Tekniker för Imaging prometafas och Metaphase av meios I i fast

JoVE Journal
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Radford, S. J., McKim, K. S. Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes. J. Vis. Exp. (116), e54666, doi:10.3791/54666 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Protocol

Note: Förfaranden har fördes vid rumstemperatur om inget annat anges. Temperaturreglerade inkubatorer används för att bibehålla temperaturer för fluga uppfödning och korsar inte annat anges.

1. Förberedelser

  1. Förbered flugor.
    1. Prometafas berikad äggcell samlingar.
      1. Tydlig vuxen flyger från friska, unga lager eller tvärkulturer. Ålder flaskor för två dagar vid 25 ° C.
        OBS: I allmänhet två friska flaskor räcker, även om mer kan behövas för vissa tvär kulturer.
      2. Efter två dagar, samla ~ 100 till 300 kvinnor (som är 0 till 2 dagar gammal vid denna punkt) från flaskorna. Honorna behöver inte vara oskulder. Lägga en klick jäst pasta på sidan av en flaska och placera 30 honor och 10 till 15 hanar vardera in i de yeasted ampuller. Ålder flaskor för två dagar vid 25 ° C.
    2. Metafas berikad äggcellen samlingar.
      1. Samla ~ 100 till 300 honor från lager eller tvär cultures. Lägg en klick av jäst pasta vid sidan av en flaska och placera 30 honor vardera (utan män tillsatta) i yeasted flaskor. Ålder flaskor för tre till fem dagar vid 25 ° C.
  2. Förbered Solutions.
    Notera: Lösningar kan förvaras under obegränsad tid vid rumstemperatur, om inte annat anges.
    1. Förbered Modifierad Robb buffert (5x): 500 mM HEPES, 500 mM sackaros, 275 mM natriumacetat, 200 mM kaliumacetat, 50 mM glukos, 6 mM magnesiumklorid och 5 mM kalciumklorid. Använda 10 N 11: 8 natriumhydroxid: kaliumhydroxid för att bringa pH till 7,4. Sterilisera genom filtrering; inte autoklav. Förvara vid -20 ° C. Tina som behövs för att förbereda ~ 200 ml 1x Robb s per oocyt prep.
    2. Fixeringslösningar.
      1. Alternativ # 1: Förbered formaldehyd / heptan fixering. Förbered Fixering Buffert: 1x fosfatbuffrad saltlösning (PBS) plus 150 mM sackaros. Om du vill använda, gör frisk med 687,5 pl Fixering buffert och 312,5 pl 16% formaldehydper oocyt prep.
        VARNING: Använd handskar när du använder formaldehydlösningar i ett dragskåp. Omhänderta avfall enligt institutionens riktlinjer.
      2. Alternativ # 2: Förbered formaldehyd / kakodylat fixering. Förbereda Fix Mix: 250 mM sackaros, 100 mM kaliumacetat (pH 7,5), 25 mM natriumacetat (pH 7,0), och 25 mM EGTA (pH 8,0). Om du vill använda, gör frisk med 400 pl Fix Mix, 100 pl kaliumkakodylat (1 M, pH 7,2) och 500 pl 16% formaldehyd per oocyt prep.
        VARNING: kaliumkakodylat innehåller arsenik.
    3. Förbereda PBS / Triton X-100: 1 x PBS plus 1% eller 0,05% Triton X-100. Lagra vid 4 ° C.
    4. Förbereda PBS-Tween 20-bovint serumalbumin (BSA) (PTB): 1 x PBS, 0,5% BSA (vikt / volym), och 0,1% Tween-20. Kan förvaras vid 4 ° C under en vecka.
    5. Fluorescerande in situ-hybridisering (FISH) Solutions.
      1. Förbereda 20X Natriumklorid-natriumcitrat (SSC): 3 M natriumklorid och 0,3 M natriumcitrat.
      2. Förbereda 2x SSC-Tween-20 (SSCT): 2 x SSC plus 0,1% Tween-20. Gör färska, ~ 20 ml per äggcellen prep.
      3. Förbereda formamid lösningar: 2 x SSC, 0,1% Tween-20, plus formamid. Göra färsk, 1 ml 20% formamid, 0,5 ml 40% formamid, och 2 ml 50% formamid per oocyt prep.
        VARNING: Använd handskar när du använder formamid lösningar i ett dragskåp. Omhänderta avfall enligt institutionens riktlinjer.
      4. Förbereda hybridiseringslösning: 2x SSC, 50% formamid, och 10% dextransulfat (vikt / volym). Lagra vid 4 ° C.
    6. FISH-prober.
      1. Order oligonukleotider (se tabell 1 för sekvenser) med HPLC-upprening och önskade 5 'fluorescent modifiering (t.ex., Cy3 eller Cy5). Resuspendera i Tris-EDTA (TE) vid 50 ng / | il.
        OBS: Skydda oligos från ljusexponering vid alla tidpunkter.

2. Insamling av slutskedet Drosophila oocyter

  1. Som
  2. Söva alla ~ 100 till 300 yeasted flugor med koldioxid och lägga till en bländare innehållande ~ 100 ml 1x Robb buffert. Puls tre gånger (~ 1 sek vardera). Håll ägg i Robb är för <20 minuter för att undvika aktivering.
    OBS: Alternativt, ägg kan hand dissekeras från hondjur. Fördelen med denna metod är att den kräver färre honor. Emellertid måste försiktighet vidtas för att begränsa exponering för koldioxid till endast ett fåtal minuter för att undvika artefakter i samband med hypoxi 7.
  3. Filtrera genom stora maskor (~ 1500 um) i 250 ml bägare för att avlägsna stora kroppsdelar. Om många intakta magar kvar på nätet, åter grind material med hjälp av ytterligare Robb buffert, och filter igen. Låt sedimentera ~ 2 minuter, därefter aspirera bort översta lagret, ta bort så många av de stora kroppsdelar som möjligt.
  4. filter genom små mesh (~ 300 | im) i en 250 ml bägare. Skölj återstående oocyter av första bägaren med hjälp av ytterligare Robb s och belagd Pasteurpipett. Låt settle ~ 3 min; oocyter kommer att lösa ut. Sug bort alla utom ~ 10 ml.
  5. Häll så mycket av 10 ml som kommer att passa in belagt 5 ml rör. Låt lösa, ta bort vätska, och upprepa med resten. Skölj återstående ägg ur bägaren med hjälp av ytterligare Robb s och belagd Pasteurpipett. Låt bosätta sig i 5 ml rör för ~ 3-5 min.

3. läkemedelsbehandlingar (tillval)

  1. Coat en andra 5 ml rör med PTB för varje äggcellen prep. Lägg lämpligt lösningsmedel (kontroll) eller läkemedel till 1 ml Robbs varje för varje oocyt prep (Tabell 2).
  2. Split oocyter till andra belagda 5 ml rör. Låt bosätta, avlägsna vätska, och tillsätt 1 ml Robb Extra lösningsmedel i ett rör och en ml Robb s plus läkemedel i det andra röret. Vicka för lämplig tid för läkemedelsbehandling (tabell 2). Let lösa.

4. Fixering

  1. Sug bort all vätska och omedelbart tillsätt 1 ml Fix.
  2. Alternativ # 1: Formaldehyd / heptan fixering (Fixering buffert plus 5% formaldehyd).
    1. Fix för 2,5 min på en nutator. Tillsätt 1 ml heptan och vortexa 1 min. Låt settle ~ 1 min.
    2. Ta bort all vätska, och sedan tillsätts 1 ml 1 x PBS. Vortex 30 sek. Låt settle ~ 1 min.
    3. Ta bort all vätska, och sedan fylla röret med 1x PBS.
      OBS: Oocyter kan användas omedelbart eller förvaras på nutator i flera timmar vid rumstemperatur.
  3. Alternativ # 2: Formaldehyd / kakodylat fixering (Fix Mix plus 8% formaldehyd och 100 mM kakodylat).
    1. Fix för 6 min på en nutator. Låt sedimentera 2 min. Avlägsna vätska, och sedan fylla röret med 1x PBS.
      OBS: Oocyter kan användas omedelbart eller förvaras på nutator i flera timmar vid rumstemperatur.

5. Ta Membran ( "rullande")

  1. Använda bestruket Pasteurpipett, lägga ~ 500 till 1000 ägg till frostat (sandblästrat) del av en glasskiva. Ta bort alla kroppsdelar och främmande material med hjälp av pincett. Låt inte oocyter torka ut; lägga 1x PBS vid behov.
  2. Placera en täck ovanpå ägg och försiktigt "rulla" oocyter tills alla membran tas bort (dra kanten av täck över oocyterna fungerar bäst.) Kontrollera med jämna mellanrum framsteg under mikroskop, lägga till mer 1x PBS vid behov. Var försiktig eftersom för mycket tryck kommer att förstöra ägg.
    OBS: För immunfluorescens endast fortsätta med steg 6. För fisk (med eller utan immunofluorescens), fortsätt med steg 7.

6. Antikropp Färgning av Drosophila oocyter

  1. Utvinning och Blockering
    1. Skölj valsade oocyter i en 15 ml koniskt rör innehållande ~ 15 ml PBS / 1% Triton X-100. Vicka ägg i denna lösning för inte mindre än 1,5 timmar och högst två timmar.Detta steg tillåter penetrering antikropp.
    2. Låt oocyter lösa ~ 2 min. Avlägsna vätska tillsammans med så många membran som möjligt, lägg sedan till PBS / 0,05% Triton X-100.
      OBS: Membran kommer att lösa långsammare än rullade ägg.
    3. Låt oocyter lösa ~ 2 min, sedan bort alla utom ~ 1 ml vätska. Överför oocyter till examen 1,5 ml rör och avlägsna kvarvarande vätska. Tillsätt 1 ml PTB för blockering och nutera under 1 timme.
  2. antikropp Färgning
    1. Pre-absorption av sekundära antikroppar mot embryon.
      OBS: Detta steg eliminerar bakgrundsfärgning från icke-specifika interaktioner antikropp med Drosophila proteiner.
      1. Samla in och fixa Drosophila embryon (~ 25 il) per typiskt förfarande 8. Lagra i metanol vid -20 ° C.
      2. Avlägsna metanol från embryon, tillsätt 800 | il metanol plus 200 | il 1 x PBS, och nutera under 15 min. Ta bort 500 pl supernatant och ersätt med 500 pl 1 x PBS. Sedan vicka i 15 min. Upprepa två gånger (för totalt cirka 1 timme tvättar), och därefter färdigt med PTB.
        OBS: Embryon kan användas omedelbart eller förvaras på nutator för flera h vid rumstemperatur.
      3. Avlägsna vätska, fyll på med PTB till 200 l per äggcellen prep och lägga fluorescensmärkta sekundära antikroppar vid lämpliga utspädningar (med tanke på att den slutliga volymen blir 300 pl;. Se steg 7,4) vicka vid 4 ° C över natten (helst) eller vid rumstemperatur under 3-4 h.
        OBS! Pre-absorberade antikropparna kommer att användas i steg 6.2.4.
        OBS: Håll prover i mörkret så mycket som möjligt när fluorescerande antikroppar har lagts till.
    2. Avlägsna vätska från oocyter, fyll på med PTB till 300 pl, och lägga till primära antikroppar vid lämpliga utspädningar. Vicka vid 4 ° C över natten (föredras) eller vid rumstemperatur under 3-4 h.
    3. Tvätta oocyter fyra gånger under 15 minuter vardera med en ml PTB.
    4. Avlägsnavätska från oocyter, tillsätt 200 pl supernatant från embryon (pre-absorberade sekundära antikroppar). Fyll sedan med PTB till 300 pl. Vicka vid rumstemperatur under 3-4 h (föredras) eller vid 4 ° C över natten.
    5. Tvätta ägg en gång under 15 minuter med en ml PTB, avlägsna vätska. Lägg sedan till 0,5 l Hoechst 33342 och 500 pl PTB och nutera för 7 min.
    6. Tvätta oocyter två gånger under 15 minuter vardera med en ml PTB.
      OBS: Oocyter kan monteras på ett objektglas omedelbart eller kan lagras i PTB vid 4 ° C tills redo för avbildning.

7. FISH (Fortsätt från steg 5 ovan)

  1. Skölj rullade ägg i en 15 ml koniska rör innehållande ~ 15 ml 2x SSCT. Låt oocyter lösa ~ 2 min. Ta bort alla utom ~ 0,5 ml vätska tillsammans med så många membran som möjligt.
    OBS: Membran kommer att lösa långsammare än rullade ägg.
  2. Överföring oocyter till 0,5 ml rör och avlägsna kvarvarande vätska. Successivt lägga till och ta bort 500 pl20%, 40% och 50% formamid lösningar, nuterande under 10 minuter i varje lösning.
    OBS: Oocyter kommer att lösa långsammare med högre halter av formamid.
  3. Avlägsna vätska, tillsätt sedan 500 | il 50% formamid-lösning och nutera vid 37 ° C under 1 till 5 tim.
    OBS: Längre inkubationer resulterar i bättre sondpenetration.
  4. Avlägsna vätska, lämnar efter inte mer än ~ 100 | il oocyter, och tillsätt 36 | il hybridiseringslösning plus 2 | al av sond (50 ng / ul) och 2 | il vatten eller 2 | j, l av en 2 nd sond (Tabell 1).
  5. Inkubera vid 91 ° C under 3 min (FISH) eller 80 ° C under 20 min (FISH plus immunofluorescens), följt av inkubation i en 37 ° C vattenbad över natten.
    OBS: Dessa steg kan utföras i en termocykler.
  6. Ta inte bort vätska. Tillsätt 500 | al 50% formamid-lösning och nutera vid 37 ° C under 1 timme.
  7. Låt bosätta, avlägsna vätska, tillsätt 500 pl 50% formamid lösning, end nutera vid 37 ° C under 1 timme.
  8. Låt settle, avlägsna vätska, tillsätt 500 | il 20% formamid-lösning och nutera vid rumstemperatur under 10 min.
  9. Utför tre snabba tvättar i 500 pl 2x SSCT (låt Settle, ta bort sedan lägga till vätska, vänd flera gånger, upprepa.) Låt Settle, avlägsna vätska, lägg sedan till 500 l PTB och nutera under 4 timmar.

8. Antikropp färgning efter FISK

  1. Avlägsna vätska från oocyter, fyll på med PTB till 300 pl, och tillsätt 10 pl anti-α-tubulin antikropp konjugerad till FITC. Alternativt kan andra antikroppar användas, efter ovanstående protokoll. Vicka vid rumstemperatur över natten.
  2. Tvätta ägg en gång under 15 minuter med 500 l PTB, avlägsna vätska, lägg sedan till 0,5 l Hoechst 33342 och 500 pl PTB och nutera för 7 min.
  3. Tvätta oocyter två gånger under 15 minuter vardera med 500 l PTB.
    OBS: Oocyter kan vara monterad på en slid omedelbart eller kan lagras i PTB vid 4 ° C tills redo föravbildning. Håll ägg i mörkret så mycket som möjligt när fluorescerande antikroppar har lagts till.
Upprepa Namn Kromosom Oligo Sekvens *
359 X GGGATCGTTAGCACTGGTAATTAGCTGC
AACAC 2 AACACAACACAACACAACACAACACAACACAACACAACAC
dodeca 3 CCCGTACTGGTCCCGTACTCGGTCCCGTACTCGGT
1,686 2 + 3 AATAACATAGAATAACATAGAATAACATAG
AATAT 4 (+ Y) AATATAATATAATATAATATAATATAATAT
* 359 sekvens från Eric Joyce, personlig kommunikation, andra sekvenser från Sullivan et al. 8

Tabell 1: FISH prober för Drosophila centro upprepningar.

Läkemedel Lösningsmedel förrådskoncentration slutkoncentration Tidpunkten för behandlingen Effekt
kolchicin etanol 125 mM 150 | iM 10 min eller 30 min destabilisera icke-kinetokoren (10 min) 9 eller alla (30 min) mikrotubuli
paklitaxel DMSO 10 mM 10 ^ M 10 min stabilisera microtubules
Binucleine 2 DMSO 25 mM 25 ^ M 20 min hämma Aurora B-kinas 10

Tabell 2: Läkemedelsbehandling.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

De metoder vi har beskrivit här kommer att resultera i insamlingen av slutskedet Drosophila oocyter som representerar tre stadier av meios (Figur 1). Oocyter i profas särskiljes genom närvaron av kärnhöljet, som är synlig genom avsaknaden av tubulin signal i den region som omger den karyosome (Figur 1A). Prometafas är perioden efter kärnhöljet uppdelning under vilken spindel monterar. Under prometafas antar karyosome en distinkt form, blir avlånga ofta med den 4: e kromosomer bortsett från huvud karyosome massan (Figur 1B). Prometafas avslutas med metafas, där Drosophila oocyter gripa naturligt tills ägglossningen. I metafas oocyter har karyosome indragen i en rund form (Figur 1C).

Vi beskriver här metoder att manipulera hastigheten för äggläggning av Drosophila honor att anrika oocyter antingen i prometafas eller metafas. Oocyter från prometafas-berikade samlingar visar ofta långsträckta karyosome (Figur 2A) medan metafas-berikade samlingar eller samlingar från jungfru Drosophila honor, som nästan helt eliminerar äggläggning, främst visar den runda karyosome (Figur 2B). Intressant, prometafas-berikade samlingar visar också typiskt mycket mer robust spindlar, vilket tyder på att både karyosome och spindel förändring mellan prometafas och metafas i Drosophila oocyter 9.

Figur 3 visar representativa bilder från de två protokoll som beskrivs här. Antikroppar mot α-tubulin (för att visa spindeln), CENP-C (för att visa centromerer), och INCENP (för att visa den centrala spindeln) användes på oocyter fast med formaldehyde / heptan (figur 3A). Prober för de repetitiva centro sekvenserna på två nd kromosomen (AACAC) och 3: e kromosom (dodeca) användes på oocyter fixerade med formaldehyd / kakodylat och co-färgades med en α-tubulin antikropp enligt FISH-protokollet (figur 3B). Den AACAC sonden visas som flera klustrade härdar medan dodeca sonden visas som ett enda fokus per kromosom. Oocyter som behandlats med 150 iM kolchicin 10 min fixerades med formaldehyd / heptan (Figur 3C). Denna behandling eliminerar de flesta icke-kinetokoren-mikrotubuli, vilket resulterar i alla mikrotubuli i kontakt med DNA vid centromermärkta foci. Oocyter behandlades med 10 | iM paklitaxel i 10 min visar alltför stora mikrotubuli i cytoplasman, men liten effekt på spindel mikrotubuli (Figur 3D). Oocyter som behandlats med 25 | iM Binucleine 2 under 20 min för att hämma Aurora B-kinas visar fullständig förlust avspindel mikrotubuli (figur 3E).

Figur 1
Figur 1: Tre stadier av mogna Drosophila oocyter:. Profas, prometafas och Metaphase Confocal bilder av Drosophila ägg i profas (A), prometafas (B), och metafas (C) i meios I. DNA visas i blått och tubulin är visas i grönt i sammanslagna bilder. Infällningar i (B) och (C) visar DNA i vitt. Skalstrecken = 10 nm. Klicka här för att se en större version av denna siffra.

figur 2
Figur 2:Prometaphase- vs metafas berikade samlingar av Drosophila ägg. Konfokala bilder av Drosophila ägg från prometafas berikad (A) eller metafas berikad (B) samlingar. DNA visas i blått och tubulin visas i grönt. Skalstrecken = 10 nm. Klicka här för att se en större version av denna siffra.

Figur 3
Figur 3: antikroppsfärgning, fisk och läkemedelsbehandlingar av Drosophila äggceller Confocal bilder av Drosophila ägg med DNA i blått och tubulin i grönt.. Skalstrecken = 10 | im. (A) Immunofluorescens i formaldehyde / heptan fixering med INCENP (central axel) i rött och CENP-C (centromerer) i vitt. (B) FISH i formaldehyd / kakodylat fixering med AACAC visas i rött och dodeca visas i vitt. (C) Behandling med 150 iM kolchicin under 10 minuter med CENP-C som visas i rött. Behandling med 10 iM paklitaxel under 10 min (D) eller 25 ^ M Binucleine 2 för 20 min (E). Klicka här för att se en större version av denna siffra.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Staging Drosophila Oocyter

Även om en långsträckt karyosome ses ofta i prometafas ägg, med hjälp av karyosome form för att skilja prometafas från metafas oocyter kan vara problematiskt. Under prometafas börjar karyosome som en rund form, förlängs, och sedan dras till en rund form som äggcellen närmar sig metafas gripandet. Detta innebär att många prometafas oocyter inte har en långsträckt karyosome. Dessutom, om mutanta eller läkemedelsbehandlade oocyter undersöks, karyosome form kan påverkas, vilket utesluter användning av denna metod för att iscensätta oocyter. Eftersom andra markörer för att skilja dessa steg är för närvarande inte tillgängliga, använder vi den metod som beskrivs ovan för att manipulera hastigheten för äggläggning av Drosophila honor att anrika oocyter antingen i prometafas eller metafas. Skälet är att om ägg tillbringa en viss tid i prometafas och obestämd tid arrserade i metafas, som varar tills äggläggning, sedan snabbare äggläggning kommer skev mot en högre andel prometafas ägg, medan långsammare äggläggning kommer att berika för metafas. Hur mycket arbete som krävs för att samla jungfru honor eller samla honor under en kortare tid än 2 dagar, som beskrivs av Gilliland et al. 6, inte belönas med en märkbar ökning av prometafas oocyter. Det är också omöjligt att använda rygg bihang att iscensätta oocyter framställda med detta protokoll som dorsala bihang avlägsnas tillsammans med membranen. Även om det inte är möjligt att arrangera enskilda oocyter med 100% säkerhet med den här metoden, data från prometafas anrikat eller metafas berikade samlingar kan tas tillsammans för att dra slutsatser om de olika stegen 9.

Drosophila-oocyter inte befruktade tills de passerar genom äggledaren; Därför, eftersom oocyterna samlas in för the-protokoll som beskrivs här undersöker oocyter tagna före äggläggning har dessa ägg inte befruktas. Passage genom äggledaren orsakar också oocyten för att aktivera och återuppta cellcykelprogression. Metoder för att undersöka cellcykelns stadier efter metafas jag existerar 11,12, men ligger utanför ramen för detta protokoll.

Fixering Metod Överväganden

Vi beskriver två separata metoder för fixering av slutskedet Drosophila oocyter. Formaldehyd / kakodylat bindningsmetoden beskrevs först av Theurkauf och Hawley 3 och formaldehyden / heptan bindningsmetoden beskrevs först av Zou et al. 4. Dessutom är en tredje metod (metanol fixering) används av cirka 13, men beskrivs inte här. Borttagning av äggcellen membran är något svårare efter formaldehyd / heptan fixering jämfört med formaldehyd / kakodylat. Detta beror på att "rulla" beroendes på friktion mellan täck och äggcellen, och formaldehyd / heptan fixering gör oocyterna mer hala. Trots denna extra svårighet, är vårt första val av fixeringsmetod när testa nya antikroppar formaldehyd / heptan eftersom det fungerar bäst för de flesta antikroppar som vi har försökt. Å andra sidan, föredrar vi formaldehyd / kakodylat fixering för fisk, främst för att underlätta membran avlägsnande, även om formaldehyd / heptan fixering har också varit framgångsrik. Båda dessa metoder bevara äggcellen morfologi bättre än metanol fixering, och därför rekommenderar vi metanolfixering endast i de fall av antikroppar som är okänsliga för formaldehydbaserade fixeringsmetoder.

De protokoll som beskrivs här fokuserar på fast avbildning, i syfte att visa effektiva metoder för att göra mogna Drosophila äggceller mottaglig för penetration antikropp, nämligen genom att avlägsna äggcellen membran. Alternativa metoder för membran removal (med hjälp av tång 14 eller ultraljudsbehandling 13) är möjliga; Men här och "rullande" för att vara den mest effektiva och tillförlitliga metoden. Tekniker för levande avbildning har även beskrivits på annat håll 14-16 och ligger utanför ramen för detta protokoll.

FISH Rekommendationer

FISH i Drosophila oocyter beskrevs ursprungligen av Dernburg et al. 5. Detta protokoll har utformats för att ge optimala förutsättningar för probhybridisering till kondense äggcell kromosomer, men det ursprungliga protokollet var inte optimal för immunofluorescens. Den ovan beskrivna metoden innefattar anpassningar vi har gjort för att förbättra antikroppsfärgning av α-tubulin, som är i huvudsak vad vi använder när de utför FISH. För andra antikroppar, som sänker temperaturen hos den denatureringssteget (steg 7,5) från 80 ° C kan vara nödvändig.

Sonderna som anges här är förrepetitiva sekvenser i heterokromatin nära centromerer. Eftersom dessa sekvenser är mycket repetitiva, probema hybridiseras till flera platser och de samlade signalerna är ganska stark. Vi har haft liten framgång med prober för sekvenser i eukromatin, möjligen på grund av den unika strukturen av kromosomerna medan ingår i den kondenserade karyosome.

imaging

Äldre Drosophila ägg, liksom ägg de flesta organismer, är stora, enskilda celler. Det betyder att det finns en stor volym av cytoplasman som innehåller en enda kärna. Lyckligtvis denna kärna, även känd som en karyosome i Drosophila, kan lätt identifieras eftersom det är typiskt beläget strax nedanför de dorsala bihang nära till cortex. De dorsala bihang avlägsnas tillsammans med äggcellen membran, men karyosome kan fortfarande vara belägen genom att hitta den lilla divot i oocyt cortex där bihangen oNCE var. De bästa bilderna erhålls från ägg som har monterats med denna divot mot täck eftersom detta placerar karyosome närmast målet. Även om det kan vara möjligt att ordna oocyterna i denna orientering före montering, föredrar vi att montera många ägg slumpmässigt och sedan söka bilden för dem i önskad riktning.

framtida tillämpningar

I framtiden kommer det att vara viktigt att identifiera markörer som på ett tillförlitligt sätt skiljer prometafas I och metafas I spindlar. Att kunna mer tillförlitligt skede oocyter kommer att minska beroendet av flera arbetsintensiva alternativ, såsom avbildning ett stort antal scenberikade oocyter eller levande avbildning, som också har sina mellan problem. Denna metod är en grundläggande metod som kan användas för att dra fördel av framsteg i Drosophila genetik som nya verktyg blir tillgängliga för att ändra eller slå ut genprodukter. Detta innefattar metoderatt direkt rikta proteinaktivitet med nya droger eller riktade nedbrytningsstrategier. Dessutom är dessa metoder inte begränsat till avbildning meiotiska spindlar. Någon struktur inom oocyten, såsom aktin cytoskelettet, skulle kunna analyseras med användning av dessa metoder.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
15 ml conical tubes Various
16% formaldehyde Ted Pella, Inc. 18505 HAZARDOUS; once opened, discard after one month
250 ml beakers Various
5 ml tubes Various
active dry yeast Various mix with water to make a paste the consistency of peanut butter
anti-α-tubulin antibody conjugated to FITC Sigma F2168 clone DM1A
Binucleine 2 Sigma B1186 HAZARDOUS
blender Various
bovine serum albumin Sigma A4161
calcium chloride Various
colchicine Sigma C-9754 HAZARDOUS
coverslips VWR 48366-227 No. 1 1/2
dextran sulfate Various
DMSO Various
EGTA Various
ethanol Various
forceps Ted Pella, Inc. 5622 Dumont tweezers high precision grade style 5
formamide Sigma 47670-250ML-F
glass slides VWR 48312-003
glucose Various
graduated 1.5 ml tubes Various
HEPES VWR EM-5330 available from several venders
Hoechst 33342 Various
magnesium chloride Various
methanol Various
large mesh (~1,500 µm) VWR AA43657-NK variety of formats and other suppliers, 12 or 14 mesh
small mesh (~300 µm) Spectrum labs 146 424 variety of formats, e.g., 146 422 or 146 486
nutator Various
Pasteur pipets Various
potassium acetate Various
Cacodylic acid Sigma C0125 HAZARDOUS; alternatively, sodium cacodylate may be substituted
potassium hydroxide Various
sodium acetate Various
sodium chloride Various
sodium citrate Various
sodium hydroxide Various
sucrose Various
taxol (paclitaxel) Sigma T1912 HAZARDOUS
Triton X-100 Fisher PI-28314
Tween 20 Fisher PI-28320
vortex Various

DOWNLOAD MATERIALS LIST

References

  1. Bridges, C. B. Non-disjunction as proof of the chromosome theory of heredity. Genetics. 1, (1), 1-52 (1916).
  2. Hassold, T., Hunt, P. To err (meiotically) is human: the genesis of human aneuploidy. Nat Rev Genet. 2, (4), 280-291 (2001).
  3. Theurkauf, W. E., Hawley, R. S. Meiotic spindle assembly in Drosophila females: behavior of nonexchange chromosomes and the effects of mutations in the nod kinesin-like protein. J Cell Biol. 116, (5), 1167-1180 (1992).
  4. Zou, J., Hallen, M. A., Yankel, C. D., Endow, S. A. A microtubule-destabilizing kinesin motor regulates spindle length and anchoring in oocytes. J Cell Biol. 180, (3), 459-466 (2008).
  5. Dernburg, A. F., Sedat, J. W., Hawley, R. S. Direct evidence of a role for heterochromatin in meiotic chromosome segregation. Cell. 86, (1), 135-146 (1996).
  6. Gilliland, W. D., Hughes, S. F., Vietti, D. R., Hawley, R. S. Congression of achiasmate chromosomes to the metaphase plate in Drosophila melanogaster oocytes. Dev Biol. 325, (1), 122-128 (2009).
  7. Gilliland, W. D., et al. Hypoxia transiently sequesters mps1 and polo to collagenase-sensitive filaments in Drosophila prometaphase oocytes. PLoS One. 4, (10), e7544 (2009).
  8. Sullivan, W., Ashburner, M., Hawley, R. S. Drosophila Protocols. Cold Spring Harbor Laboratory Press. (2000).
  9. Radford, S. J., Hoang, T. L., Głuszek, A. A., Ohkura, H., McKim, K. S. Lateral and End-On Kinetochore Attachments Are Coordinated to Achieve Bi-orientation in Drosophila Oocytes. PLoS Genet. 11, (10), e1005605 (2015).
  10. Smurnyy, Y., Toms, A. V., Hickson, G. R., Eck, M. J., Eggert, U. S. Binucleine 2, an isoform-specific inhibitor of Drosophila Aurora B kinase, provides insights into the mechanism of cytokinesis. ACS Chem Biol. 5, (11), 1015-1020 (2010).
  11. Mahowald, A. P., Goralski, T. J., Caulton, J. H. In vitro activation of Drosophila eggs. Dev Biol. 98, (2), 437-445 (1983).
  12. Page, A. W., Orr-Weaver, T. L. Activation of the meiotic divisions in Drosophila oocytes. Dev Biol. 183, (2), 195-207 (1997).
  13. Tavosanis, G., Llamazares, S., Goulielmos, G., Gonzalez, C. Essential role for gamma-tubulin in the acentriolar female meiotic spindle of Drosophila. EMBO J. 16, (8), 1809-1819 (1997).
  14. Endow, S. A., Komma, D. J. Spindle dynamics during meiosis in Drosophila oocytes. J Cell Biol. 137, (6), 1321-1336 (1997).
  15. Matthies, H. J., Clarkson, M., Saint, R. B., Namba, R., Hawley, R. S. Drosophila Protocols. Sullivan, W., Ashburner, M., Hawley, R. S. Cold Spring Harbor Laboratory Press. 67-85 (2000).
  16. Colombié, N., et al. Dual roles of Incenp crucial to the assembly of the acentrosomal metaphase spindle in female meiosis. Development. 135, (19), 3239-3246 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics