemi av epikardial utväxter

  1. Ta bort materialet från Explantation kulturer och tvätta två gånger med DPBS.
  2. Försiktigt tillsätt 500 pl av 4% (volym / volym) paraformaldehyd eller iskall metanol till varje brunn och fixera explantat under 5 minuter vid rumstemperatur eller 10 min vid -20 ° C, respektive. Fix enligt specifikationerna antikropps som rekommenderas av tillverkaren.
  3. Ta bort fixativ och skölj varje brunn med DPBS tre gånger under 5 min.
  4. Permeabilisera cellerna med 500 | il av 0,1% (volym / volym) Triton X-100 i DPBS för 5 min.
  5. Ta permeabilization lösning och skölj med DPBS tre gånger under 5 min.
  6. Blockera cellerna med 10% serum i DPBS under 30 min vid rumstemperatre.
  7. Vidare med primär antikropp-färgning enligt tillverkarens rekommendationer och optimala förhållanden som bestäms av slutanvändaren.
  8. Avlägsna antikropplösning och skölj med DPBS tre gånger under 5 min.
  9. Applicera sekundär antikropp enligt tillverkarens anvisningar och motfärg med en lämplig kärn färgämne.
  10. Avlägsna antikropplösning och skölj med DPBS tre gånger under 5 min.
  11. Ta kammarglid väggar enligt tillverkarens instruktioner och lägga vattenmonteringsmedium direkt till cellerna. Placera en täck över cellerna och försegla med nagellack. Typiska resultat visas i Figur 2B - 2D med hjälp av inverterad konfokala scanning mikroskopi.

6. Ex vivo Culture Assay (figur 3A)

  1. preparat
    1. Förbered 12 ml ex vivo odlingsmedium med användning av en (1: 1) blandning av Dulbeccos modifierade Eagle-medium (DMEM): M199 som kompletterats med 10%FBS och 1% Pen / Strep.
    2. I ett 37 ° C vattenbad, för-varm ex vivo odlingsmedium och 100 ml HBSS.
    3. Alikvotera 1 ml förvärmda mediet i 8-12 brunnar i en platta med 24 brunnar.
    4. Transfer förvärmas HBSS till två 10 cm 2 plattor, innehållande 50 ml vardera.
  2. Isolera mus embryonala hjärtan i HBSS (som beskrivs i 1.2) från gravida dammar på 12,5 DPC.
  3. Överför varje hjärta till en enda brunn i 24 brunnar innehållande ex vivo odlingsmedium. Inkubera plattan vid 37 ° C, 5% CO2 med försiktig skakning för hand eller med hjälp av en vaggande plattform för att förhindra vidhäftning. Omedelbart vidare till steg 7,1.

7. epikardisk Märkning och EMT Induktion i Ex Vivo kulturer

  1. För att märka epikardium, förbereda 12 ml 37 ° C ex vivo odlingsmedium kompletterat med 3,0 x 10 6 pfu / ml Ad / GFP. För riktade ablation av floxed alleler, överföring 6 ml Ad / GFP kompletterat odlingsmedium till en ny 15 ml koniska rör. Lägga Ad / Cre eller kontrollera adenovirus till en slutlig koncentration av 1,5 x 10 6 pfu / ml.
    Anmärkning: Gain av funktion-analyser kan också utföras med lämplig adenoviral medierad gentillförsel.
  2. Försiktigt bort odlingsmediet från varje brunn i 24-brunnsplatta med användning av en P1,000 pipettspetsen.
  3. Försiktigt lägga odlingsmedium kompletterat med adenovirus (er) till varje brunn.
  4. Inkubera plattan vid 37 ° C, 5% CO2 under 24 h med försiktig skakning.
  5. För EMT induktion, förbereda 12 ml 37 ° C ex vivo odlingsmedium innehållande 10 ng / ml TGF-β1 och 20 ng / ml blodplättshärledd tillväxtfaktor (PDGF) -BB eller vehikel (4 mM HCl innehållande 1 mg / ml BSA ).
  6. Försiktigt bort odlingsmedium från varje brunn i 24-brunnsplatta med användning av en P1,000 pipettspetsen. Skölj försiktigt hjärtan med 1 ml DPBS.
  7. Ta bort DPBS och fylla hjärtan med ex vivo kultur migDIUM innehållande TGF-β1 och PDGF-BB eller vehikel.
  8. Inkubera i 24 h vid 37 ° C, 5% CO2 med försiktig skakning.

8. Frysförvaring och Immunohistokemi av Ex Vivo kulturer

  1. Förbered hjärtan för Frysförvaring.
    1. Ta bort odlingsmedium och tvätta hjärtan två gånger med iskall DPBS.
    2. Tillsätt 1 ml 4% (volym / volym) paraformaldehyd till varje hjärta och fixa under 2 h vid 4 ° C med försiktig skakning.
    3. Ta bort fixativ och tvätta hjärtan två gånger med DPBS. Överför hjärtan färska brunnar med 1 ml 10% (w / v) sackaros framställd i DPBS. Inkubera plattan över natten vid 4 ° C med försiktig skakning.
    4. Överför försiktigt hjärtan till nya brunnar med 18% (w / v) sackaros framställd i DPBS. Inkubera plattan över natten vid 4 ° C med försiktig skakning.
    5. Överför varje hjärta till en cryomold innehåller vävnadsfrysmedium. Omedelbart frysa block med flytande kväve och förvaras vid -80 & #176; C.
  2. Avsnitt hjärtan på 5 um med hjälp av en kryostat och placera vävnadssnitt på positivt laddade objektglas. Store glider vid -80 ° C tills färgning.
  3. Utför immunohistokemi på snitt för detektering av under epikardiella basalmembranet.
    1. Tina glider under åtminstone 30 minuter vid rumstemperatur.
    2. Rehydrera sektionerna genom tvättning två gånger i DPBS under 5 min med försiktig skakning.
    3. Permeabilisera sektion med 0,1% (volym / volym) Triton X-100 i PBS i 5 min vid rumstemperatur.
    4. Tvätta bilderna två gånger i DPBS under 5 min med försiktig skakning.
    5. Blot bort överflödigt DPBS och definiera färgning region med en hydrofob märkning penna. Blockera sektioner med 10% serum i DPBS under 30 min vid rumstemperatur.
    6. Ta bort block och tillämpa kollagen typ IV antikropp (ColIV, 1: 200) utspädd i blocket. Inkubera över natten vid 4 ° C i en fuktighetskontrollerad kammare.
    7. Tvätta bilderna tre gånger i DPBS för5 min med försiktig skakning.
    8. Späd fluorescerande konjugerad sekundär antikropp (1: 500) och DAPI (1: 5000) i DPBS och gäller för bilderna. Inkubera under en timme vid rumstemperatur. Välj en lämplig sekundär antikropp med en emissions och excitationsvåglängd skiljer sig från GFP.
    9. Tvätta bilderna tre gånger i PBS under 5 min med försiktig skakning. Mount glider med monteringsmedium.

9. Imaging och kvantifiering av Ex Vivo kulturer

  1. Har en blindad användarbild och kvantifiera färgade sektioner. Bild minst fem sektioner icke på varandra följande vävnad från ett givet hjärta i 4-5 godtyckliga ställen längs epikardium (kanten av hjärtat) med användning av en fluorescerande eller konfokalt mikroskop vid 40X förstoring. Typiska resultat visas i figur 3B med hjälp av inverterad konfokala scanning mikroskopi.
  2. Manuellt räkna det totala antalet GFP-positiva celler i en given bild. Identifiera migrera EPDC som GFP pokänslig celler belägna inom eller utanför ColIV subepicardial basalmembranet. Bestämma procent av GFP migrerande celler som antalet migrerande GFP positiva celler över det totala antalet GFP-positiva celler i en given bild. Typiska resultat visas i figur 3C-D med hjälp av inverterad konfokala scanning mikroskopi.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Epikardium kan effektivt isoleras med hjälp av en utväxt odlingsanalys genom att dra nytta av dess yttre läge och utnyttja utvecklings plasticitet och inneboende vandrande beteende EPDC. Murina embryonala hjärtan är isolerade vid E11.5 före epikardiell EMT och odlades ryggsidan nedåt på kollagenbelagda kammarglas 26 (figur 1 A, B). Explanterade hjärtan kommer att fortsätta att ingå avtal; kommer emellertid epikardium vidhäfta till kollagenmatrisen och migrera ut från myokardiet inom 24 h av odling (Figur 1C). Epikardiska celler kan observeras som härrör från hjärtat med gatsten liknande morfologi, indikativ för mesotelceller identitet (figurerna 1C-E). Efter 24 timmar av kultur, epikardium utarmade hjärtan bort för gen eller proteinuttrycksanalys.

Förutom att observera epithelial morfologi, kan renheten hos epikardiella cellkulturer ytterligare valideras av uttrycket av epikardiella begränsade gen och proteinmarkörer. Epikardiella cell explantat visa robust uttryck av epikardiella och mesotelceller markörer (Aldh1a2, Tcf21 och WT1) och låg expression av cardiomyocyte gener (Nkx2-5 och Myh7) jämfört med epikardium utarmade hjärtan (Figur 2A). För att ytterligare kontrollera identiteten är epikardiella cellkulturer fast 48 timmar efter hjärt borttagning och co-färgades med antikroppar mot Wilms tumör 1 (WT1) och zona occludens protein 1 (ZO1) att märka mesotelceller och inter täta förbindelser, respektive 37,38 ( Figur 2B). Denna utväxt odlingsmetod ger en relativt hög renhet av mesotelceller; emellertid kan användarna observera en liten andel av cellerna kontamineras. Fibroblaster och glatta muskelceller uppvisar ett långsträckt mesenkymala fenotyp med en noterbar frånvaro av nuclear WT1 och organiserade tight junctions (Figur 2C). Felsökning tekniker för att begränsa mängden icke-epikardiella kontamination cell expanderas i diskussionen.

Explantation utväxt analysen är ett användbart odlingssystem för förhör epikardiella biologi in vitro. För att demonstrera epikardiella cell plasticitet, var explantat stimulerades med TGF-β1 [10 ng / ml] för att inducera transdifferentiering in i mesenkymala celler 26,28. Efter 24 h av stimulering, EPDC anta en mesenkymala fenotyp med reducerad ZO1 färgning och robust de novo bildning av glatt muskel-a-aktin positiva spänningsfibrer (ACTA2 eller SMA), speciellt vid periferin av kulturen 39 (figur 2D, röd). I motsats till betona fiberenhet i utkanten av explantat, sammanflytande epikardiella celler med mer definierade inter kontakter (ZO1, grön) i centrum av en monolayer display ACTA2 proteinuttryck i kortikala aktin.

Förutom att genomgå EMT, kommer EPDC invadera myokardiet och differentiera, utgöra en väsentlig andel icke-cardiomyocyte populationer. Motilitet EPDC kan bedömas med hjälp av en tidigare etablerad ex vivo organkultur system där utsidan av E12.5 hjärtan är märkta med ett adenovirus som uttrycker GFP 9,18 (Figur 3A). Märkta hjärtan är ytterligare odlas under tre dagar i närvaro av TGF-β1 [10 ng / ml] och PDGF-BB [20 ng / ml] för att främja EPDC migration. Organkulturer skall periodvis roteras för att förhindra vidhäftning av ex vivo-hjärtan till ytan av odlingsplattor. Detta system möjliggör effektiv märkning av hela epikardium och bedömning av EPDC motilitet i en tredimensionell modell i motsats till riktnings migration med in vitro skrap analyser. Migreringen av EPDC är observed som invasionen av GFP positiva epikardiella celler in i eller bortom ColIV (röd) subepicardial basalmembran 16 (Figurerna 3B, C). För att illustrera användbarheten av detta system, har vi nyligen visat att manipulering av MRTF / SRF signalering axel kan påverka motiliteten hos EPDC 9. Strykning av Mrtfa och Mrtfb av Cre-medierad excision av floxed alleler (MRTFdKO) dämpar migrering av EPDC i subepicardial utrymme. Omvänt, tvångs expression av MRTF-A (Ad / MRTF-A) i C57BL / 6 hearts resulterar i ökad EPDC migration och störning av ColIV basalmembranet (figurerna 3C, D).

Gen Fram Omvänd NCBI accessionsnummer
Aldh1a2 GGCACTGTGTGGATCAACTG TCACTTCTGTGTACGCCTGC NM_009656
GAPDH CGTGCCGCCTGGAGAAAC TGGGAGTTGCTGTTGAAGTCG NM_001289726
Myh7 GTGGCTCCGAGAAAGGAAG GAGCCTTGGATTCTCAAACG NM_080728
Nkx2-5 GACGTAGCCTGGTGTCTCG GTGTGGAATCCGTCGAAAGT NM_008700
Tcf21 CATTCACCCAGTCAACCTGA CCACTTCCTTCAGGTCATTCTC NM_011545
WT1 ATCCGCAACCAAGGATACAG GGTCCTCGTGTTTGAAGGAA NM_144783

Tabell 1: Sekvenser av framåt och bakåt primers som användes för validering av epikardiella utväxt kultur renhet genom analys av epikardium och myokardium Restricted Gene Expression genuttryck bestäms av QRT-PCR wi.th följande parametrar: denaturera vid 95 ° C under 10 sek; glödgning vid 60 ° C under 30 sek; upprepa 50x cykler.

Figur 1
Figur 1: Isolering av primär epikardiella celler med en utväxt Culture Assay (A) En schematisk bild av epikardiella utväxt Explantation analys med en rekommenderad tidsplan för epikardiella modulering och analys.. (B - E) Representativa bright bilder av olika tidpunkter under explantatet analys. (B) Embryonala dag E11.5 murina hjärtan placeras ryggsidan nedåt på en kollagensubstrat. (C) epikardiella celler (vita pilspetsar) kommer att börja migrera bort hjärtat inom 3-4 timmar av kultur. Blodkroppar (svarta pilar) kan ansamlas i närheten eller täcka explantat under epikardiell utväxt. (D, E) Eftercirka 24 timmar av kultur, hjärtan avlägsnas och epikardiella mono förblir vidhäftade till kammaren bilden. Cellulära utväxter visar epitelial morfologi med en gatsten liknande arrangemang av celler. Skalstrecken = 250 ^ m (BD) eller 50 | j, m (C, E). H = hjärta, LA = vänster förmak, LV = vänster kammare, OFT = utflöde, RA = höger förmak, RV = höger kammare. Klicka här för att se en större version av denna siffra.

figur 2
Figur 2: Utvärdering av epikardiella Cell utväxt Renhet (A) QRT-PCR validering av epikardiella begränsad markörer (Tcf21, Aldh1a2 och WT1) i utväxt kulturer jämfört med hjärtinfarkt genuttryck (Nkx2-5 och Myh7) i epikardium-utarmat E11.. 5 hjärtan. Data repret medelvärde ± SEM (n = 8 per grupp). Asterisker betecknar statistisk signifikans med användning av ett Student T-test med **** P <0,0001. (B) Representativa co-immunofluorescerande färgning av ostimulerade utväxter för epikardiella uttryck (WT1, röd), inter täta förbindelser (ZO1, grönt) och kärnor (DAPI, blå). (C) Ett exempel på kontamine cell i en utväxt kultur. Epikardiella celler (asterisk) observeras till höger på panelen med karakteristiska mesothelial identitet (kärn WT1, röd) och organiserade epiteliala tight junctions (ZO1, grön). De angränsande cellerna i centrum (vita pilspetsar) uppvisar en långsträckt mesenkymala morfologi, visat genom differentiell interferenskontrast (DIC) avbildning, med minimal kärn WT1 protein och oorganiserade ZO1 färgning. (D) epikardiell cellkulturer stimulerades med vehikel (4 mM HCl i 1 mg / ml BSA) eller TGF-β1 [10 ng / ml] för att inducera epikardiellEMT. TGF-β1 stimulering befrämjar robust uttryck av ACTA2 (röd) i kortikala regioner av konfluenta celler i centrum för explantat eller i stressituationer fibrer av celler som migrerar vid kanten eller periferin av monoskiktet. Cell sammanväxningar är märkta genom ZO1 (grön). Skalstrecken = 25 nm (BD). Klicka här för att se en större version av denna siffra.

Figur 3
Figur 3: Ex vivo Bedömning av EPDC motilitet (A) En schematisk tidslinje ex vivo hjärtodlingsanalys.. (B) Ett representativt 5 ^ m sektion av en C57BL / 6 E12.5 hjärta transducerad med Ad / GFP (grön) under 24 h för att märka det yttre av hjärtat. Ex vivo hjärtan var därefter odlas under ytterligare 48 h med TGF- β1 [10 ng / ml]och PDGF-BB [20 ng / ml] för att stimulera EPDC migration. Sektioner co-färgades för ColIV (röd) för att märka subepicardial basalmembranet och kärnor (DAPI, blå). Ex vivo hjärta kultur morfologi visas av DIC. LV = vänster kammare, RV = höger kammare, RA = höger förmak. (C, D) Ett exempel tillämpning av vivo migration assay genom att modulera MRTF / SRF reglerande axeln ex. Denna siffra har modifierats [9]. E12.5 hjärtan isolerades från Mrtfa - / -;. Mrtfb fl / fl embryon och transducerades med Ad / GFP och ett kontrollvirus eller ett adenovirus som uttrycker Cre-rekombinas för 24 tim Ex vivo-kulturer stimulerades sedan med TGF-β1 [10 ng / ml] och PDGF-BB [20 ng / ml] under ytterligare 48 timmar. EPDC motilitet (vita pilar) observeras som migreringen av GFP-positiva celler (gröna) in i eller bortom ColIV (röd). Cre-medierad deletion av Mrtfb i <em> Mrtfa - / - bakgrund (MRTFdKO) resulterar i dämpning av EPDC migration jämfört med kontroll hjärtan. Omvänt, tvingade uttryck av MRTF-A (Ad / MRTF-A) i E12.5 C57BL / 6 hearts förbättrar EPDC migration. (D) Kvantifiering av% GFP positiv cell migration. Data presenteras som medelvärdet ± SEM (n = 4 hjärtan för varje betingelse). Data analyserades med användning av en en-vägs ANOVA med asterisker betecknar statistisk signifikans genom Tukeys post-hoc-tester med **** P <0,0001. Skalstrecken = 200 | j, m (B) eller 25 | j, m (C). Alla bilder förvärvades med hjälp av inverterad konfokala laserskanning mikroskopi. Klicka här för att se en större version av denna siffra.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Här redogör vi detaljerade metoder för att isolera primära epikardiella cell genom utväxt och spåra EPDC migration i ex vivo hjärt kulturer. För utväxt kulturer, lämplig tidpunkt för att avlägsna epikardium utarmade hjärta varierar något mellan experiment. Regelbunden kontroll av explantaten efter en inkubation över natten rekommenderas att bedöma omfattningen av epikardiella utväxt och extrahera hjärtat före fibroblaster visas. För att säkerställa renhet, bör hjärtan tas bort inom 24 timmar av explantation att förhindra ansamling av icke-epikardiella linjer. Trimning bort utflöde och båda förmaken före överföring av hjärtat till en kammare diabild kan också minska förorenande celltyper 27,40. Eftersom foster hjärtan isoleras från en mus kull under ett smalt fönster tid och odlades under samma betingelser, är det dags för utväxter ska visas relativt lika från ett hjärta till en annan inom ett experiment. Därför bör alla hjärtan be bort när majoriteten av explantat uppvisar epikardiella utväxter. I vissa fall behöver epikardiella celler inte migrerar ut effektivt från ett hjärta som är avtalsslutande mer kraftfullt än de andra, i vilket fall Explantation måste undantas från experimentet.

Ansamling av blodceller kan ofta dölja en platt monoskikt av epikardiella celler (pilar, figur 1C), vilket gör det svårt att visualisera utväxter. Att undvika överdriven blodcell bidrag, kan hjärtan förbli i HBSS under några minuter vid dissektion från embryot. Detta ger tillräckligt med tid för fostrets hjärta att pumpa ut kvarvarande blod i hjärtkamrarna innan de överförs till en kammare bild. Alternativt kan komplettera kulturerna med Explantation medium A efter den första natten inkubation hjälpa till att spola bort en del överflödigt blod och avslöjar utväxter; emellertid bör nivån av medierna inte stiga över hjärtat som ytspänningen kan leda till att hjärtatatt dra bort från substratet. Robust epikardiella utväxter observeras när kollagen typ I som odlingssubstrat; har dock andra substrat rapporterats beroende på organismen och / eller program 27,40-42. Med hjälp av detta protokoll, kan primära fetala epikardiella celler frodas under 4 dagar efter hjärt borttagning och daglig medel påfyllning; emellertid bör experimentell design som kräver längre perioder av odling bestämmas av slutanvändaren. Eftersom epikardiella EMT är starkt aktiveras under embryonal utveckling, är denna utväxt odlingsteknik begränsad till anrikning av fetala epikardiella celler. Andra grupper har beskrivit metoder för att isolera vuxna epikardiella celler 43,44.

För ex vivo migrationsanalyser, hjärta utvinning och epikardiella cell märkning rekommenderas vid E12.5 av två skäl. Först hjärtan isolerade efter E12.5 är större och därmed kräver mer perfusion för att stödja livsduglighet. Enkel diffusion av näringsämnens är inte tillräcklig för att upprätthålla organkulturer från större hjärtan. För det andra, epikardiella EMT och EPDC migration ske omkring E12.5. Därför bör epikardium märkas med ett adenovirus som uttrycker ett fluorescerande protein omedelbart efter hjärt extraktion för att maximera detekteringen av EPDC. Alternativt har karboxifluorescein-diacetat succinimidylester (CFSE) tidigare rapporterats för att märka det yttre av hjärtat och spår EPDC migration 10,45.

I motsats till utväxt analyser bör ex vivo kulturer gungas jämna mellanrum för att undvika hjärt fastsättning och epikardiella cell utväxt. Kulturer kan också kontinuerligt skakas i en inkubator försedd med en rocker på den lägsta hastighetsinställningen. Användarna kommer att märka förändringar i hjärt morfologi inom några dagar av organkultur och bör undvika analyser än 72 timmar av hjärt isolering. Med hjälp av denna analys är EPDC invasion observeras inom 48-72 timmar av kultur. Medan Cre-loxP-systemethar använts in vivo för att kartlägga lokaliseringen av EPDC till kranskärlen, hjärtmuskeln interstitium, och skiljeväggen mellan kamrarna 7,22, denna ex vivo tekniken är begränsad till EPDC migration inom några cellager av sub-epikardiella utrymme. Således är denna metod mer lämplig för att bestämma regulatorer av EPDC motilitet och invasion snarare än att definiera den slutliga destinationen för att migrera EPDC.

Epikardiella cell isoleringar och ex vivo migrationsanalyser, i kombination med vinst eller förlust av funktions metoder har redan visat sig vara användbara för att utvärdera kandidatgener som kan påverka EPDC biologi 9,18,46. Dessa metoder ger också en plattform för vinst-of-funktion eller förlust av funktionsskärmar för att identifiera nya regulatorer av EPDC migration. Denna strategi, i samband med fluorescensaktiverad cellsortering eller enda cell RNA-sekvensering, kan också innebära en möjlighet att undersöka epikardiell heterogenitetoch EPDC differentieringen i större detalj. Slutligen modifikationer av dessa förfaranden kan användas för att utveckla skärmar för små molekyler som påverkar epikardiell cell och EPDC biologi för att hjärt regenerativ medicin.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har ingenting att lämna ut.

Acknowledgements

EMS har finansierats med bidrag från National Institutes of Health (NIH) [licensnummer R01HL120919]; American Heart Association [licensnummer 10SDG4350046]; University of Rochester CTSA utmärkelse från NIH [licensnummer UL1 TR000042]; och start medel från Aab CVRI. MAT stöddes delvis av bidrag till University of Rochester School of Medicine och tandvård från Howard Hughes Medical Institute Med-I-Grad initiativet; och ett institutionellt Ruth L. Kirschstein National Research Service Award från NIH [licensnummer GM068411].

Materials

Name Company Catalog Number Comments
Dulbecco's Modified Eagle Medium Hyclone  SH3002201 DMEM
Hanks' Balanced Salt Solution Hyclone SH3003102 HBSS
Medium 199 Hyclone SH3025301 M199
Dulbecco’s Phosphate-Buffered Saline  Hyclone SH3002802 DPBS
Fetal Bovine Serum  Gemini  100-106 FBS
Penicillin/Streptomycin Solution Hyclone SV30010
Corning Biocoat Collagen I, 4-Well Culture Slides Corning 354557
Multiwell 24-well plates Falcon 08-772-1
Dissecting microscope Leica M50 Equipped with Leica KL300 LED might source
Confocal miscroscope Olympus 1X81 Equipped with muli-argon laser 405/488/515, FV10-MCPSU laser 405/440/635, 559 laser, and mercury lamp
Bioruptor Diagenode  UCD-200
Transforming growth factor beta 1 R&D Systems 100-B-001 TGF-β1
Platelet-derived growth factor BB R&D Systems 220-BB-010 PDGF-BB
Trizol Reagent Applied Biosystems 15596-026 Caution, hazardous material
TURBO DNA-free Kit Life Technologies AM1907 DNaseI
iScript cDNA Synthesis Kit BioRad 1708891
UltraPure Glycogen Life Technologies 10814-010
SYBR Green BioRad 170-8880
Protease inhibtor cocktail tablets Roche 11836170001
Alexa Goat-anti-rabbit 488 Life Technologies A11008 Secondary antibody
Alexa Goat anti-rabbit 594 Life Technologies A-11012 Secondary antibody
Alexa Goat anti-mouse 594 Life Technologies A-11005 Secondary antibody
Mouse anti-smooth muscle alpha actin, Cy3-conjugated  Sigma-Aldrich C6198 monoclonal antibody, clone 1A4
Mouse anti-Wilms tumor 1 (WT1) Life Technologies MA1-46028 monoclonal antibody, clone 6F-H2
Rabbit anti-ZO1 Life Technologies 40-2200 polyclonal antibody
Rabbit anti-Collagen Type 4 Millipore AB756P polyclonal antibody
4',6-Diamidino-2-Phenylindole, Dihydrochloride  Life Technologies D1306 DAPI
Fluorescent mounting medium  DAKO S3023
16% Paraformaldehyde solution Electron Microscopy Sciences 15710 PFA diluted to 4% in DPBS. Caution, hazardous material
Sucrose Sigma-Aldrich S0389
Tissue Freezing Medium Triangle Biomedical Sciences TFM-B
Pap pen DAKO S2002
Disposable mictrotome blades  Sakura Finetek 4689
Microscope slides Globe Scientific 1358W positively charged, 25 mm x 75 mm x 1 mm
Cryostat  Leica CM1950
Forceps Fine Science Tools 11295-00
Surgical Scissors Fine Science Tools 91460-11
Disposable base molds Fisher Scientific 22-363-553
Ketamine Hospira NDC 0409-2051-05
Xylazine Akorn NADA 139-236

DOWNLOAD MATERIALS LIST

References

  1. von Gise, A., Pu, W. T. Endocardial and epicardial epithelial to mesenchymal transitions in heart development and disease. Circ Res. 110, 1628-1645 (2012).
  2. Martinez-Estrada, O. M., et al. Wt1 is required for cardiovascular progenitor cell formation through transcriptional control of Snail and E-cadherin. Nat Genet. 42, 89-93 (2010).
  3. Gittenberger-de Groot, A. C., Vrancken Peeters, M. P., Mentink, M. M., Gourdie, R. G., Poelmann, R. E. Epicardium-derived cells contribute a novel population to the myocardial wall and the atrioventricular cushions. Circ Res. 82, 1043-1052 (1998).
  4. Katz, T. C., et al. Distinct compartments of the proepicardial organ give rise to coronary vascular endothelial cells. Dev Cell. 22, 639-650 (2012).
  5. Mikawa, T., Gourdie, R. G. Pericardial mesoderm generates a population of coronary smooth muscle cells migrating into the heart along with ingrowth of the epicardial organ. Dev Biol. 174, 221-232 (1996).
  6. Wilm, B., Ipenberg, A., Hastie, N. D., Burch, J. B., Bader, D. M. The serosal mesothelium is a major source of smooth muscle cells of the gut vasculature. Development. 132, 5317-5328 (2005).
  7. Zhou, B., et al. Epicardial progenitors contribute to the cardiomyocyte lineage in the developing heart. Nature. 454, 109-113 (2008).
  8. Dettman, R. W., Denetclaw, W., Ordahl, C. P., Bristow, J. Common epicardial origin of coronary vascular smooth muscle, perivascular fibroblasts, and intermyocardial fibroblasts in the avian heart. Dev Biol. 193, 169-181 (1998).
  9. Trembley, M. A., Velasquez, L. S., de Mesy Bentley, K. L., Small, E. M. Myocardin-related transcription factors control the motility of epicardium-derived cells and the maturation of coronary vessels. Development. 142, 21-30 (2015).
  10. Mellgren, A. M., et al. Platelet-derived growth factor receptor beta signaling is required for efficient epicardial cell migration and development of two distinct coronary vascular smooth muscle cell populations. Circ Res. 103, 1393-1401 (2008).
  11. von Gise, A., et al. WT1 regulates epicardial epithelial to mesenchymal transition through beta-catenin and retinoic acid signaling pathways. Dev Biol. 356, 421-431 (2011).
  12. Lavine, K. J., et al. Endocardial and Epicardial Derived FGF Signals Regulate Myocardial Proliferation and Differentiation In Vivo. Dev Cell. 8, 85-95 (2005).
  13. Sanchez, N. S., Barnett, J. V. TGFbeta and BMP-2 regulate epicardial cell invasion via TGFbetaR3 activation of the Par6/Smurf1/RhoA pathway. Cell Signal. 24, 539-548 (2012).
  14. Dettman, R. W., Pae, S. H., Morabito, C., Bristow, J. Inhibition of 4-integrin stimulates epicardial-mesenchymal transformation and alters migration and cell fate of epicardially derived mesenchyme. Dev Biol. 257, 315-328 (2003).
  15. Rhee, D. Y., et al. Connexin 43 regulates epicardial cell polarity and migration in coronary vascular development. Development. 136, 3185-3193 (2009).
  16. Wu, M., et al. Epicardial spindle orientation controls cell entry into the myocardium. Dev Cell. 19, 114-125 (2010).
  17. Hirose, T., et al. PAR3 is essential for cyst-mediated epicardial development by establishing apical cortical domains. Development. 133, 1389-1398 (2006).
  18. Baek, S. T., Tallquist, M. D. Nf1 limits epicardial derivative expansion by regulating epithelial to mesenchymal transition and proliferation. Development. 139, 2040-2049 (2012).
  19. Lu, J., et al. Coronary smooth muscle differentiation from proepicardial cells requires rhoA-mediated actin reorganization and p160 rho-kinase activity. Dev Biol. 240, 404-418 (2001).
  20. Combs, M. D., Braitsch, C. M., Lange, A. W., James, J. F., Yutzey, K. E. NFATC1 promotes epicardium-derived cell invasion into myocardium. Development. 138, 1747-1757 (2011).
  21. Acharya, A., et al. The bHLH transcription factor Tcf21 is required for lineage-specific EMT of cardiac fibroblast progenitors. Development. 139, 2139-2149 (2012).
  22. Zhou, B., von Gise, A., Ma, Q., Hu, Y. W., Pu, W. T. Genetic fate mapping demonstrates contribution of epicardium-derived cells to the annulus fibrosis of the mammalian heart. Dev Biol. 338, 251-261 (2010).
  23. Zhou, B., et al. Adult mouse epicardium modulates myocardial injury by secreting paracrine factors. J Clin Invest. 121, 1894-1904 (2011).
  24. Singh, M., Epstein, J. Epicardial Lineages and Cardiac Repair. Journal of Developmental Biology. 1, 141-158 (2013).
  25. Braitsch, C. M., Combs, M. D., Quaggin, S. E., Yutzey, K. E. Pod1/Tcf21 is regulated by retinoic acid signaling and inhibits differentiation of epicardium-derived cells into smooth muscle in the developing heart. Dev Biol. 368, 345-357 (2012).
  26. Austin, A. F., Compton, L. A., Love, J. D., Brown, C. B., Barnett, J. V. Primary and immortalized mouse epicardial cells undergo differentiation in response to TGFbeta. Developmental dynamics : an official publication of the American Association of Anatomists. 237, 366-376 (2008).
  27. Kim, J., Rubin, N., Huang, Y., Tuan, T. L., Lien, C. L. In vitro culture of epicardial cells from adult zebrafish heart on a fibrin matrix. Nat Protoc. 7, 247-255 (2012).
  28. Compton, L. A., Potash, D. A., Mundell, N. A., Barnett, J. V. Transforming growth factor-beta induces loss of epithelial character and smooth muscle cell differentiation in epicardial cells. Developmental dynamics : an official publication of the American Association of Anatomists. 235, 82-93 (2006).
  29. Smith, C. L., Baek, S. T., Sung, C. Y., Tallquist, M. D. Epicardial-derived cell epithelial-to-mesenchymal transition and fate specification require PDGF receptor signaling. Circ Res. 108, 15-26 (2011).
  30. Shea, K., Geijsen, N. Dissection of 6.5 dpc Mouse Embryos. JOVE. 2, (2007).
  31. Witty, A. D., et al. Generation of the epicardial lineage from human pluripotent stem cells. Nature biotechnology. 32, 1026-1035 (2014).
  32. Iyer, D., et al. Robust derivation of epicardium and its differentiated smooth muscle cell progeny from human pluripotent stem cells. Development. 142, 1528-1541 (2015).
  33. Takeichi, M., Nimura, K., Mori, M., Nakagami, H., Kaneda, Y. The transcription factors Tbx18 and Wt1 control the epicardial epithelial-mesenchymal transition through bi-directional regulation of Slug in murine primary epicardial cells. PloS one. 8, e57829 (2013).
  34. Wong, M. L., Medrano, J. F. Real-time PCR for mRNA quantitation. BioTechniques. 39, 75-85 (2005).
  35. Schmittgen, T. D., Livak, K. J. Analyzing real-time PCR data by the comparative CT method. Nature Protocols. 3, 1101-1108 (2008).
  36. Bradford, M. M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical biochemistry. 72, 248-254 (1976).
  37. Moore, A. W., McInnes, L., Kreidberg, J., Hastie, N. D., Schedl, A. YAC complementation shows a requirement for Wt1 in the development of epicardium, adrenal gland and throughout nephrogenesis. Development. 126, 1845-1857 (1999).
  38. Kim, J., et al. PDGF signaling is required for epicardial function and blood vessel formation in regenerating zebrafish hearts. Proc Natl Acad Sci U S A. 107, 17206-17210 (2010).
  39. Kalluri, R., Weinberg, R. A. The basics of epithelial-mesenchymal transition. J Clin Invest. 119, 1420-1428 (2009).
  40. Dong, X. R., Maguire, C. T., Wu, S. P., Majesky, M. W. Chapter 9 Development of Coronary Vessels. Methods in Enzymology. 445, 209-228 (2008).
  41. Ruiz-Villalba, A., Ziogas, A., Ehrbar, M., Perez-Pomares, J. M. Characterization of epicardial-derived cardiac interstitial cells: differentiation and mobilization of heart fibroblast progenitors. PLoS One. 8, e53694 (2013).
  42. Garriock, R. J., Mikawa, T., Yamaguchi, T. P. Isolation and culture of mouse proepicardium using serum-free conditions. Methods. 66, 365-369 (2014).
  43. Smart, N., Riley, P. Derivation of epicardium-derived progenitor cells (EPDCs) from adult epicardium. Curr Protoc Stem Cell Biol. (2009).
  44. Zhou, B., Pu, W. T. Isolation and characterization of embryonic and adult epicardium and epicardium-derived cells. Methods Mol Biol. 843, 155-168 (2012).
  45. Morabito, C. J., Dettman, R. W., Kattan, J., Collier, J. M., Bristow, J. Positive and negative regulation of epicardial-mesenchymal transformation during avian heart development. Dev Biol. 234, 204-215 (2001).
  46. Grieskamp, T., Rudat, C., Ludtke, T. H., Norden, J., Kispert, A. Notch signaling regulates smooth muscle differentiation of epicardium-derived cells. Circ Res. 108, 813-823 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics