Teknikker til Imaging prometafasen og Metafase af Meiose I i Fast

JoVE Journal
Biology

Your institution must subscribe to JoVE's Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Radford, S. J., McKim, K. S. Techniques for Imaging Prometaphase and Metaphase of Meiosis I in Fixed Drosophila Oocytes. J. Vis. Exp. (116), e54666, doi:10.3791/54666 (2016).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Protocol

Bemærk: procedurer udføres ved stuetemperatur, medmindre andet er angivet. Temperaturkontrollerede inkubatorer bruges til at opretholde temperaturer for flue opdræt og sender medmindre andet er angivet.

1. Forberedelser

  1. Forbered Fluer.
    1. Prometafasen beriget oocyt-samlinger.
      1. Klar voksen flyver fra sunde, unge lager eller cross kulturer. Alder flasker til to dage ved 25 ° C.
        BEMÆRK: Generelt to sunde flasker vil være tilstrækkeligt, selv om der kan være behov for mere for nogle cross kulturer.
      2. Efter to dage, indsamle ~ 100 til 300 kvinder (som er 0 til 2 dage gammel på dette tidspunkt) fra flaskerne. Hunnerne behøver ikke at være jomfruer. Tilføj en DAB af gær pasta til siden af ​​et hætteglas og anbringes 30 hunner og 10 til 15 hanner hver ind i yeasted hætteglas. Alder hætteglas i to dage ved 25 ° C.
    2. Metafase-beriget oocyt samlinger.
      1. Saml ~ 100 til 300 kvinder fra lager eller på tværs cultures. Tilføj en DAB af gær pasta til siden af ​​et hætteglas og placere 30 hunner hver (med tilføjet nogen hanner) i de yeasted hætteglas. Alder hætteglas for tre til fem dage ved 25 ° C.
  2. Forbered Solutions.
    Bemærk: Opløsninger kan opbevares i ubegrænset tid ved stuetemperatur, medmindre andet er angivet.
    1. Fremstille modificerede Robb buffer (5x): 500 mM HEPES, 500 mM sucrose, 275 mM natriumacetat, 200 mM kaliumacetat, 50 mM glucose, 6 mM magnesiumchlorid og 5 mM calciumchlorid. Brug 10 N 11: 8 natriumhydroxid: kaliumhydroxid for at bringe pH til 7,4. Der steriliseres ved filtrering; ikke autoklaveres. Opbevar ved -20 ° C. Optø efter behov for at forberede ~ 200 ml 1x Robb s pr oocyt prep.
    2. Fiksering Solutions.
      1. Mulighed # 1: Forbered formaldehyd / heptan fiksering. Forbered Fiksering Buffer: 1x phosphatpufret saltvand (PBS) plus 150 mM sucrose. For at bruge, lave frisk med 687.5 pi Fiksering Buffer og 312,5 pi 16% formaldehydper oocyt prep.
        ADVARSEL: Bær handsker, mens du bruger formaldehyd-løsninger i et stinkskab. Bortskaf affald i henhold til institutionelle retningslinier.
      2. Mulighed # 2: Forbered formaldehyd / cacodylat fiksering. Forbered Fix Mix: 250 mM sucrose, 100 mM kaliumacetat (pH 7,5), 25 mM natriumacetat (pH 7,0), og 25 mM EGTA (pH 8,0). For at bruge, lave frisk med 400 pi Fix Mix, 100 pi kaliumcacodylat (1 M, pH 7,2), og 500 pi 16% formaldehyd pr oocyt prep.
        ADVARSEL: kaliumcacodylat indeholder Arsen.
    3. Forbered PBS / Triton X-100: 1x PBS plus 1% eller 0,05% Triton X-100. Opbevares ved 4 ° C.
    4. Forbered PBS-Tween 20-bovint serumalbumin (BSA) (PTB): 1x PBS, 0,5% BSA (vægt / volumen) og 0,1% Tween-20. Kan opbevares ved 4 ° C i en uge.
    5. Fluorescens in situ-hybridisering (FISH) Solutions.
      1. Forbered 20X Natriumchlorid-natriumcitrat (SSC): 3 M natriumchlorid og 0,3 M natriumcitrat.
      2. Forbered 2x SSC-Tween-20 (SSCT): 2x SSC plus 0,1% Tween-20. Foretag friske, ~ 20 ml pr oocyt prep.
      3. Forbered formamid løsninger: 2x SSC, 0,1% Tween-20, plus formamid. Lave frisk, 1 ml 20% formamid, 0,5 ml 40% formamid, og 2 ml 50% formamid pr oocyt prep.
        ADVARSEL: Bær handsker, mens du bruger formamid løsninger i et stinkskab. Bortskaf affald i henhold til institutionelle retningslinier.
      4. Forbered hybridiseringsopløsning: 2x SSC, 50% formamid og 10% dextransulfat (vægt / volumen). Opbevares ved 4 ° C.
    6. FISH-prober.
      1. Bestil oligonukleotider (se tabel 1 for sekvenser) med HPLC rensning og ønskede 5'fluorescerende ændring (fx Cy3 eller Cy5). Resuspender i Tris-EDTA (TE) ved 50 ng / pl.
        BEMÆRK: Beskyt oligoer fra lys eksponering på alle tidspunkter.

2. Indsamling af sen-fase Drosophila oocyter

  1. Som
  2. Bedøver alle ~ 100 til 300 yeasted fluer med kuldioxid og tilføje til en blender indeholder ~ 100 ml 1x Robb s Buffer. Pulse tre gange (~ 1 sek hver). Hold oocytter i Robb er for <20 min for at undgå aktivering.
    BEMÆRK: Alternativt oocytter kan hånd-dissekeres fra hundyr. Fordelen ved denne metode er, at den kræver mindst hunner. Dog skal man sørge for at begrænse eksponeringen for kuldioxid til kun et par minutter for at undgå artefakter forbundet med hypoxi 7.
  3. Filtreres gennem store mesh (~ 1500 um) i 250 ml bægerglas at fjerne store kropsdele. Hvis mange intakte underliv forblive på mesh, re-grind materiale ved anvendelse af yderligere Robb s Buffer, og filter igen. Lad henstå ~ 2 min, derefter aspireres off toplag, fjerne så mange af de store kropsdele som muligt.
  4. Filter gennem små mesh (~ 300 um) i et 250 ml bægerglas. Skyl resterende oocytter ud af første bæger brug af yderligere Robb s og belagt Pasteur-pipette. Lad bilægge ~ 3 min; oocytter vil bosætte ud. Aspirer off alle, men ~ 10 ml.
  5. Hæld så meget af de 10 ml som vil passe ind coated 5 ml rør. Lad bosætte, fjerne væske, og gentag med resten. Skyl resterende oocytter ud af bæger brug af yderligere Robb s og belagt Pasteur-pipette. Lad bosætte sig i 5 ml rør til ~ 3-5 min.

3. Drug Behandlinger (ekstraudstyr)

  1. Coat en anden 5 ml rør med PTB for hver oocyt prep. Tilsæt egnet opløsningsmiddel (kontrol) eller lægemiddel til 1 ml Robb er hver for hver oocyt prep (tabel 2).
  2. Split oocytter til andet overtrukket 5 ml rør. Lad bilægge, fjerne væske, og tilsæt 1 ml Robb s plus opløsningsmiddel i et rør og 1 ml Robb s plus lægemiddel i anden slange. Nutate for passende tidsrum til behandling lægemiddel (tabel 2). Let bundfælde sig.

4. Fiksering

  1. Aspirér off al væske og straks tilsættes 1 ml Fix.
  2. Mulighed # 1: Formaldehyd / heptan fiksering (Fiksering Buffer plus 5% formaldehyd).
    1. Fix for 2,5 minutter på en nutator. Der tilsættes 1 ml heptan og vortex 1 min. Lad bilægge ~ 1 min.
    2. Fjern al væske, og derefter tilføje 1 ml 1x PBS. Vortex 30 sek. Lad bilægge ~ 1 min.
    3. Fjern al væske, og derefter udfylde rør med 1x PBS.
      BEMÆRK: Oocytter kan anvendes straks eller opbevares på nutator i flere timer ved stuetemperatur.
  3. Mulighed # 2: Formaldehyd / cacodylat fiksering (Fix Mix plus 8% formaldehyd og 100 mM cacodylat).
    1. Fix i 6 min på en nutator. Lad bosætte 2 min. Fjern væske, og derefter udfylde rør med 1x PBS.
      BEMÆRK: Oocytter kan anvendes straks eller opbevares på nutator i flere timer ved stuetemperatur.

5. Fjernelse Membraner ( "Rolling")

  1. Brug belagt Pasteur-pipette, tilføje ~ 500 til 1.000 oocytter til matteret (sandblæst) del af en glasplade. Fjern alle kropsdele og fremmede materiale med en pincet. Lad ikke oocyter tørre ud; tilføje 1x PBS efter behov.
  2. Placer en dækglas oven på oocyter og forsigtigt "roll" oocytter, indtil alle membraner er fjernet (at trække kanten af ​​dækglasset på tværs oocytterne fungerer bedst.) Tjek jævne fremskridt under mikroskop, tilføje mere 1x PBS som nødvendigt. Pas som for meget pres vil ødelægge oocytter.
    BEMÆRK: immunfluorescens kun fortsætte med Trin 6. For FISH (med eller uden immunofluorescens), fortsætte med trin 7.

6. Antistof Farvning af Drosophila oocyter

  1. Udvinding og blokering
    1. Skyl valsede oocytter i et 15 ml konisk rør indeholdende ~ 15 ml PBS / 1% Triton X-100. Nutate oocytter i denne opløsning i ikke mindre end 1,5 time og ikke mere end 2 timer.Dette trin tillader antistof penetration.
    2. Lad oocytter afregne ~ 2 min. Fjerne væske sammen med så mange membraner som muligt, hvorefter der tilsættes PBS / 0,05% Triton X-100.
      BEMÆRK: Membraner vil bosætte langsommere end valsede oocytter.
    3. Lad oocytter bosætte ~ 2 min, derefter fjerne alle, men ~ 1 ml væske. Overfør oocytter til dimitterede 1,5 ml rør og fjerne de resterende væske. Tilsæt 1 ml PTB for blokering og nutate i 1 time.
  2. antistoffarvning
    1. Pre-absorption af sekundære antistoffer mod embryoner.
      BEMÆRK: Dette trin eliminerer baggrundsfarvning fra ikke-specifikke antistof interaktioner med Drosophila proteiner.
      1. Indsamle og ordne Drosophila embryoner (~ 25 pi) pr typisk procedure 8. Opbevar i methanol ved -20 ° C.
      2. Fjerne methanol fra embryoner, tilsættes 800 pi methanol plus 200 pi 1x PBS og nutate i 15 minutter. Fjern 500 pi supernatant og erstatte med 500 pi 1x PBS. Så nutate i 15 min. Gentag to gange (i alt ~ 1 time vaske), og derefter færdigt med PTB.
        BEMÆRK: Embryoner kan anvendes straks eller opbevares på nutator for flere timer ved stuetemperatur.
      3. Fjern væske, fylde med PTB til 200 pi pr oocyt prep og tilføje fluorescens-mærkede sekundære antistoffer ved passende fortyndinger (holde sig for øje, at det endelige volumen vil være 300 pi;. Se trin 7.4) Nutate ved 4 ° C natten over (at foretrække) eller ved stuetemperatur i 3 til 4 timer.
        BEMÆRK: De præ-absorberede antistoffer vil blive anvendt i trin 6.2.4.
        BEMÆRK: Hold prøver i mørke så meget som muligt, når fluorescerende antistoffer er blevet tilføjet.
    2. Fjern væsken fra oocytter, fylde med PTB til 300 pi, og tilføje primære antistoffer ved passende fortyndinger. Nutate ved 4 ° C natten over (foretrækkes) eller ved stuetemperatur i 3 til 4 timer.
    3. Vask oocytter fire gange i 15 minutter hver med 1 ml PTB.
    4. Fjernevæske fra oocytter, der tilsættes 200 pi supernatant fra embryoner (præ-absorberede sekundære antistoffer). Så fyld med PTB til 300 pi. Nutate ved stuetemperatur i 3 til 4 timer (fortrinsvis) eller ved 4 ° C natten over.
    5. Vask oocytter gang i 15 minutter med 1 ml PTB, fjerne væske. Derefter tilsættes 0,5 pi Hoechst 33342 og 500 pi PTB og nutate i 7 min.
    6. Vask oocytter to gange i 15 minutter med hver 1 ml PTB.
      BEMÆRK: Oocytter kan være monteret på en slæde umiddelbart eller kan opbevares i PTB ved 4 ° C indtil den er klar til billeddannelse.

7. FISH (Fortsæt fra trin 5 ovenfor)

  1. Skyl rullet oocytter i et 15 ml konisk rør indeholdende ~ 15 ml 2x SSCT. Lad oocytter afregne ~ 2 min. Fjern alle men ~ 0,5 ml væske sammen med så mange membraner som muligt.
    BEMÆRK: Membraner vil bosætte langsommere end valsede oocytter.
  2. Transfer oocytter til 0,5 ml rør og fjerne tilbageværende væske. Successivt tilføje og fjerne 500 pi20%, 40% og 50% formamid løsninger, nuterende i 10 minutter i hver opløsning.
    BEMÆRK: Oocytter vil bosætte langsommere med højere procentdele af formamid.
  3. Fjerne væske, tilsæt derefter 500 pi 50% formamid-opløsning, og nutate ved 37 ° C i 1 til 5 timer.
    BEMÆRK: Længere inkubationer resultere i bedre sonde penetration.
  4. Fjerne væske, efterlod ikke mere end ~ 100 pi oocytter, og der tilsættes 36 ul hybridiseringsopløsning plus 2 pi probe (50 ng / pl) og 2 pi vand eller 2 pi af en 2 nd probe (tabel 1).
  5. Inkuber ved 91 ° C i 3 minutter (kun FISH) eller 80 ° C i 20 min (FISH plus immunfluorescens), efterfulgt af inkubation i et 37 ° C vandbad natten over.
    BEMÆRK: kan udføres Disse trin i en thermocycler.
  6. Fjern ikke væske. Tilføj 500 pi 50% formamid-opløsning og nutate ved 37 ° C i 1 time.
  7. Lad bilægge, fjerne væske, tilsættes 500 pi 50% formamid løsning, end nutate ved 37 ° C i 1 time.
  8. Lad henstå, fjerne væske, tilsættes 500 pi 20% formamid-opløsning, og nutate ved stuetemperatur i 10 min.
  9. Udfør tre hurtige vaske i 500 pi 2x SSCT (lad bilægge, fjern derefter tilføje væske, vend flere gange, gentag.) Lad bilægge, fjerne væske, tilsæt derefter 500 pi PTB og nutate i 4 timer.

8. Antistof Farvning efter FISH

  1. Fjerne væske fra oocytter, fylde med PTB til 300 pi, og der tilsættes 10 pi anti-α-tubulin antistof konjugeret til FITC. Alternativt kan andre antistoffer anvendes, efter ovenstående protokol. Nutate ved stuetemperatur natten over.
  2. Vask oocytter gang i 15 min med 500 pi PTB, fjerne væske, tilsæt derefter 0,5 pi Hoechst 33342 og 500 pi PTB og nutate i 7 min.
  3. Vask oocytter to gange i 15 min hver med 500 pi PTB.
    BEMÆRK: Oocytter kan være monteret på en slæde umiddelbart eller kan opbevares i PTB ved 4 ° C, indtil den skalbilleddannelse. Hold oocytter i mørke så meget som muligt, når fluorescerende antistoffer er blevet tilføjet.
Gentag navn kromosom Oligo Sequence *
359 X GGGATCGTTAGCACTGGTAATTAGCTGC
AACAC 2 AACACAACACAACACAACACAACACAACACAACACAACAC
dodeca 3 CCCGTACTGGTCCCGTACTCGGTCCCGTACTCGGT
1,686 2 + 3 AATAACATAGAATAACATAGAATAACATAG
AATAT 4 (+ Y) AATATAATATAATATAATATAATATAATAT
* 359 sekvens fra Eric Joyce, personlig kommunikation, andre sekvenser fra Sullivan et al. 8

Tabel 1: FISH prober til Drosophila centromere gentagelser.

Medicin opløsningsmiddel stamkoncentration Endelig koncentration Tidspunkt for behandling Effekt
colchicin ethanol 125 mM 150 uM 10 min eller 30 min destabilisere ikke-kinetochore (10 min) 9 eller alle (30 min) mikrotubuli
paclitaxel DMSO 10 mM 10 uM 10 min stabilisere microtubules
Binucleine 2 DMSO 25 mM 25 uM 20 min hæmme Aurora B kinase 10

Tabel 2: Drug behandling.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

De metoder, vi har beskrevet her, vil resultere i indsamlingen af sene Drosophila oocytter, der repræsenterer tre stadier af meiose (figur 1). Oocytter i profase er kendetegnet ved tilstedeværelsen af kernemembranen, som er synlig ved den manglende tubulin signal i området omkring karyosome (figur 1A). Prometafasen er perioden efter opdeling nuklear kappe, i hvilken spindel samler. Under prometafasen, den karyosome antager en karakteristisk form, bliver aflange ofte med de 4 th kromosomer bortset fra den vigtigste karyosome masse (figur 1B). Prometafasen slutter med metafase, hvor Drosophila oocytter naturligt arrestere indtil ægløsning. I metafase oocytter har karyosome tilbagetrukket til en rund form (figur 1C).

Vi beskriver her metoder at manipulere hastigheden af æglægning af Drosophila hunner til berige for oocytter enten i prometafasen eller metafase. Oocytter fra prometafasen-berigede samlinger viser ofte den aflange karyosome (figur 2A), mens metafase-beriget samlinger eller samlinger fra jomfruelige Drosophila hundyr, som næsten helt eliminerer æglægning, primært vise runde karyosome (figur 2B). Interessant prometafasen-berigede kollektioner viser også typisk meget mere robust spindler, antyder, at både karyosome og spindel skift mellem prometafasen og metafase i Drosophila oocytter 9.

Figur 3 viser repræsentative billeder fra de to protokoller, der er beskrevet her. Antistoffer mod α-tubulin (for at vise spindlen), CENP-C (for at vise centromerer), og INCENP (for at vise den centrale spindel) blev anvendt på oocytter fikseret med formaldehyde / heptan (figur 3A). Prober til de repetitive centromere sekvenser på 2. kromosom (AACAC) og 3. kromosom (dodeca) blev anvendt på oocytter fikseret med formaldehyd / cacodylat og co-farvet med en α-tubulin antistof ifølge FISH-protokollen (figur 3B). Den AACAC sonde vises som flere grupperet foci, mens dodeca sonde vises som en enkelt fokus per kromosom. Oocytter blev behandlet med 150 pM colchicin i 10 min blev fikseret med formaldehyd / heptan (figur 3C). Denne behandling fjerner de fleste ikke-kinetochore-mikrotubuli, hvilket resulterer i alle mikrotubuli i kontakt med DNA ved centromerfusioner-mærkede foci. Oocytter behandlet med 10 pM paclitaxel i 10 min for rigelig mikrotubuli i cytoplasmaet, men ringe effekt på spindlen mikrotubuli (figur 3D). Oocytter behandlet med 25 pM Binucleine 2 for 20 minutter til at hæmme Aurora B kinase show fuldstændig tab afspindel mikrotubuli (figur 3E).

figur 1
Figur 1: Tre stadier af modne Drosophila oocyter:. Profase, er prometafasen, og Metafase Konfokal billeder af Drosophila oocytter i profase (A), prometafasen (B), og metafase (C) af meiosen I. DNA vist i blå og tubulin er vist med grønt i flettede billeder. Mellemværker i (B) og (C) viser DNA i hvidt. Scale barer = 10 um. Klik her for at se en større version af dette tal.

Figur 2
Figur 2:Prometaphase- vs. metafase-beriget samlinger af Drosophila oocytter. Konfokale billeder af Drosophila oocytter fra prometafasen-beriget (A) eller metafase-berigede (B) samlinger. DNA er vist i blåt og tubulin er vist i grøn. Scale barer = 10 um. Klik her for at se en større version af dette tal.

Figur 3
Figur 3: Antibody farvning, FISH, og medicinsk behandling af Drosophila oocytter Konfokal billeder af Drosophila oocytter med DNA i blåt og tubulin i grøn.. Scale barer = 10 um. (A) Immunofluorescens i formaldehyde / heptan fiksering med INCENP (central spindel) i rød og CENP-C (centromerer) i hvidt. (B) FISH i formaldehyd / cacodylat fiksering med AACAC vist i rødt og dodeca vist i hvid. (C) Behandling med 150 pM colchicin i 10 min med CENP-C vist i rødt. Behandling med 10 pM paclitaxel i 10 min (D) eller 25 uM Binucleine 2 i 20 min (E). Klik her for at se en større version af dette tal.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Iscenesættelse Drosophila oocyter

Selv om en langstrakt karyosome ofte ses i prometafasen oocytter, ved hjælp karyosome form at skelne prometafasen fra metafase oocytter kan være problematisk. Under prometafasen, den karyosome begynder som en rund form, forlænger, og derefter går tilbage til en rund form som oocyt nærmer sig metafase anholdelse. Det betyder, at mange prometafasen oocytter ikke har en aflang karyosome. Desuden, hvis mutant eller lægemiddel-behandlede oocytter undersøgt, karyosome form kan påvirkes, hvilket udelukker anvendelse af denne fremgangsmåde til fase oocytter. Fordi andre markører til at skelne disse faser er ikke tilgængelige i øjeblikket, bruger vi den ovenfor beskrevne metode til at manipulere hastigheden af æg-lægning af Drosophila hunner at berige for oocytter enten i prometafasen eller metafase. Rationalet er, at hvis oocytter bruger en bestemt mængde tid i prometafasen og ubestemt mængde tid arrserede i metafase, som varer indtil æglægning, så hurtigere æglægning vil skævt i retning af en højere procentdel af prometafasen oocytter, mens langsommere æglægning vil berige for metafase. Mængden af indsats, der kræves for at indsamle jomfruelige hunner eller indsamle hunner over en kortere tidshorisont end 2 dage, som beskrevet af Gilliland et al. 6, ikke belønnet med en betydelig stigning i prometafasen oocytter. Det er også umuligt at bruge dorsale vedhæng til fase oocyter tilberedt med denne protokol som dorsale vedhæng fjernes sammen med membranerne. Selv om det ikke er muligt at iscenesætte individuelle oocytter med 100% sikkerhed ved hjælp af denne metode, data fra prometafasen beriget eller metafase-beriget samlinger kan tages sammen for at drage konklusioner om disse forskellige stadier 9.

Drosophila oocytter ikke befrugtet indtil de passerer gennem æggelederen; derfor, fordi oocytterne indsamles for the-protokoller, der er beskrevet her undersøger oocytter taget før æglægning, har disse oocytter ikke blevet befrugtet. Passage gennem æggelederen forårsager også oocytten at aktivere og genoptage cellecyklusprogression. Metoder til at undersøge cellecyklus faser efter metafase jeg eksisterer 11,12, men er uden for rammerne af denne protokol.

Fiksering Metode Overvejelser

Vi beskriver to separate metoder til fiksering af sene Drosophila oocytter. Den formaldehyd / cacodylat fiksering metode blev først beskrevet af Theurkauf og Hawley 3 og formaldehyd / heptan fiksering metode blev først beskrevet af Zou et al. 4. Desuden anvendes en tredje fremgangsmåde (methanol fiksering) med ca. 13, men som ikke er beskrevet her. Fjernelse af oocytten membraner er noget vanskeligere efter formaldehyd / heptan fiksering sammenlignet med formaldehyd / cacodylat. Dette skyldes, at "rulle" afhængers på friktion mellem dækglasset og ægcelle, og formaldehyd / heptan fiksering gør oocytterne mere glat. Trods dette yderligere vanskelighed, vores første valg af fiksering metode, når afprøvning af nye antistoffer er formaldehyd / heptan fordi det virker bedst for størstedelen af ​​antistoffer, som vi har prøvet. På den anden side, foretrækker vi formaldehyd / cacodylat fiksering til FISH, primært for at lette fjernelse membran, skønt formaldehyd / heptan fiksering også har været vellykket. Begge disse metoder bevare oocyt morfologi bedre end methanol fiksering, og derfor anbefaler vi methanol fiksering kun i tilfælde af antistoffer, som er refraktære over for formaldehyd-baserede fiksering metoder.

De her beskrevne protokoller fokus på fast imaging, for at demonstrere effektive metoder til at gøre modne Drosophila oocytter modtagelig for antistof penetration, nemlig ved at fjerne ægget membraner. Alternative metoder til membran removal (med pincet 14 eller lydbehandling 13) er mulige; dog finder vi "rullende" for at være den mest effektive og pålidelige metode. Teknikker til direkte billedvisning er også blevet beskrevet andetsteds 14-16 og er ikke omfattet af denne protokol.

FISH Anbefalinger

FISH i Drosophila oocytter blev oprindeligt beskrevet af Dernburg et al. 5. Denne protokol er designet til at give optimale betingelser for probehybridisering til de kondenserede oocyt kromosomer, men den oprindelige protokol var ikke optimal for immunfluorescens. Den ovenfor beskrevne metode omfatter tilpasninger, vi har gjort for at forbedre antistof farvning af α-tubulin, hvilket primært det, vi bruger, når du udfører FISH. For andre antistoffer, sænke temperaturen af ​​denatureringstrin (trin 7,5) fra 80 ° C kan være nødvendig.

De sonder, der er anført her, er forrepetitive sekvenser i heterochromatin nær centromerer. Fordi disse sekvenser er meget gentagne, proberne anneale til flere steder, og de kollektive signaler er ganske stærk. Vi har haft ringe succes med sonder til sekvenser i euchromatin, muligvis på grund af den unikke struktur af kromosomerne, mens der er indeholdt i den kondenserede karyosome.

Imaging

Ældre Drosophila oocytter, ligesom oocytter fra de fleste organismer, er store, enkelte celler. Det betyder, at der er en stor mængde cytoplasma, der indeholder en enkelt kerne. Heldigvis er dette kerne, også kendt som en karyosome i Drosophila, kan let identificeres, da det typisk er placeret lige under den dorsale vedhæng tæt på cortex. Den dorsale vedhæng fjernes sammen med oocytten membraner, men karyosome kan stadig være placeret ved at finde den lille divot i oocyt cortex hvor vedhængene once var. De bedste billeder opnås fra oocytter, der er blevet monteret med denne divot vendende dækglasset eftersom dette placerer karyosome tættest på målet. Selv om det kan være muligt at arrangere de oocytter i denne orientering før montering, foretrækker vi at montere mange oocytter tilfældigt og derefter søge slide for dem i den foretrukne orientering.

Fremtidige applikationer

I fremtiden vil det være vigtigt at identificere markører, der pålideligt adskiller prometafasen I og metafase I spindler. At være i stand til mere pålideligt iscenesætte oocytter vil reducere afhængigheden af ​​flere arbejdskraftintensive alternativer, såsom billeddannelse stort antal fase beriget oocytter eller levende billeddannelse, som også har sine mellemstationer problemer. Denne metode er en grundlæggende metode, som kan anvendes til at drage fordel af fremskridt i Drosophila genetik som nye værktøjer bliver tilgængelige til at ændre eller knockout genprodukter. Dette omfatter metodertil direkte målprotein aktivitet med nye lægemidler eller målrettede nedbrydning strategier. Desuden er disse metoder ikke begrænset til afbildning meiotiske spindler. Enhver struktur i oocytten, såsom actincytoskelettet, kunne analyseres ved hjælp af disse metoder.

Subscription Required. Please recommend JoVE to your librarian.

Materials

Name Company Catalog Number Comments
15 ml conical tubes Various
16% formaldehyde Ted Pella, Inc. 18505 HAZARDOUS; once opened, discard after one month
250 ml beakers Various
5 ml tubes Various
active dry yeast Various mix with water to make a paste the consistency of peanut butter
anti-α-tubulin antibody conjugated to FITC Sigma F2168 clone DM1A
Binucleine 2 Sigma B1186 HAZARDOUS
blender Various
bovine serum albumin Sigma A4161
calcium chloride Various
colchicine Sigma C-9754 HAZARDOUS
coverslips VWR 48366-227 No. 1 1/2
dextran sulfate Various
DMSO Various
EGTA Various
ethanol Various
forceps Ted Pella, Inc. 5622 Dumont tweezers high precision grade style 5
formamide Sigma 47670-250ML-F
glass slides VWR 48312-003
glucose Various
graduated 1.5 ml tubes Various
HEPES VWR EM-5330 available from several venders
Hoechst 33342 Various
magnesium chloride Various
methanol Various
large mesh (~1,500 µm) VWR AA43657-NK variety of formats and other suppliers, 12 or 14 mesh
small mesh (~300 µm) Spectrum labs 146 424 variety of formats, e.g., 146 422 or 146 486
nutator Various
Pasteur pipets Various
potassium acetate Various
Cacodylic acid Sigma C0125 HAZARDOUS; alternatively, sodium cacodylate may be substituted
potassium hydroxide Various
sodium acetate Various
sodium chloride Various
sodium citrate Various
sodium hydroxide Various
sucrose Various
taxol (paclitaxel) Sigma T1912 HAZARDOUS
Triton X-100 Fisher PI-28314
Tween 20 Fisher PI-28320
vortex Various

DOWNLOAD MATERIALS LIST

References

  1. Bridges, C. B. Non-disjunction as proof of the chromosome theory of heredity. Genetics. 1, (1), 1-52 (1916).
  2. Hassold, T., Hunt, P. To err (meiotically) is human: the genesis of human aneuploidy. Nat Rev Genet. 2, (4), 280-291 (2001).
  3. Theurkauf, W. E., Hawley, R. S. Meiotic spindle assembly in Drosophila females: behavior of nonexchange chromosomes and the effects of mutations in the nod kinesin-like protein. J Cell Biol. 116, (5), 1167-1180 (1992).
  4. Zou, J., Hallen, M. A., Yankel, C. D., Endow, S. A. A microtubule-destabilizing kinesin motor regulates spindle length and anchoring in oocytes. J Cell Biol. 180, (3), 459-466 (2008).
  5. Dernburg, A. F., Sedat, J. W., Hawley, R. S. Direct evidence of a role for heterochromatin in meiotic chromosome segregation. Cell. 86, (1), 135-146 (1996).
  6. Gilliland, W. D., Hughes, S. F., Vietti, D. R., Hawley, R. S. Congression of achiasmate chromosomes to the metaphase plate in Drosophila melanogaster oocytes. Dev Biol. 325, (1), 122-128 (2009).
  7. Gilliland, W. D., et al. Hypoxia transiently sequesters mps1 and polo to collagenase-sensitive filaments in Drosophila prometaphase oocytes. PLoS One. 4, (10), e7544 (2009).
  8. Sullivan, W., Ashburner, M., Hawley, R. S. Drosophila Protocols. Cold Spring Harbor Laboratory Press. (2000).
  9. Radford, S. J., Hoang, T. L., Głuszek, A. A., Ohkura, H., McKim, K. S. Lateral and End-On Kinetochore Attachments Are Coordinated to Achieve Bi-orientation in Drosophila Oocytes. PLoS Genet. 11, (10), e1005605 (2015).
  10. Smurnyy, Y., Toms, A. V., Hickson, G. R., Eck, M. J., Eggert, U. S. Binucleine 2, an isoform-specific inhibitor of Drosophila Aurora B kinase, provides insights into the mechanism of cytokinesis. ACS Chem Biol. 5, (11), 1015-1020 (2010).
  11. Mahowald, A. P., Goralski, T. J., Caulton, J. H. In vitro activation of Drosophila eggs. Dev Biol. 98, (2), 437-445 (1983).
  12. Page, A. W., Orr-Weaver, T. L. Activation of the meiotic divisions in Drosophila oocytes. Dev Biol. 183, (2), 195-207 (1997).
  13. Tavosanis, G., Llamazares, S., Goulielmos, G., Gonzalez, C. Essential role for gamma-tubulin in the acentriolar female meiotic spindle of Drosophila. EMBO J. 16, (8), 1809-1819 (1997).
  14. Endow, S. A., Komma, D. J. Spindle dynamics during meiosis in Drosophila oocytes. J Cell Biol. 137, (6), 1321-1336 (1997).
  15. Matthies, H. J., Clarkson, M., Saint, R. B., Namba, R., Hawley, R. S. Drosophila Protocols. Sullivan, W., Ashburner, M., Hawley, R. S. Cold Spring Harbor Laboratory Press. 67-85 (2000).
  16. Colombié, N., et al. Dual roles of Incenp crucial to the assembly of the acentrosomal metaphase spindle in female meiosis. Development. 135, (19), 3239-3246 (2008).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics