Conjugación de apareamiento Los ensayos para el análisis específico de la secuencia de proteínas de transferencia que participan en la conjugación bacteriana

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Erdogan, F., Lento, C., Yaseen, A., Nowroozi-Dayeni, R., Kheyson, S., Audette, G. F. Conjugative Mating Assays for Sequence-specific Analysis of Transfer Proteins Involved in Bacterial Conjugation. J. Vis. Exp. (119), e54854, doi:10.3791/54854 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

La transferencia de genes y proteínas a nivel micro del organismo desempeña un papel central en la supervivencia bacteriana y evolución, así como los procesos de infección. El intercambio de ADN entre bacterias o entre una bacteria y una célula se puede lograr a través de la transformación, conjugación o transducción de vector. 1,2 La conjugación es único en comparación con la transformación y la transducción en que durante la conjugación entre las bacterias gram-negativas tales como Escherichia coli, la transferencia de DNA se produce de una manera controlada de donantes mediante el cual un sistema macromolecular compleja conecta las células donantes y receptores. La conjugación es también la manera más directa en la cual las células bacterianas interactúan con las células huésped para inyectar los genes, las proteínas o los productos químicos en los sistemas de acogida. 3 Muy a menudo, la transferencia de dichos agentes tienen efectos notables sobre el anfitrión, que van desde la patogénesis y la carcinogénesis de acoger la evolución y la adaptación. Se ha demostrado que recombinatio conjugativon aumenta la tasa de adaptación de 3 veces en las bacterias con altas tasas de mutación en condiciones de estrés ambiental. 4 Por otra parte, la conjugación es, con mucho, la ruta más común a través del cual se extienden los genes de resistencia a antibióticos en cepas bacterianas. 5,6

Los microorganismos han evolucionado los sistemas de secreción especializados para apoyar la transferencia de macromoléculas a través de las membranas celulares; en la actualidad hay 9 tipos de sistemas de secreción (DST) en bacterias gram negativas que se han descrito: T1SS, T2SS, T3SS, T4SS, T5SS, T6SS, T7SS, así como la SEC (secreción) y Tat (de dos arginina translocación) vías. 7,8 Cada tipo de sistema de secreción se divide en diferentes subtipos, una necesidad debido a la diversidad de las proteínas y el carácter distintivo de vías existentes en diferentes cepas bacterianas. Por ejemplo, en el sistema de secreción de tipo IV (T4SS), los sistemas de Ti y Cag facilitar el transporte, mientras que el efector F-plásmido, R27 unand pKM101 T4SSs facilitar la transferencia de un plásmido conjugativo. 7,9,10 Una comprensión detallada de los mecanismos por los cuales los organismos ensamblan sus respectivos sistemas de secreción de proteínas de sus componentes y comparten contenido celular con un receptor o su entorno es un factor importante en el desarrollo de estrategias dirigidas a combatir los microorganismos y procesos de patógenos la infección celular.

Después de la conjugación bacteriana identificación inicial en E. coli por Lederberg y Tatum, 11 se han identificado y caracterizado un gran número de plásmidos móviles y conjugativo. 12 Tales plásmidos móviles muestran una considerable gama es de tamaño (de 1 a más de 200 kilobases (kb)), sin embargo todos los plásmidos móviles contienen una relaxasa, que reconoce el origen de transferencia (oriT) permitiendo de ese modo la transmisión del plásmido. plásmidos de conjugación más genes codifican para el montaje de un T4SS funcional, así como un tipo deIV proteína de acoplamiento. 12 Por ejemplo, el 100 kb del plásmido F de E. coli codifica todos los genes de conjugación dentro de una región de transferencia de 33,3 kB (TRA). Los 13 genes en la región tra del plásmido F codifican todas las proteínas que facilitan la formación del pilus, el apareamiento formación de la pareja (MPF), la transferencia de ADN y las funciones de exclusión durante la transferencia de plásmido conjugativo. 10,14,15 Un volumen importante de información está disponible para conjugación T4SSs, por más detallados estudios estructurales de las proteínas y complejos de conjugación sólo se están volviendo más reciente disponible. 16-28

Con el fin de montar una visión global del proceso de conjugación, se requiere un acoplamiento de los estudios estructurales detallados para mutacional análisis de proteínas de transferencia de conjugación. Esto se puede lograr a través de ensayos de apareamiento de conjugación. Para el plásmido F, cada proteína codificada dentro de la región tra juega un papel en la co mediada-Fnjugation; Por lo tanto, el knockout / deleción de un gen de transferencia va a suprimir la capacidad de conjugación de la célula (Figura 1). Mientras plásmidos móviles más pequeños son más propicias a los procedimientos de eliminación estándar, por los plásmidos conjugativos más grandes tales como F, knockouts de genes se logran más fácilmente por medio de recombinación homóloga en el que el gen diana se sustituye con uno transmitir un gen de resistencia a antibiótico distinto. En el protocolo actual, que emplean la recombinación homóloga para sustituir un gen de transferencia de interés con cloranfenicol acetiltransferasa (CAT) de la 55 kb F plásmido derivado pOX38-Tc; 29,30 plásmido resultante knockout, pOX38-Tc Δgene :: Cm, facilita la resistencia a la presencia de cloranfenicol (Cm) en el medio de crecimiento. Las células donantes que albergan pOX38-Tc Δgene :: Cm no son capaces de afectar a la transferencia de ADN conjugativo / apareamiento tal como se observa a través del uso de un ensayo de apareamiento; la eficiencia de acoplamiento de una célula donante pOX38-Tc Δgene :: Cm y un recip normalesient disminuirá o, más a menudo, ser abolida. la transferencia por conjugación del plásmido pOX38-Tc Δgene :: Cm se puede restaurar a través de una pequeña recuperación plásmido que alberga el gen de transferencia concentrados. Este plásmido de recuperación puede ser uno que proporciona la expresión constitutiva, como pK184 plásmido (pK184-gen), 31 o una que proporciona expresión inducible mientras que el plásmido se dirige correctamente el gen a la ubicación correcta dentro de la célula (citoplasma o periplasma). En consecuencia, en los ensayos de apareamiento entre este nuevo donante (que alberga pOX38-Tc Δgene plásmidos :: Cm + pK184-gen) y una célula receptora, se espera que la eficiencia de acoplamiento para restaurar a cerca de la de un ensayo normal de apareamiento donante-receptor. Este sistema permite a uno para sondear la función del gen noqueado a través de la generación de una serie de construcciones de pK184-gen (deleciones o mutaciones puntuales) y prueba de la capacidad de cada constructo para restaurar la capacidad de acoplamiento de la pOX38-Tc Δgene :: Cm albergar célula donantes.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Generación de construcciones de ADN

  1. El diseño de oligómeros para la recombinación homóloga del gen diana
    1. Diseño de un solo 55-72 pb oligómero hacia adelante de la siguiente manera: (a) recoger una secuencia de nucleótidos de largo 19 a 32 pares de bases que es homóloga a una secuencia de ADN en la región pb 10 a 100 corriente arriba del sitio de inicio de la 5 'del gen de la cloranfenicol acetiltransferasa en el plásmido pBAD33 comercial, 32 y (b) seleccionar un 36-54 pb de longitud secuencia de nucleótidos homólogas a una región 10-150 pb aguas abajo del sitio de inicio de los 5 'del gen diana de interés.
      1. Únete "fin de la secuencia de nucleótidos recogidos en (b) a la 5 'del extremo 3 de la secuencia de nucleótidos recogió en (a), dando así un solo 55-72 largo oligómero adelante.
    2. Diseño de un solo oligómero inversa 55 a 72 pares de bases de la siguiente manera: (a) recoger una secuencia de nucleótidos de largo 19 a 32 pares de bases que es homóloga a una secuencia de ADN en la región pb aguas abajo 10-100del extremo 3 'del gen de la cloramfenicol en el plásmido pBAD33 comercial, y (b) seleccionar un 36-54 pb de longitud de nucleótidos secuencia homóloga a una región dentro de 10 a 150 pb aguas arriba del sitio 3' final del gen diana de interés .
      1. Unirse a "fin de la secuencia de nucleótidos recogido en (b) a los 5 'del extremo 3' de la secuencia de nucleótidos recogido en (a) para que sea un único oligómero.
      2. Copia este oligómero en cualquier software de bioinformática disponible y convertir secuencia en su complemento inverso. Esto le dará un solo 55-72 pb de longitud oligómero inverso.
    3. El uso de cualquier programa de oligo-analizador disponible, compruebe que los oligómeros de recombinación tienen un contenido GC entre el 40-60%, temperatura de fusión baja de la horquilla (Tm), baja auto y hetero-dimerización Tm 's. Ordenar los cebadores para la síntesis y el envío de cualquier empresa de biotecnología preferido.
  2. La amplificación de la CAT casete de pBAD33 (R Cm
  3. Crecer un cultivo durante la noche (O / N, 16 a 18 h) de las células DH5a que albergan el plásmido pBAD33 en caldo Lisogenia estéril (LB) con 20 mg / ml de cloranfenicol (Cm) con agitación a 200 rpm y 37 ° C.
  4. Centrifugadora 6-8 ml del cultivo O / N a temperatura ambiente, 5.000 xg durante 3 min. Decantar el sobrenadante y extraer el plásmido pBAD33 del sedimento utilizando un mini-prep kit plásmido (Tabla de Materiales) y el protocolo del fabricante.
  5. Hacer un resumen del ADN plásmido pBAD33 añadiendo lo siguiente en un tubo estéril en el orden dado: volumen adecuado de agua doblemente destilada (ddH2O) a un volumen final de 50 l, volumen 1 g de pBAD33 plásmido, 5 l de 10x tampón de reacción de la enzima, y ​​0,5 l de enzima de restricción AvaI (RE). Mezclar suavemente con la pipeta y dejar que la reacción continúe durante 1 hora a 37 ° C. Heat inactivar la reacción durante 20 min (minutos) a 80DO. Conservar las muestras a -20 ° C durante no más de 24 horas para minimizar la degradación de extremo pegajoso.
  6. Preparar una agarosa 1,2% de separación de gel por mezcla de 1,2 g de agarosa con 100 ml de 1x TAE (Tris 40 mM, pH 8,5; 20 mM de ácido acético; EDTA 1 mM) de tampón en un matraz Erlenmeyer de 250 ml. El calor y el remolino que se disuelva completamente en un microondas. Detener el calentamiento de inmediato cuando el líquido comienza a hervir y agitar el frasco.
    1. Enfriar la agarosa líquida durante 3 minutos a temperatura ambiente mientras se agita, añadir 2 l de 10 mg / ml de bromuro de etidio y agitar para mezclar. Verter la agarosa en una bandeja de gel con un peine bien y dejar que se solidifique por 1 h a temperatura ambiente. geles se almacena a 4 ° C para un máximo de 2 días en tampón TAE 1x.
  7. Mezclar cada RE digerir de 1.2.3 con 0,2 volumen de colorante de carga de ADN (10 l de colorante por 50 reacción l) por pipeteado. Cargar 5 l de 500 escalera g / ml de ADN en el primer pocillo y toda la mezcla RE DIGEST-colorante en otro pozo en la unagarose gel. Usar 2-3 pozos para cargar todo el volumen de reacción en el gel.
    1. Dejar correr el gel apenas sumergido en tampón TAE 1x y operando a 45-50 V (4,5-5 V / cm) durante 65 min en un dispositivo de electroforesis en gel.
  8. El uso de un armario de UV y una maquinilla de afeitar estéril, cortar rápidamente la banda de 2,8 kb que corresponde a la secuencia de CAT del gel para minimizar la exposición UV de ADN. Extraer el ADN de la porción de gel de corte a cabo utilizando un kit de extracción de gel (Tabla de Materiales) según el protocolo del fabricante.
    Nota: Tenga cuidado de no exponer la piel directamente bajo los rayos UV y el mango de la navaja con cuidado.
  9. Amplificar el casete CAT extraído de 1.2.6 por Reacción en Cadena de la Polimerasa (PCR) usando los cebadores diseñados en 1,1 que contienen voladizos homólogas a la secuencia del gen para permitir la recombinación homóloga. Las reacciones de PCR se establecieron en hielo usando las instrucciones del fabricante (Tabla de Materiales) en el siguiente orden:
    1. En untubo de PCR estéril, añadir un volumen apropiado de ddH 2 O hasta un volumen final de 50 l, seguido de 10 l de tampón de PCR, 1 l de dNTPs 10 mM, 2,5 l de Cebador directo 10 M, 2,5 l de 10 mM Cebador inverso , 1-25 ng de ADN molde a partir de 1.2.6 y 0.5 l de 100 unidades / l de ADN polimerasa.
    2. Establecer un control negativo que lleva los mismos componentes que 1.2.7.1 pero con la excepción de plantilla de ADN. Utiliza un volumen adecuado de ddH2O en lugar de ADN molde. Establecer un control positivo utilizando ADN molde y los cebadores que han sido probados para trabajar en una reacción de PCR, tales como los proporcionados como control positivo por el fabricante.
    3. Mezclar todos los contenidos de la reacción suavemente por pipeteado.
    4. Amplificar mediante PCR utilizando los ajustes siguientes: desnaturalización inicial durante 30 s a 98ºC, 30 ciclos de desnaturalización durante 10 s a 98ºC, hibridación del cebador durante 20 s, extensión durante 20 s por kilobases de amplicón a 72 ° C y una aletaal extensión de 10 min a 72 ° C. Conservar las muestras a -20 ºC.
  10. Confirmar el tamaño correcto de la amplificación mediante electroforesis en gel de agarosa (véase 1.2.4-1.2.5) mediante el uso de solamente 5 l de cada reacción. Se purificó el amplicón de PCR usando un kit de purificación de PCR y el protocolo del fabricante. Tienda purificó ADN a -20 ºC.
  • El plásmido pK184 Recuperación-gen
    1. Diseñar un cebador directo a partir de su extremo 5 'y yendo hacia el extremo 3' en el siguiente orden: (a) recoger 4 nucleótidos al azar (una combinación de adenina, timina, guanina y citosina) para la eficacia de la escisión, que se adjunta a (b) la enzima de restricción EcoRI (RE) secuencia del sitio de corte (GAATTC), seguido por (c) una larga secuencia de nucleótidos 21 a 25 pares de bases que es homóloga al extremo 5 'del gen de interés, incluyendo el codón de inicio. Si el gen diana contiene un sitio EcoRI, elegir otro RE apropiado desde el sitio de clonación múltiple pK184.
    2. En el caso de genes que codifican las proteínas periplásmicas, incluir una secuencia líder adicional entre el sitio RE y el codón de inicio en el cebador directo.
    3. El uso de cualquier oligo-analizador disponible, compruebe que los cebadores tienen un contenido GC entre el 40-60%, baja la horquilla de Tm, baja auto y hetero-dimerización Tm 's. Ordenar los cebadores para la síntesis.
    4. Crecer un cultivo O / N de las células DY330R pOX38-Tc en estéril LB que contiene 10 mg / ml de tetraciclina (Tc) con agitación a 32 ºC y 200 rpm. Centrifugadora 6-8 ml del cultivo O / N a temperatura ambiente, 5.000 xg durante 3 min. decantar elsobrenadante y se extrae el ADN plasmídico a partir del sedimento utilizando un mini-prep kit plásmido (Tabla de Materiales) y el protocolo del fabricante.
    5. Amplificar el gen completo de interés con los cebadores de 1.3.1-1.3.5 usando pOX38-Tc como la plantilla (ver 1.2.7.1-1.2.7.3).
    6. Confirmar el tamaño correcto de la amplificación mediante electroforesis en gel de agarosa (véase 1.2.4-1.2.5) mediante el uso de solamente 5 l de cada reacción. Se purificó el ADN amplificado utilizando un kit de purificación de PCR y el protocolo del fabricante. Tienda de ADN purificado a -20 ° C.
    7. Hacer un doble digestión tanto del ADN del plásmido pK184 disponible en el mercado y el gen amplificado (de 1.3.7.), Mediante la adición de lo siguiente en un tubo estéril en el orden dado: volumen apropiado de ddH 2 O hasta un volumen final de 50 l , 1 g de volumen pK184 plásmido, 5 l de tampón de reacción 10x enzima, y ​​1 l de cada EcoRI y HindIII.
      1. Mezclar suavemente con la pipeta y dejar que la reacción continúe durante 1 ha 37 ºC. Heat inactivar la reacción durante 20 min a 80 ºC. Conservar las muestras a -20 ° C durante no más de 24 horas para minimizar la degradación de extremo pegajoso.
        Nota: El tipo de nucleasa de restricción utilizada aquí depende del sitio de la nucleasa de restricción que fue diseñado en los cebadores en los pasos 1.3.1 y 1.3.2.
      2. Como control positivo, configurar digestiones individuales del plásmido pK184 mediante la preparación de la misma reacción que en 1.3.8 excepto agregar sólo uno de los REs a un tubo de reacción. Haga esto por separado con ambos RES.
    8. Ejecutar las digestiones en un gel de agarosa al 1,2% usando protocolos 1.2.4-1.2.5 extraer el ADN de doble digerir fragmentos de tanto pK184 y el gen de interés de acuerdo con el paso 1.2.6.
    9. Ligar el inserto de gen en el vector pK184 mediante la adición de los componentes en un tubo estéril en el siguiente orden: 2 l de 10x tampón de T4 ADN ligasa, un total de 100 ng de ADN compuesta de un 1: vector 3: insertar (pK184: gen) relación, ddH2O hasta unavolumen total de 20 l y 1 l de ligasa de ADN de T4. Como control negativo, configure una reacción similar usando 100 ng de vector sin el gen inserto.
      1. Mezclar con cuidado todos los contenidos de la reacción utilizando una micropipeta y se incuba durante 30 minutos a 25 ° C. Heat-inactivar la reacción de ligamiento durante 10 min a 65 ° C y luego se coloca en hielo.
    10. Mientras que en el hielo, añadir 15 l de la pK184-gen reacción de ligación de la etapa 1.3.10 a 100 l de células DH5a químicamente competentes en un tubo estéril de 1,5 ml. Mezclar suavemente con la pipeta e incubar en hielo durante 10 min. Haga lo mismo para la muestra de control negativo. Para un control positivo, utilizar 20 a 100 ng de un plásmido tal como pBAD33 y transformarla en 50 l de DHα células.
    11. Directamente transferir las muestras de hielo en un baño de agua C 42 ° y se incuba durante 90 segundos. Esto proporciona a las células un choque de calor y permite a la absorción del ADN del plásmido.
    12. Colocar de nuevo las células en hielo durante otro5 min y a continuación, añadir 900 l de LB. estéril Incubar a 37 ° C durante 1 h con agitación a 125 rpm.
    13. Alícuota de un volumen de 100 l de muestra de cada reacción de ligación en 1.3.13 sobre una placa de agar que contiene 50 mg / ml de kanamicina (Km) y la propagación de las células usando un esparcidor estéril. La placa de control positivo debe tener antibióticos apropiados. Mantenga el área estéril y trabajar cerca de una llama. Se incuba la placa boca abajo a 37 ° C durante la noche.
    14. Usando una pipeta estéril o bucle, cosechar una sola colonia distinta de las células y inocular un 20 ml de LB estéril con 50 mg / ml Km. Mantenga el área estéril y trabajar cerca de una llama. Cultivar las células O / N a 37 ° C con agitación a 200 rpm.
    15. Hacer 3-5 existencias de glicerol de las células DH5a transformado mediante la mezcla de 500 l de la cultura O / N con 500 l de glicerol 100% estéril (final de 50% v / v) en crio-tubos estériles. Almacenar a -80 ° C.
    16. También centrífuga 6-8 ml del cultivo O / N a temperatura ambiente, 5,000 xg durante 3 min. Decantar el sobrenadante y extraer el plásmido de recuperación pK184-gen a partir del sedimento utilizando un mini-prep kit plásmido (Tabla de Materiales) y el protocolo del fabricante.
  • pK184 - mutantes del gen
    Nota: Los cebadores diseñados para deleciones, inserciones y / o mutaciones puntuales se pueden generar fácilmente utilizando las herramientas disponibles en línea de los fabricantes.
    1. Diseñar cada cebador directo escogiendo una secuencia larga de nucleótidos 18 a 32 pares de bases que es homóloga al extremo 5 'del gen de interés, incluyendo el codón de inicio. cebadores de diseño tales que cada cebador directo se hibrida 30-180 pb aguas abajo de la anterior, resultando en mutantes de deleción que carecen de fragmentos de péptidos N-terminales de longitudes apropiadas.
    2. Diseño de un cebador inverso escogiendo una secuencia de nucleótidos de longitud 18 a 32 pares de bases que es homóloga al extremo 3 'del gen de interés, incluyendo el codón de parada. Copia este imprimación en unaNY programa de bioinformática disponibles y convertir la secuencia en su complemento inverso. Este es el cebador inverso.
      1. En el caso de genes que codifican las proteínas periplásmicas, diseñar el cebador inverso que es el complemento inverso de "final de una secuencia líder que flanquea el extremo 5 'del extremo 3 del gen y se requiere para la correcta localización de la proteína producto en el periplasma.
    3. El uso de cualquier programa de oligo-analizador disponible, compruebe que los cebadores de deleción tienen un contenido GC entre el 40-60%, temperatura de fusión baja de la horquilla (Tm), baja auto y hetero-dimerización Tm 's. Ordenar los cebadores para la síntesis y el envío de cualquier empresa de biotecnología disponible.
    4. Utilizando la construcción pK184-gen obtenido en 1.3 Protocolo como la plantilla y las directrices en 1.2.7-1.2.8, amplificar por PCR las construcciones de deleción con los cebadores diseñados en los pasos 1.4.1-1.4.3 para generar amplicones? X pK184-gen . amplificada tienda de ADN de unat -20 ° C.
    5. Ligar el constructo amplificado utilizando cualquier kit de mutagénesis disponible (Tabla de Materiales).
    6. Transformar cada uno de los productos ligados? X pK184-gen por separado en células DH5a químicamente competentes usando un protocolo estándar de choque térmico (ver 1.3.11-1.3.13).
    7. Alícuota de un volumen de 100 l de muestra de cada reacción de ligación en 1.4.12 sobre una placa de agar que contiene 50 mg / ml Km y la propagación de las células usando un esparcidor estéril. Mantenga el área estéril y trabajar cerca de una llama. Se incuba la placa boca abajo a 37 ° C durante la noche.
    8. Usando una pipeta estéril o bucle, cosechar una sola colonia distinta de las células y inocular a 20 ml de medio estéril LB con 50 mg / ml Km. Mantenga el área estéril y trabajar cerca de una llama. Cultivar las células O / N a 37 ° C con agitación a 200 rpm.
    9. Hacer 3-5 existencias de glicerol de las células DH5a transformadas mediante la mezcla de 500 l de la cultura de O / N con 500 l de glicerol estéril 100% (final 50% v / v) en crio-tubos estériles. Almacenar a -80 ° C.
    10. Centrifugadora 6-8 ml del cultivo O / N a temperatura ambiente, 5.000 xg durante 3 min. Decantar el sobrenadante y extraer el plásmido? X gen pK184 construir a partir del sedimento utilizando un mini-prep kit plásmido (Tabla de Materiales) y el protocolo del fabricante. ADN almacenar a -20 ° C.
  • 2. Generación de pOX38-Tc Δgene :: Cm Las cepas

    1. DY330R pOX38-Tc Δgene :: Cm knockouts
      1. Preparar una cultura / N o de células DY330R pOX38-Tc en 10 ml de LB estéril que contiene 10 mg / ml de Tc. Cultive hasta O / N a 32 ° C y 200 rpm.
      2. Hacer una dilución 1:70 de la cultura de O / N en 20 ml de LB estéril fresca Cultivar las células a 32 ° C hasta que el crecimiento de fase logarítmica media (OD 600 nm 0,4 a 0,6).
      3. Transferencia de 10 ml de cultivo a un matraz estéril y se incuba a 42 ° C durante 15 min a 150 rpm en un temblor ba de aguaXX. Esto inducirá la expresión de proteínas específicas de recombinación en DY330R.
      4. Enfriar la cultura en un baño de hielo-agua durante 10 minutos. Preparar células electrocompetentes de la siguiente manera.
        1. Transferencia de las células enfriadas en tubos cónicos de pre-refrigerados y centrifugar a 4000 xg durante 7 minutos a 4 ºC. Todos los tubos y pipetas que se utilizarán en los próximos pasos deben colocarse a 4 ° C o en hielo para enfriar.
        2. Eliminar el sobrenadante y se resuspendió suavemente las células en 1 ml de ddH helada 2 O. Añadir otros 30 ml de hielo frío ddH2O
        3. Centrifugar las células (4.000 xg, 7 min, 4 ° C), descartar el sobrenadante y se resuspendió suavemente las células en 1 ml de ddH helada 2 O.
        4. Transferencia de las células resuspendidas en pre-refrigerados 1,5 tubos de microcentrífuga ml y centrifugar a 15.000 xg durante 1 min a 4 ºC.
        5. Resuspendió suavemente el precipitado en 200 l de ddH helada 2 O y la alícuota en 50 volúmenes de microlitros. Electrocompetent células pueden ser almacenadas a -80 ° C
      5. Añadir 300 ng del casete CAT amplificado a partir de 1,2 a 50 l de células DY330R pOX38-Tc electrocompetentes mientras se mezcla en hielo, suavemente pipeteando arriba y abajo. Repita este paso utilizando sin modificar plásmido pBAD33 como control positivo.
      6. Transferir las células a una cubeta de electroporación previamente enfriada (-20 ° C) 1 mm. Electroporar las células a 1,8 kV con una constante de 5,5 ms de tiempo, utilizando un electroporador. Inmediatamente después de aplicar el pulso, diluir las células con 1 ml de SOC medios de comunicación y transferir a un tubo de microcentrífuga. Se incuban las células a 32 ° C durante 2 h.
      7. Alícuota de 100 l de cada muestra sobre placas de agar que contiene 10 mg / ml de Tc y 20 mg / ml de Cm y se extienden con un esparcidor estéril. Mantenga el área estéril y trabajar cerca de una llama. Se incuba la placa boca abajo a 32 ° C durante la noche para seleccionar los recombinantes exitosos. El casete CAT introducido en la célula se someterá a re homólogacombinación con el gen de interés y crear el DY330R pOX38-Tc Δgene :: Cm (Rif R, R Tc, Cm R) clon.
        Nota: Es importante hacer crecer células DY330R a 32 ° C, con la excepción de la inducción 15 min a 42 ° C de la etapa 2.1.3 antes de generar células electrocompetentes, ya que el crecimiento prolongado a temperaturas elevadas riesgos muerte celular debido a la producción de productos tóxicos de la p L operón responsable de las funciones de recombinación en DY330R. 33,34
      8. Preparar una O / N de DY330R pOX38-Tc Δgene :: Cm células de la cosecha de una sola colonia distinta de las células con una pipeta estéril o un asa, y la inoculación de un medio estéril 20 ml de LB con 10 mg / ml de Tc, y 20 mg / mL Cm. Mantenga el área estéril y trabajar cerca de una llama. Cultivar las células de O / N a 32 ° C con agitación a 200 rpm.
      9. Hacer 3-5 reservas de glicerina de la O / N mediante la mezcla de 500 l de la cultura de O / N con 500 l de gl estéril 100%ycerol (final de 50% v / v) en crio-tubos estériles. Almacenar a -80 ° C.
      10. Centrifugadora 6-8 ml del cultivo O / N a temperatura ambiente, 5.000 xg durante 3 min. Se decanta el sobrenadante y extraer el pOX38-Tc Δgene :: Cm construir a partir del sedimento utilizando un mini-prep kit plásmido (Tabla de Materiales) y el protocolo del fabricante; almacenar ADN purificado a -20 ° C.
      11. Realizar un ensayo de apareamiento de conjugación utilizando células XK1200 como el destinatario para confirmar la interrupción de la conjugación por eliminación de genes según el protocolo 3.1.
    2. DY330R pOX38-Tc Δgene :: Cm + pK184-gen
      1. Transformar células DY330R pOX38-Tc Δgene :: Cm con 300 ng de la construcción pK184-gen a través de electroporación de acuerdo con los pasos 2.1.4-2.1.7. Todos los medios selectivos deberán contener de 20 mg / ml de Cm y 50 mg / ml km. Se incuba a 32 ° C. El plásmido de recuperación en las células electroporadas ahora restaurará la función del gen noqueado en el DY330R pOX38-Tc Δgene :: células Cm.
      2. Preparar un O / N de DY330R pOX38-Tc Δgene :: Cm + pK184 de genes de células recombinantes por la recolección de una sola colonia distinta de las células con una pipeta estéril o bucle, y la inoculación de un medio de 20 ml estéril LB con 20 mg / ml Cm y 50 mg / ml Km. Mantenga el área estéril y trabajar cerca de una llama. Cultivar las células de O / N a 32 ° C con agitación a 200 rpm.
      3. Hacer 3-5 stocks de glicerol de la O / N mediante la mezcla de 500 l de la cultura O / N con 500 l de glicerol 100% estéril (final de 50% v / v) en crio-tubos estériles. Almacenar a -80 ° C.
      4. También realice el protocolo 3.1 para generar XK1200 pOX38-Tc Δgene :: Cm células recombinantes.
    3. XK1200 pOX38-Tc Δgene :: Cm + pK184-gen y mutantes
      1. Preparar células electrocompetentes XK1200 pOX38-Tc Δgene :: Cm (de la etapa 2.2.4).
      2. Por separado electroporar 300 ng de pK184-gen o pK184 de genes plásmidos mutantes en 50 l de electrocompetent XK1200 pOX38-Tc Δgene :: Cm células como por pasos 2.1.4-2.1.7. Todos los medios selectivos deben contener ácido 10 mg / ml nalidíxico (Nal), 20 mg / ml Cm, y 50 mg / ml Km y se incubó a 37 ° C.
      3. Preparar un O / N de XK1200 pOX38-Tc Δgene :: Cm + pK184 de genes de células recombinantes por la recolección de una sola colonia distinta de las células con una pipeta estéril o bucle, y la inoculación de un medio de 20 ml estéril LB con Nal, 20 mg / ml cm y 50 mg / ml Km. Mantenga el área estéril y trabajar cerca de una llama. Cultivar las células O / N a 37 ° C con agitación a 200 rpm.
      4. Hacer 3-5 stocks de glicerol de la O / N mediante la mezcla de 500 l de la cultura O / N con 500 l de glicerol 100% estéril (final de 50% v / v) en crio-tubos estériles. Almacenar a -80 ° C.

    3. Los ensayos de apareamiento conjugativos

    1. El apareamiento de conjugación para generar XK1200 pOX38-Tc Δgene :: Cm células
      1. Preparar un 20 ml estéril LB O / N cultura de DY330R pOX38-Tc Δgene :: Cm + células pK184 de genes mediante el uso de una pipeta estéril o un asa para inocular un 20 ml estéril LB que contiene 20 mg / ml de Cm y 50 mg / ml km con una acción glicerol o en una sola colonia placa de agar. Crecer a 32 ° C con agitación a 200 rpm. Preparar el mismo para XK1200 células en 20 ml de LB estéril con 10 mg / ml Nal, que crece a 37 ° C.
      2. Hacer diluciones 1:70 de cada cultivo por separado en 2 ml de LB estéril con el mismo contenido a los antibióticos; añadir glucosa a una concentración final de 100 mM a todas las células del donante. Se cultivan las células a la fase semilogarítmica (OD 600 0.5-0.7) a 37 ° C con agitación a 200 rpm.
      3. Se centrifuga (4.000 xg durante 5 min a 4 ° C) para sedimentar las células, desechar el sobrenadante, lavar una vez con LB estéril fría para eliminar los antibióticos, y volver a suspender las células en 2 ml de LB. estéril frío
      4. Alícuota de 100 l de cada cultivo en 800 l de medio LB estéril y dejar que se acoplan a 32 ° C durante 1 h sin agitación.
      5. <li> Vortex las células durante 30 s para interrumpir las parejas de apareamiento y colocarlos en hielo durante 10 minutos para evitar un mayor acoplamiento.
      6. Alícuota de 100 l de la mezcla de células sobre una placa de agar que contiene 10 mg / ml Nal y 20 mg / ml Cm para seleccionar las células XK1200 pOX38-Tc Δgene :: Cm. Difundir las células utilizando un esparcidor estéril. Mantenga el área estéril y trabajar cerca de una llama. Se incubó la placa O / N a 37 ° C al revés.
      7. Cosechar una sola colonia del gen nuevo XK1200 pOX38-Tc Δ :: Cm knockout cepa utilizando una pipeta estéril o un asa estéril y crecer en LB con 20 mg / ml Cm, S / N en el 37 ° C con agitación a 200 rpm. Hacer 3-5 stocks de glicerol de la O / N mediante la mezcla de 500 l de la cultura O / N con 500 l de glicerol 100% estéril (final de 50% v / v) en crio-tubos estériles. Almacenar a -80 ° C.
        Nota: Las células resultantes son ahora capaces de hacerse competentes para la transformación con las construcciones pK184-gen (protocolos 1.3 y 1.4) para el culoessing el gen y sus mutantes en la capacidad para recuperar la transferencia por conjugación en el protocolo 3.2.
    2. El apareamiento de conjugación Ensayo de XK1200 donantes a los receptores MC4100
      1. Preparar un cultivo O / N de XK1200 pOX38-Tc Δgene :: Cm + pK184-gen las células en 20 ml de estéril LB con 20 mg / ml Cm, 50 mg / ml Km y MC4100 células en 5 ml de LB con 50 mg / ml de estreptomicina (SM) utilizando células de una población de glicerol o sola colonia sobre una placa de agar y estéril pipeta o bucle. Cultivos deben mantenerse a 37 ° C con 200 rpm de agitación.
      2. Hacer diluciones 1:70 de cada cultura O / N por separado en 2 ml de LB estéril con los mismos antibióticos. Añadir glucosa a una concentración final de 100 mM a todas las células del donante. Se cultivan las células a la fase semilogarítmica (OD 600 0.5-0.7) a 37 ° C con agitación a 200 rpm.
      3. Se centrifuga (4.000 xg durante 5 min a 4 ° C) para sedimentar las células, desechar el sobrenadante, lavar una vez con LB estéril fría para eliminar antibiotics, y volver a suspender las células en 2 ml de LB estéril fría
      4. Por duplicado, alícuota de 100 l de cada cultivo en 800 l de medio LB estéril y permita que se acoplan a 37 ° C durante 1 h sin agitación.
      5. Vortex las células durante 30 s para interrumpir el apareamiento de pares y los colocan en hielo durante 10 min para evitar un mayor acoplamiento.
      6. El uso de las culturas mediados de registro desde el paso 3.2.2 y fresco LB estéril, prepare 6 diluciones seriadas de las células del donante y del receptor de 10 -2 a la 10 -7.
      7. En cada una de dos mitades de una placa de agar que contiene 10 mg / ml Nal, 20 mg / ml de Cm y 50 mg / ml, Km detectar alícuotas de 10 l de cada dilución de XK1200 células del donante, como se muestra en la Figura 2. Repita este procedimiento para las diluciones de las células MC4100 receptor en las placas de agar que contiene 50 mg / ml de Sm. Incubar las placas O / N a 37 ° C.
      8. El uso de la mezcla de la etapa 3.2.5 vórtex y fresco LB estéril, prepare 6 diluciones (10 -2 a 10 -7 Figura 2. Repita para ambas mezclas duplicadas. Mantenga el área estéril y trabajar cerca de una llama. Incubar las placas O / N a 37 ° C.
      9. Determinar la eficiencia de acoplamiento de cada construcción tal como se describe en el protocolo 3.3.
      10. Repita este protocolo para todos los plásmidos de recuperación para evaluar el efecto de una mutación particular en la eficiencia de la conjugación.
    3. El cálculo de la eficiencia de acoplamiento
      1. Contar el número de colonias de la misma manchado de dilución para cada donante, receptor y las células transconjugantes en sus respectivas placas.
      2. Recuento de las colonias receptores para probar cualquier sesgo que resultaría de tener un mayor número de transconjugantes de los receptores a que la dilución dada.
      3. doalculate la eficiencia de acoplamiento como el número de colonias transconjugantes dividido por el número de colonias de los donantes. Multiplicar por 100 para obtener valor de eficiencia por cada 100 células del donante.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    El proceso de F conjugación bacteriana plásmido guiado es un proceso coordinado que implica proteínas de transferencia dentro de la región tra de la F-plásmido que reúne un T4SS para facilitar la síntesis pilus y la transferencia de ADN conjugativo. La proteína TraF (# de acceso GenBank BAA97961; UniProt ID P14497) es necesaria para la formación de F-pilus conjugativo. 10,14,35 - 37 La proteína contiene un dominio similar a la tiorredoxina C-terminal, aunque no tiene el motivo CXXC catalítico. 35,38 Aunque se ha predicho para interactuar con la proteína Trah a través de su dominio N-terminal, una región 39 demostró ser más dinámico que su dominio C-terminal, de 37 años, no se sabe mucho más acerca de las características estructurales de la proteína. Para evaluar los aspectos funcionales de la proteína TraF en conjunción con estudios estructurales, lo primero que anularon el gen TRAF en la pOX38-Tc a través homólogala recombinación, generando el plásmido pOX38-Tc ΔtraF :: Cm (Tabla 1) en células de E. coli E. DY330R. 33,34 También generada fue el plásmido pK184-TraF de cebadores específicos de TRAF (Tabla 2) para proporcionar la recuperación de la conjugación y permitir el sondeo secuencia de la proteína. La transferencia del plásmido pOX38-Tc ΔtraF :: Cm en XK1200 células 40 a partir de células DY330R cuando pK184-TraF se proporciona en trans (transconjugantes cultiva en 10 mg / ml Nal, 10 mg / ml de Tc y 20 mg / ml Cm) indica que (a) el nocaut TRAF en pOx38-Tc ΔtraF :: Cm proporciona un casete de CAT en el marco, y (b) que pK184-TraF puede restaurar la función de conjugación.

    Una serie de mutantes TraF se generaron para el análisis usando el ensayo de apareamiento conjugativo 37 usando XK1200 pOX38-Tc ΔtraF :: Cm + pK184-TraF? XLas células y las células MC4100 41 como donantes y receptores, respectivamente. Un mutante representativo es TraF 55-247 (Tabla 1), una deleción N-terminal mutante que elimina la región de la proteína predijo para interactuar con Trah. Cuando se proporciona la proteína TRAF de longitud completa de las células del donante, la transferencia por conjugación se restaura (Figura 2), mientras que proporciona los pK184 plásmido vacío no lo hace (Tabla 3). Del mismo modo, la función de conjugación en las células del donante XK1200 no se restaura cuando se proporciona con el plásmido pK184-TraF 55-247 (Tabla 3). Esto indica que la región truncada de la proteína es importante para la función de TraF dentro del aparato conjugativo, probablemente a través de la interacción con Trah, y proporciona una región de la proteína para apuntar para un análisis mutacional.

    Figura 1
    en trans a través de un plásmido de recuperación (pK184-gen). La resultante pOX38-Tc Δgene :: Cm plásmido se transfiere a una cepa XK1200 (Paso 2) para una evaluación adicional del gen usando ensayos de apareamiento con un receptor MC4100 (Paso 3). Haga clic aquí para ver una versión más grande de esta figura.

    Figura 2
    Figura 2: Mating ensayo para evaluar la función del gen diana en la conjugación. Las células donantes y receptores fueron E. coli XK1200 pOX38-Tc ΔtraF :: Cm transformó con pK184-TraF y MC4100, respectivamente. Los transconjugantes resultantes (MC4100-Tc pOX38 ΔtraF :: Cm) crecen en placas que contienen Sm y Cm, lo que indica una recuperación exitosa de la función de conjugación. El experimento se realiza por duplicado en una única placa de agar, y diluciones en serie se utilizan para calcular la eficiencia de acoplamiento de los mutantes de genes de restauración (Tabla 2). Haga clic aquí para ver una versión más grande de esta figura.

    Cepa bacteriana / plásmido Características relevantes Marcador selectivo (s) Referencia
    Cepas bacterianas
    DY330R W3110 lacU169 gal490 λc1857 Δ (cro-bioA) Rif R Rif 33,34
    XK1200 F - lacΔU124 Δ (NADA aroG gal attλ bio gyrA) nal 40
    MC4100 araD139 Δ (argF-lac) U169 rpsL150 relA1 flbB3501 deoC1 ptsF25 rbsR sm 41
    Vectores y construcciones
    pBAD33 El plásmido de expresión bajo de P araBAD Cm 32
    pK184 2.4 kb vector de clonación, replicón p15a km 31
    pK184-TraF </ Td> F TraF de pOX38 en pK184 km 35
    pK184-56-247 TraF F TraF aa 56-247 de pK184-TraF km
    plásmidos conjugativos
    pOX38-Tc IncFI, Tra +, + RepFIA, fragmento HindIII de f1 F, mini-Tn Tc 29,30
    pOX38-Tc ΔtraF :: Cm pOX38-Tc con el CAT insertado en TraF Tc Cm 35
    † Cm, cloranfenicol; Km, kanamicina; Nal, ácido nalidíxico; Rif, rifampicina; Sm, estreptomicina; Tc, tetraciclina
    ‡ Todas las construcciones TraF contienen la secuencia líder de 19 residuos para asegurar la localización en el espacio periplásmico.

    Tabla 1: cepas y plásmidos coli utilizaron en este estudio.

    Construir Cebador*
    TraF-Cm-A 5'-GATCGAGGCTGGCAGTGGTATAACGAGAAAATAAATCCGAAGGA - CTGTGACG GAAGATCACTTC -3 '
    TraF-Cm-Rev 5'-TCTTCAGAAACGTTCAGGAACTGTTTTGCCAGGTCGTCCT - CTTATTCAGGCGT AGCACCAG -3 '
    pK184-TRAF Para 5'-TTTTTT GAATTC TATGAATAAAGCATTACTGCCAC -3 '
    pK184-TraF-Rev 5'-TTTTTT AAGCTT TAAAAATTGGGTTTAAAATCTTCAGAAA -3 '
    pK184-55-247 TraF -Para 5'- CATATG TACG ATGGCCGCACTGCAGACGG -3 '
    pK184-55-247 TraF 5'- CATATG TACG TCCTGACGCCGGAAAAATAAAGCAGCAGAGTAA -3 '
    † Tabla adaptada de Lento y col. 2016 35 con permiso
    * Las regiones que sobresalen TraF están en cursiva. sitios de enzimas de restricción están subrayados (HindIII: AAGCTT, EcoRI: GAATTC, NdeI: CATATG)

    Tabla 2: Una lista de los cebadores utilizados en este estudio.

    El plásmido de donantes † Recuperación plásmido Transconjugantes ‡ § (células ml -1) El apareamiento Efficiency§ ||
    pOX38-Tc ΔtraF :: Cm Ninguna 0 0
    pOX38-Tc ΔtraF :: Cm pK184 0 0
    pOX38-Tc ΔtraF :: Cm pK184-TraF 5 x 10 3 0.0167
    pOX38-Tc ΔtraF :: Cm pK184-55-247 TraF 0 0
    * Tabla adaptada de Lento y col. 2016 35 con permiso
    † Las células del donante fueron E. coli XK1200, con una concentración media de 3 x 10 7 células ml -1
    ‡ células receptoras fueron E. coli MC4100. El número de transconjugantes para el control positivo es de una dilución 10-5. 0 indica que no hay transconjugantes de una dilución 10-2.
    promedio §An de dos a cuatro experimentos de apareamiento se llevaron a cabo para cada construcción.
    || La eficiencia de acoplamiento es definED AS transconjugantes por cada 100 células del donante. 0 indica que no hay eficacia de apareamiento transconjugantes de una dilución 10-2

    Tabla 3: suprimidas por la eficiencia de acoplamiento construcciones de deleción TraF.

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    proceso de conjugación bacteriana proporciona un medio por el cual las bacterias se pueden propagar genes proporciona una ventaja evolutiva para el crecimiento en entornos difíciles, tales como la propagación de los marcadores de resistencia a antibióticos. Debido a que muchos de los plásmidos de conjugación son tan grandes, 12 estudios funcionales en las proteínas implicadas en el montaje del aparato de transferencia a través de mutaciones de los genes diana en el propio plásmido conjugativo son difíciles de manejar. Los protocolos detallados en el presente documento proporcionan un medio por el cual se puede evaluar más fácilmente el gen diana de interés mediante el uso de más pequeñas, plásmidos de expresión más manejables (Figura 1). Empleamos el plásmido derivado F pOX38-Tc (Tabla 1) para estudiar F conjugación mediada por plásmidos; otros plásmidos de conjugación se pueden estudiar usando los protocolos detallados aquí y plásmidos derivados apropiados. Los ensayos de apareamiento descritos han sido adaptados de Frost y colegas, 42 con algunas MODIFICACIons. En estudios anteriores, 8,33,42 la creación de la construcción pOX38-Tc Δgene :: Cm se consiguió escindiendo el gen de interés con las enzimas de restricción apropiadas y la inserción de la casete CAT amplificado en pOX38-Tc. 42 En el método actual, se emplean recombinación homóloga en la cepa de E. coli recombinería DY330R 33,34 a octavos de final del gen diana y reemplazarlo con el casete CAT. Esto tiene una ventaja de permitir que la cepa DY330R resultante que alberga el pOX38-Tc Δgene :: Cm construir para actuar como un control para el knockout de genes específicos a cabo F-T4SS mediada por la transferencia por conjugación a través de la recuperación de la transferencia utilizando el plásmido recuperación pK184-gen . Si bien puede ser posible generar agujeros ciegos utilizando una metodología CAJONES-Cas9, 43 que no tenemos en este momento explorado esta posibilidad.

    El proceso comienza con la generación de un knockout de genes en el plásmido derivado F pOX38-Tc (Figure 1). Esto se logra a través de recombinación homóloga en células DY330R (Tabla 1), otras cepas con características similares, tales como DY329, DY331 y DY378 también se pueden utilizar. Los cebadores están diseñados inicialmente para amplificar por PCR el casete de CAT del plásmido pBAD33 32 y que sobresale por contener bases que son específicos para el gen diana (Tabla 2); el producto de PCR se sometió a electroporación después en células que albergan DY330R pOX38-Tc. La recombinación homóloga genera el knock-out plásmido pOX38-Tc Δgene :: Cm donde se inserta el casete CAT en marco dentro del gen diana, lo que altera efectivamente el montaje y la conjugación T4SS la vez que proporciona resistencia a Cm. Al mismo tiempo, el gen diana se amplifica por PCR a partir pOX38-Tc y se inserta en un pequeño plásmido de expresión; en este protocolo utilizamos pK184 para la expresión constitutiva, sin embargo se podría elegir un plásmido con expresión inducible del gen diana si se desea. El plásmido pK184-gen se transforma entoncesen las células DY330R pOX38-Tc Δgene :: Cm, y estas células se utilizan como donantes para transferir la pOX38-Tc Δgene :: Cm construir a través de la conjugación en XK1200 células para los ensayos de apareamiento. En los ensayos de apareamiento, las células del donante y el receptor son XK1200 pOX38-Tc Δgene :: Cm y MC4100, respectivamente. El plásmido recuperación pK184-gen, así como los mutantes de la serie de gen diana (deleciones o mutaciones puntuales), se proporciona a las células del donante para evaluar su capacidad de restaurar el apareamiento, y determinar su eficiencia, con células MC4100 receptores (Figura 2 ; Tabla 3).

    Crítica para el procedimiento es el uso de donante apropiado y cepas receptoras (Tabla 1), y el diseño de los cebadores utilizados. Para cada cebador diseñado, hay pautas generales que deben seguirse. A pesar de que tratamos de cumplir estrictamente con el contenido de GC 40-60%, esto no siempre es posible. En tales casos, es la discreción del experimentador para probar un cebador wcontenido de GC ITH ligeramente por debajo o por encima de este rango. La temperatura de fusión (Tm) del cebador de avance y retroceso debe ser similar, y la temperatura de hibridación (T a) valor debe ser siempre inferior a la T m por 2 a 5 ° C por PCR. La energía libre disponible para permitir que una horquilla para desarrollar debería ser mucho más baja que la T a, mientras que el homo- y hetero- dimerización T m 's debe ser muy baja (menos de -10 kJ y 30 ° C). Los cebadores pueden ser diseñados para sondear deleciones, inserciones o mutaciones puntuales como deseado. Por supuesto, es crítico que la construcción génica resultante se amplificó y se ligó en el plásmido de recuperación en el marco de tal manera que se expresa correctamente. La transformación de células competentes se puede hacer a través de electroporación o choque térmico utilizando células electrocompetentes o químicamente competentes, respectivamente. Encontramos que la electroporación es más eficaz para las construcciones más grandes, como pOX38-Tc y la recombinación homóloga oligonucleotide, mientras que los más pequeños plásmidos de expresión tales como pK184-TraF se pueden transformar fácilmente en las células usando métodos de choque térmico. Por último, es importante recordar que habrá múltiples antibióticos en uso en todo el protocolo, ya que ambas cepas donantes y receptores requieren diferentes resistencias que son diferentes de las empleadas en los plásmidos de conjugación y de recuperación.

    Aparte de las técnicas de ensayos de apareamiento que se describen aquí, hay otros métodos que se utilizan para estudiar la conjugación bacteriana, que varían ligeramente en su enfoque. transferencia horizontal de genes es un proceso donde las bacterias transferir un plásmido a una célula receptora, incluyendo interespecies destinatarios. 44 Un estudio de Dahlberg et al 44, por ejemplo se usa la conjugación bacteriana para determinar la extensión de la transferencia de genes entre especies horizontal. Utilizaron la incorporación de la proteína fluorescente verde (GFP) en un plásmido clonado en células KT2442; la cromosómico lac I q gen en las células KT2442 reprimir la expresión de GFP. Cuando la GFP que transporta el plásmido se transfiere a una especie sin el gen q lac I, se observa fluorescencia. 44 A pesar de su limitación para proporcionar una función específica de proteínas en diversas especies, entre especies del experimento de conjugación posiblemente podría acoplarse con los protocolos presentados aquí para hacer predicciones evolutivas para las interacciones proteína-proteína entre diferentes especies.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    Los autores declaran que no tienen intereses financieros en competencia.

    Acknowledgments

    Esta investigación fue apoyada por un Descubrimiento donación del Consejo de Ciencias Naturales e Ingeniería de Canadá (NSERC).

    Materials

    Name Company Catalog Number Comments
    GeneJet Plasmid Mini-Prep Kit Fisher Scientific K0503
    GeneJet Gel Extraction Kit Fisher Scientific K0692
    GeneJet PCR Purification Kit Fisher Scientific K0702
    Q5 Site-Directed Mutagenesis Kit New England Biolabs E0554S
    Broad Range DNA Ladder New England Biolabs N0303A
    Petri Dishes Fisher Scientific FB0875713
    Electroporator Eppendorf 4309000027
    Electroporation cuvettes Fisher Scientific FB101 Cuvettes have a 1 mm gap.
    Enzymes
    AvaI New England Biolabs R0152S
    EcoRI New England Biolabs R0101S
    HindIII New England Biolabs R0104L
    NdeI New England Biolabs R0111S
    Phusion DNA Polymerase New England Biolabs M0530L
    T4 DNA Ligase New England Biolabs M0202S
    DpnI New England Biolabs R0176S
    Antibiotics Final Concentrations
    Chloramphenicol (Cm) Fisher Scientific BP904-100 20 µg/mL
    Kanamycin (Km) BioBasic Inc. DB0286 50 µg/mL
    Nalidixic acid (Nal) Sigma-Aldrich N8878-25G 10 µg/mL
    Rifampicin (Rif) Calbiochem 557303 20 µg/mL
    Tetracycline (Tc) Fisher Scientific BP912-100 10 µg/mL
    Streptomycin (Sm) Fisher Scientific BP910-50 50 µg/mL

    DOWNLOAD MATERIALS LIST

    References

    1. Dobrindt, U., Hochhut, B., Hentschel, U., Hacker, J. Genomic islands in pathogenic and environmental microorganisms. Nat Rev Microbiol. 2, (5), 414-424 (2004).
    2. Furuya, E. Y., Lowy, F. D. Antimicrobial-resistant bacteria in the community setting. Nat Rev Microbiol. 4, (1), 36-45 (2006).
    3. Griffiths, A., Miller, J., Suzuki, D., Lewontin, R., Gelbart, W. An Introduction to Genetic Analysis, 7th Edition. W.H. Freeman. San Fransisco. (2000).
    4. Cooper, T. F. Recombination Speeds Adaptation by Reducing Competition between Beneficial Mutations in Populations of Escherichia coli. PLoS Biol. Barton, N. H. 5, (9), 225 (2007).
    5. Lujan, S. A., Guogas, L. M., Ragonese, H., Matson, S. W., Redinbo, M. R. Disrupting antibiotic resistance propagation by inhibiting the conjugative DNA relaxase. Proc Natl Acad Sci. 104, (30), 12282-12287 (2007).
    6. Carattoli, A. Plasmids and the spread of resistance. Int J Med Microbiol. 303, (6-7), 298-304 (2013).
    7. Shala, A., Ferraro, M., Audette, G. F. Bacterial Secretion Systems: Nanomachines for Infection and Genetic Diversity. Handbook of Clinical Nanomedicine: Nanoparticles, Imaging, Therapy and Clinical Applications. Bawa, R., Audette, G. F., Rubenstein, I. Pan Sanford Publishing. Singapore. 657-686 (2016).
    8. Tseng, T. T., Tyler, B. M., Setubal, J. C. Protein secretion systems in bacterial-host associations, and their description in the Gene Ontology. BMC Microbiol. 9, (1), Suppl 1 2 (2009).
    9. Alvarez-Martinez, C. E., Christie, P. J. Biological diversity of prokaryotic type IV secretion systems. Microbiol Mol Biol Rev. 73, (4), 775-808 (2009).
    10. Lawley, T. D., Klimke, W. A., Gubbins, M. J., Frost, L. S. F factor conjugation is a true type IV secretion system. FEMS Microbiol Lett. 224, (1), 1-15 (2003).
    11. Lederberg, J., Tatum, E. L. Gene Recombination in Escherichia Coli. Nature. 158, (4016), 558-558 (1946).
    12. Smillie, C., Garcillan-Barcia, M. P., Francia, M. V., Rocha, E. P. C., de la Cruz, F. Mobility of Plasmids. Microbiol Mol Biol Rev. 74, (3), 434-452 (2010).
    13. Willetts, N., Skurray, R. The Conjugation System of F-Like Plasmids. Annu Rev Genet. 14, (1), 41-76 (1980).
    14. Frost, L. S., Ippen-Ihler, K., Skurray, R. A. Analysis of the sequence and gene products of the transfer region of the F sex factor. Microbiol Rev. 58, (2), 162-210 (1994).
    15. Audette, G. F., Manchak, J., Beatty, P., Klimke, W. A., Frost, L. S. Entry exclusion in F-like plasmids requires intact TraG in the donor that recognizes its cognate TraS in the recipient. Microbiology. 153, Pt 2 442-451 (2007).
    16. Christie, P. J., Atmakuri, K., Krishnamoorthy, V., Jakubowski, S., Cascales, E. Biogenesis, Architecture, and Function of Bacterial Type Iv Secretion Systems. Annu Rev Microbiol. 59, (1), 451-485 (2005).
    17. Christie, P. J. Type IV secretion: the Agrobacterium VirB/D4 and related conjugation systems. Biochim Biophys Acta - Mol Cell Res. 1694, (1-3), 219-234 (2004).
    18. Bhatty, M., Laverde Gomez, J. a, Christie, P. J. The expanding bacterial type IV secretion lexicon. Res Microbiol. 164, (6), 620-639 (2013).
    19. Christie, P. J., Cascales, E. Structural and dynamic properties of bacterial Type IV secretion systems (Review). Mol Membr Biol. 22, (1-2), 51-61 (2005).
    20. Christie, P. J. Type IV secretion: Intercellular transfer of macromolecules by systems ancestrally related to conjugation machines. Mol Microbiol. 40, (2), 294-305 (2001).
    21. Christie, P. J., Whitaker, N., González-Rivera, C. Mechanism and structure of the bacterial type IV secretion systems. Biochim Biophys Acta. 1843, (8), 1578-1591 (2014).
    22. Cascales, E. The type VI secretion toolkit. EMBO Rep. 9, 735 (2008).
    23. Silverman, J. M., Brunet, Y. R., Cascales, E., Mougous, J. D. Structure and Regulation of the Type VI Secretion System. Annu Rev Microbiol. 66, (1), 453-472 (2012).
    24. Chandran, V., et al. Structure of the outer membrane complex of a type IV secretion system. Nature. 462, (7276), 1011-1015 (2009).
    25. Rivera-Calzada, A., et al. Structure of a bacterial type IV secretion core complex at subnanometre resolution. EMBO J. 32, (8), 1195-1204 (2013).
    26. Waksman, G., Fronzes, R. Molecular architecture of bacterial type IV secretion systems. Trends Biochem Sci. 35, 691 (2010).
    27. Fronzes, R., Christie, P. J., Waksman, G. The structural biology of type IV secretion systems. Nat Rev Microbiol. 7, (10), 703-714 (2009).
    28. Kaplan, M., et al. Probing a cell-embedded megadalton protein complex by DNP-supported solid-state NMR. Nat Methods. 12, (7), 5-9 (2015).
    29. Guyer, M. S., Reed, R. R., Steitz, J. A., Low, K. B. Identification of a sex-factor-affinity site in E. coli as gamma delta. Cold Spring Harb Symp Quant Biol. 45, Pt 1 135-140 (1981).
    30. Anthony, K. G., Sherburne, C., Sherburne, R., Frost, L. S. The role of the pilus in recipient cell recognition during bacterial conjugation mediated by F-like plasmids. Mol Microbiol. 13, (6), 939-953 (1994).
    31. Jobling, M. G., Holmes, R. K. Construction of vectors with the pl5a replicon, kanamycin resistance, inducible lacZα and pUC18 or pUC19 multiple cloning sites. Nucleic Acids Res. 18, (17), 5315 (1990).
    32. Guzman, L. M., Belin, D., Carson, M. J., Beckwith, J. Tight regulation, modulation, and high-level expression by vectors containing the arabinose P(BAD) promoter. J Bacteriol. 177, (14), 4121-4130 (1995).
    33. Yu, D., et al. An efficient recombination system for chromosome engineering in Escherichia coli. Proc Natl Acad Sci U S A. 97, (11), 5978-5983 (2009).
    34. Lawley, T. D., Gilmour, M. W., Gunton, J. E., Standeven, L. J., Taylor, D. E. Functional and Mutational Analysis of Conjugative Transfer Region 1 (Tra1) from the IncHI1 Plasmid R27. J Bacteriol. 184, (8), 2173-2180 (2002).
    35. Elton, T. C., Holland, S. J., Frost, L. S., Hazes, B. F-Like Type IV Secretion Systems Encode Proteins with Thioredoxin Folds That Are Putative DsbC Homologues. J Bacteriol. 187, (24), 8267-8277 (2005).
    36. Hazes, B., Frost, L. Towards a systems biology approach to study type II/IV secretion systems. Biochim Biophys Acta. 1778, 1839-1850 (2008).
    37. Lento, C., Ferraro, M., Wilson, D., Audette, G. F. HDX-MS and deletion analysis of the type 4 secretion system protein TraF from the Escherichia coli F plasmid. FEBS Lett. Tsolis, R. 590, (3), 376-386 (2016).
    38. Audette, G. F., Van Schaik, E. J., Hazes, B., Irvin, R. T. DNA-binding protein nanotubes: Learning from nature's nanotech examples. Nano Lett. 4, 1897-1902 (2004).
    39. Harris, R. L., Silverman, P. A. Tra proteins characteristic of F-like type IV secretion systems constitute an interaction group by yeast two-hybrid analysis. J Bacteriol. 186, (16), 5480-5485 (2004).
    40. Moore, D., et al. Characterization of the F-Plasmid Conjugative Transfer Gene traU. J Bacteriol. 172, (8), 4263-4270 (1990).
    41. Anthony, K. G., Sherburne, C., Sherburne, R., Frost, L. S. The role of the pilus in recipient cell recognition during bacterial conjugation mediated by F-like plasmids. Mol Microbiol. 13, (6), 939-953 (1994).
    42. Klimke, W. A., Frost, L. S. Genetic analysis of the role of the transfer gene, traN, of the F and R100-1 plasmids in mating pair stabilization during conjugation. J Bacteriol. 180, (16), 4036-4043 (1998).
    43. Jiang, W., Marraffini, L. A. CRISPR-Cas: New Tools for Genetic Manipulations from Bacterial Immunity Systems. Annu Rev Microbiol. 69, (1), 209-228 (2015).
    44. Dahlberg, C., Bergstrom, M., Andreasen, M., Christensen, B. B., Molin, S., Hermansson, M. Interspecies bacterial conjugation by plasmids from marine environments visualized by gfp expression. Mol Biol Evol. 15, (4), 385-390 (1998).

    Comments

    0 Comments


      Post a Question / Comment / Request

      You must be signed in to post a comment. Please or create an account.

      Usage Statistics