Konjugerbare Mating Analyser for sekvens-spesifikk analyse av Transfer proteiner involvert i Konjugasjon

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Cite this Article

Copy Citation | Download Citations

Erdogan, F., Lento, C., Yaseen, A., Nowroozi-Dayeni, R., Kheyson, S., Audette, G. F. Conjugative Mating Assays for Sequence-specific Analysis of Transfer Proteins Involved in Bacterial Conjugation. J. Vis. Exp. (119), e54854, doi:10.3791/54854 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Introduction

Overføring av gener og proteiner i mikroorganismenivå spiller en sentral rolle i bakteriell overlevelse og utvikling, samt infeksjon prosesser. Utvekslingen av DNA mellom bakterier eller mellom en bakterie og en celle kan oppnås ved transformasjon, konjugasjon eller en vektor transduksjon. 1,2 Bøyning er unik i forhold til transformasjon og transduksjon ved at under konjugeringen mellom gram-negative bakterier som Escherichia coli, overføring av DNA finner sted i et donor-kontrollert måte hvorved et komplekst system makromolekylært forbinder giver- og mottakercellene. Bøyning er også den mest direkte måten bakterieceller kommuniserer med vertsceller for å injisere gener, proteiner eller kjemikalier på vertssystemer. 3 Ganske ofte, overføring av slike midler har bemerkelsesverdig effekt på verten, alt fra patogenesen og kreft å være vert for utvikling og tilpasning. Det har vist seg at konjugerbare recombination øker frekvensen av tilpasning tre ganger i bakterier med høye mutasjon priser under forhold med miljøstress. 4 Videre er konjugasjon langt den vanligste rute der antibiotikaresistensgener i bakteriestammer er spredt. 5,6

Mikroorganismer har utviklet spesialiserte sekresjon systemer for å støtte overføring av makromolekyler over mobilnettet membraner; Det er for tiden 9 typer sekresjon systemer (TSSs) i gramnegative bakterier som har blitt beskrevet: T1SS, T2SS, T3SS, T4SS, T5SS, T6SS, T7SS, samt Sec (sekresjon) og Tat (to-arginin trans) trasé. 7,8 Hver type sekresjon system er videre delt inn i forskjellige undergrupper, en nødvendighet på grunn av mangfoldet av proteiner og særpreg veier som er involvert, i forskjellige bakteriestammer. For eksempel, i den type IV sekresjon system (T4SS), Ti og CAG systemer er det lettere effektor transport, mens F-plasmid, en R27nd pKM101 T4SSs lette overføring av en konjugativt plasmid. 7,9,10 En detaljert forståelse av de mekanismer som organismer montere sine respektive sekresjon systemer fra sine komponent proteiner og dele cellulære innholdet med en mottaker eller deres omgivelsene er en viktig faktor i utviklingen av målrettede strategier for å bekjempe sykdomsfremkallende mikroorganismer og prosesser cellular infeksjon.

Etter den første identifikasjon Konjugasjon i E. coli ved Lederberg og Tatum, 11 et stort antall mobile og konjugativt plasmider er blitt identifisert og karakterisert. 12 Slike flyttbare plasmider viser betydelig område er størrelse (fra en til over 200 kilobaser (kb)), men alle mobil plasmider inneholder en relaxase, som gjenkjenner opprinnelsen til overførings (Orit) for derved å muliggjøre overføring av plasmidet. Konjugativt plasmider som koder for ytterligere gener for montering av en funksjonell T4SS, så vel som en typeIV kobling protein. 12 For eksempel 100 kb F plasmid av E. coli koder alle konjugerbare genene innen en 33,3 kB transfer (ekstra) region. 13 Genene i tra regionen i F-plasmidet kode alle proteiner som letter pilus dannelse, parring par dannelse (MPF), DNA overføring og eksklusjons funksjoner under konjugativt plasmid overføring. 10,14,15 En betydelig mengde kunnskap er tilgjengelig for konjugerbare T4SSs, men detaljerte strukturstudier av konjugerbare proteiner og komplekser er bare mer nylig blitt tilgjengelig. 16-28

For å sette sammen et helhetlig syn på konjugerbare prosessen, er en kobling av detaljerte strukturstudier til mutasjonsanalyser konjugerbare overførings proteiner nødvendig. Dette kan oppnås gjennom konjugativt passende analyser. For F-plasmidet, hvert protein kodet innenfor den tra regionen spiller en rolle i den F-mediert conjugation; derfor vil den knockout / sletting av en overføring gen avskaffe konjugativt kapasitet av cellen (figur 1). Mens mindre mobile plasmider i større grad bidrar til standard sletting prosedyrer, for større konjugativt plasmider slik som F, blir genet knockouts lettere oppnås via homolog rekombinasjon, hvor målgenet er erstattet med en transport en tydelig antibiotisk resistensgen. I dagens protokoll, ansetter vi homolog rekombinasjon å erstatte en overføring gen av interesse med kloramfenikol acetyltransferase (CAT) i 55 kb F plasmid derivat pOX38-Tc; 29,30 knockout det resulterende plasmid, pOX38-Tc Δgene :: Cm, letter motstand av tilstedeværelsen av kloramfenikol (Cm) i vekstmediet. Donor celler som pOX38-Tc Δgene :: Cm er ute av stand til å påvirke konjugativt DNA-overføring / paring som observeres ved bruk av en parring assay; parring effektiviteten av en pOX38-Tc Δgene :: Cm donorcelle og en normal Recipient vil redusere eller, oftere, bli avskaffet. Konjugerbare overføring av pOX38-Tc Δgene :: Cm plasmid kan gjenopprettes via en liten bedring plasmid målrettet overføring genet. Denne gjenopprettings plasmid kan være en som gir konstituerende uttrykk, slik som plasmid pK184 (pK184-genet), 31 eller en som gir induserbar uttrykk så lenge at plasmid ordentlig rettet genet til riktig sted inne i cellen (cytoplasma eller periplasmaet). Følgelig, i parrings analyser mellom denne nye donor (husing pOX38-Tc Δgene :: Cm + pK184-genet plasmider) og en mottagercelle, er paring effektivitet forventes å gjenopprette til nesten den for en normal donor-mottaker parring analysen. Dette systemet gjør det mulig å undersøke funksjonen av det slått ut-genet ved generering av en serie av pK184-genkonstruksjoner (delesjoner eller punktmutasjoner) og testing av hver enkelt konstruksjon evne til å gjenopprette parring kapasiteten til pOX38-Tc Δgene :: Cm husing donor celles.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Generering av DNA-konstruksjoner

  1. Designing Oligomers for homolog rekombinasjon av Target Gene
    1. Utforme en enkelt 55-72 bp oligomer frem som følger: (a) velge en 19-32 bp lang nukleotid-sekvens som er homolog med en DNA-sekvens i området 10-100 bp oppstrøms fra 5'-startsetet av kloramfenikol-acetyltransferase-genet i det kommersielle pBAD33 plasmid, 32 og (b) velge en 36-54 bp lang nukleotidsekvens som er homolog med en region 10-150 bp nedstrøms for 5'-startsetet av målgenet av interesse.
      1. Slutte seg til 3'-enden av nukleotidsekvens valgt i (b) til 5'-enden av nukleotidsekvensen valgt i (a), og dermed gi en enkelt 55-72 lang fremover oligomer.
    2. Utforme en enkelt 55-72 bp omvendt oligomer som følger: (a) velge en 19-32 bp lang nukleotid-sekvens som er homolog med en DNA-sekvens i området 10-100 bp nedstrømsfra 3'-enden av kloramfenikol-genet i den kommersielle pBAD33 plasmidet, og (b) velge en 36-54 bp lang nukleotid-sekvens som er homolog til et område innenfor 10 til 150 bp oppstrøms for det 3'-enden området av mål-genet av interesse .
      1. Slutte seg til 3'-enden av nukleotidsekvens valgt i (b) til 5'-enden av nukleotidsekvensen valgt i (a) for å gjøre det til en enkelt oligomer.
      2. Kopier denne oligomer inn alle tilgjengelige bioinformatikk programvare og konvertere sekvens i sin revers komplement. Dette vil gi en enkelt 55-72 bp langt bakover oligomer.
    3. Ved hjelp av alle tilgjengelige oligo-analysator program, sjekk at rekombinasjon oligomerer har GC innhold mellom 40-60%, lav hårnål smeltetemperatur (T m), lav selv og hetero dimerization T m 's. Bestill primere for syntese og forsendelse fra noen foretrukne bioteknologiselskap.
  2. Forsterkning av CAT Cassette fra pBAD33 (Cm R
  3. Vokse en over natten (O / N, 16-18 h) kultur av DH5a celler som inneholder plasmidet pBAD33 i sterilt lysogeni buljong (LB) med 20 ug / ml kloramfenikol (Cm) med risting ved 200 rpm og 37 ° C.
  4. Sentrifuge 6-8 ml O / N kultur ved værelsestemperatur, 5000 x g i 3 min. Dekanter supernatanten og trekke ut pBAD33 plasmid fra pelleten ved hjelp av et plasmid mini-prep kit (Materialer Table) og produsentens protokoll.
  5. Har et sammendrag av den pBAD33 plasmid DNA ved tilsetning av følgende i et sterilt rør i angitt rekkefølge: passende volum dobbelt-destillert vann (DDH 2 O) til et sluttvolum på 50 pl, 1 pg volum av pBAD33 plasmid, 5 ul 10 x enzym-reaksjonsbuffer, og 0,5 ul av Aval restriksjonsenzym (RE). bland forsiktig ved pipettering og la reaksjonen forløpe i en time ved 37 ° C. Varme inaktivere reaksjonsblandingen i 20 minutter (min) ved 80° C. Oppbevar prøver ved -20 ° C for ikke lenger enn 24 timer for å minimere klebrig-end degradering.
  6. Fremstille en 1,2% agarose-gel separering ved å blande 1,2 g agarose med 100 ml 1 x TAE (40 mM Tris, pH 8,5; 20 mM eddiksyre; 1 mM EDTA) buffer i en 250 ml Erlenmeyer-kolbe. Varme og virvel for å løse opp i en mikrobølgeovn. Stoppe oppvarming umiddelbart når væsken begynner å koke og virvle kolben.
    1. Kjøle væske agarose i 3 minutter ved romtemperatur under virvlende, tilsett 2 ul av 10 mg / ml etidiumbromid og virvel for å blande. Hell agarose gel inn i en skuff med et godt kam og la den stivne i 1 time ved romtemperatur. Oppbevar gels ved 4 ° C i opp til 2 dager i 1x TAE buffer.
  7. Bland hver RE fordøye fra 1.2.3 med 0,2 volum av DNA lasting fargestoff (10 mL av fargestoff per 50 mL reaksjon) ved pipettering. Belastning 5 ul av 500 ug / ml DNA stige inn i den første brønnen, og alle de RE spaltningen-fargestoff blandingen inn i en annen brønn på engarose gel. Bruk 2-3 brønner å laste ned alle reaksjonsvolumet på gelen.
    1. Kjør gelen knapt neddykket i 1 x TAE-buffer og som arbeider ved 45-50 V (4,5-5 V / cm) i 65 min i en gelelektroforese enhet.
  8. Ved hjelp av en UV-kabinettet og en steril barberhøvel, raskt kuttet 2,8 kb båndet som svarer til den CAT-sekvensen ut av gelen for å minimalisere eksponering av UV-DNA. Pakk ut DNA fra cut-out gel skive ved hjelp av en gel utvinning kit (Materialer Table) som per produsentens protokoll.
    Merk: Pass på å ikke utsette huden direkte under UV og håndtere barberhøvel med forsiktighet.
  9. Forsterke CAT kassetten ekstrahert fra 1.2.6 ved hjelp av polymerase kjedereaksjon (PCR) ved anvendelse av primere utformet på 1,1 som inneholder overheng homologe til gensekvensen for å tillate homolog rekombinasjon. PCR reaksjoner er satt opp på isen ved hjelp av produsentens retningslinjer (Materialer Table) i følgende rekkefølge:
    1. Inn i ensterilt PCR-rør, tilsette en passende volum av DDH 2 O til et sluttvolum på 50 ul, fulgt av 10 ul av PCR-buffer, 1 pl av 10 mM dNTPs, 2,5 ul 10 uM forover primer, 2,5 ul 10 uM revers primer , 1-25 ng templat-DNA fra 1.2.6 og 0,5 ul av 100 enheter / pl DNA-polymerase.
    2. Sett opp en negativ kontroll som bærer de samme komponentene som 1.2.7.1, men med unntak av templat-DNA. Bruk en passende volum av DDH 2 O i stedet for templat-DNA. Sett opp en positiv kontroll ved hjelp av mal DNA og primere som har vist seg å fungere i en PCR-reaksjon, slik som de som følger med som positiv kontroll av produsenten.
    3. Bland alle reaksjons innholdet forsiktig ved pipettering.
    4. Forsterke via PCR ved anvendelse av de følgende innstillinger: Innledende denaturering i 30 s ved 98 ° C, 30 sykluser med denaturering i 10 s ved 98 ° C, primersammensmeltning i 20 s, forlengelse for 20 s pr kilobase av amplikon ved 72 ° C og en final forlengelse i 10 minutter ved 72 ° C. Oppbevar prøver ved -20 ºC.
  10. Bekreft riktig størrelse på forsterkning via agarosegel-elektroforese (se 1.2.4-1.2.5) ved hjelp av bare fem mL av hver reaksjon. Rense PCR fragment ved hjelp av en PCR rensing kit og produsentens protokoll. Oppbevares renset DNA ved -20 ºC.
  • Den pK184-genet Recovery Plasmid
    1. Utforme en fremtids primer begynner fra sin 5 'ende og går mot 3' ende i følgende rekkefølge: (a) plukke 4 tilfeldige nukleotider (en kombinasjon av adenin, tymin, guanin og cytosin) for spalting effektivitet, festet til (b) EcoRI-restriksjonsenzym (RE) snitt reiser sekvens (GAATTC), etterfulgt av (c) en 21-25 bp lang nukleotid-sekvens som er homolog til 5'-enden av genet av interesse, inkludert startkodonet. Hvis målet genet inneholder et EcoRI sted, velger du en annen passende RE fra pK184 multiple kloningssete.
    2. I tilfelle av gener som koder for periplasmatiske proteiner, omfatte en ytterligere ledersekvens mellom RE området og startkodonet i foroverprimeren.
    3. Ved hjelp av alle tilgjengelige oligo-analysator, sjekk at primere har GC innhold mellom 40-60%, lav hårnål T m, lav selv og hetero dimerization T m 's. Bestill primere for syntese.
    4. Dyrke en O / N kultur av DY330R pOX38-Tc-celler i sterilt LB inneholdende 10 ug / ml tetracyklin (Tc) med risting ved 32 ° C og 200 rpm. Sentrifuge 6-8 ml O / N kultur ved værelsestemperatur, 5000 x g i 3 min. dekantersupernatanten og trekke ut plasmid DNA fra pelleten ved hjelp av et plasmid mini-prep kit (Materialer Table) og produsentens protokoll.
    5. Forsterke hele genet av interesse med primere fra 1.3.1-1.3.5 hjelp pOX38-Tc som mal (se 1.2.7.1-1.2.7.3).
    6. Bekreft riktig størrelse på forsterkning via agarosegel-elektroforese (se 1.2.4-1.2.5) ved hjelp av bare fem mL av hver reaksjon. Rens det amplifiserte DNA ved å bruke en PCR-rensesett og produsentens protokoll. Oppbevares renset DNA ved -20 ° C.
    7. Gjør en dobbel sammendrag av både kommersielt tilgjengelige pK184 plasmid-DNA, og det amplifiserte genet (fra 1.3.7.), Ved å tilsette følgende i et sterilt rør i angitt rekkefølge: passende volum av DDH 2 O til et endelig volum på 50 ul , 1 ug volum av pK184 plasmid, 5 pl 10x enzymreaksjonsbuffer, og 1 ul av hver enkelt EcoRI og Hindlll.
      1. bland forsiktig ved pipettering og la reaksjonen forløpe i en timeved 37 ºC. Varme inaktivere reaksjonsblandingen i 20 minutter ved 80 ° C. Oppbevar prøver ved -20 ° C for ikke lenger enn 24 timer for å minimere klebrig-end degradering.
        Merk: Den type restriksjonsnuklease brukes her avhenger av restriksjonsnuklease område som ble utviklet i de primere i trinn 1.3.1 og 1.3.2.
      2. Som en positiv kontroll, setter opp enkelt oppsummeringer av pK184 plasmidet ved fremstilling av den samme reaksjon som i 1.3.8, bortsett legge bare en av RES til en reaksjonsrøret. Gjør dette med begge Res.
    8. Kjør fordøyer på en 1,2% agarosegel ved hjelp av protokoller 1.2.4-1.2.5 Pakk ut DNA dobbel fordøye fragmenter av både pK184 og genet av interesse i henhold til punkt 1.2.6.
    9. Ligere genet innsatsen i pK184 vektoren ved å tilsette komponentene i et sterilt rør i følgende rekkefølge: 2 ul av 10 x T4 DNA-ligasebuffer, en samlet mengde av 100 ng DNA bestående av en 1: 3 vektor: sett (pK184: genet) ratio, DDH 2 O opp til entotalt volum på 20 pl og 1 pl T4 DNA-ligase. Som en negativ kontroll, setter opp en lignende reaksjon under anvendelse av 100 ng av vektor uten innsatsen genet.
      1. Bland forsiktig alle reaksjonsinnholdet ved hjelp av en mikropipette og inkuberes i 30 min ved 25 ° C. Varme inaktivere ligeringsreaksjonen i 10 minutter ved 65 ° C og deretter plassere på is.
    10. Mens på is, tilsett 15 mL av pK184-genet Ligeringsreaksjonen fra trinn 1.3.10 til 100 ul av kjemisk kompetente DH5a-celler i et sterilt 1,5 ml rør. bland forsiktig ved pipettering og inkuber på is i 10 min. Gjør det samme for den negative kontrollprøven. For en positiv kontroll, bruker 20-100 ng av et plasmid som pBAD33 og forvandle det til 50 mL av DHα celler.
    11. Direkte overføring av prøvene fra is inn i et 42 ° C vannbad og inkuberes i 90 sekunder. Dette gir cellene en varmesjokk og tillater dem for opptak av plasmid-DNA.
    12. Plasser cellene tilbake på is i en annen5 min og deretter legge 900 mL sterilt LB. Inkuber ved 37 ° C i 1 time under rysting ved 125 rpm.
    13. Alikvot et 100 ul volum av prøve fra hver ligeringsreaksjonen i 1.3.13 på en agarplate inneholdende 50 ug / ml kanamycin (Km) og spre cellene ved hjelp av en steril sprederen. Den positive kontrollen plate bør ha egnede antibiotika. Hold området sterilt og arbeide i nærheten av en flamme. Inkuber platen opp-ned ved 37 ° C over natten.
    14. Ved hjelp av en steril pipette eller sløyfe, høste en enkelt distinkt koloni av celler og inokulere en 20 ml steril LB med 50 ug / ml Km. Hold området sterilt og arbeide i nærheten av en flamme. Dyrke cellene O / N ved 37 ° C med risting ved 200 rpm.
    15. Gjøre 3-5 glyserol bestander av de transformerte DH5a-celler ved å blande 500 pl av O / N-kultur med 500 ul steril 100% glycerol (slutt 50% v / v) i sterile kryo-rør. Oppbevar ved -80 ° C.
    16. Også sentrifuge 6-8 ml O / N kultur ved værelsestemperatur, 5,000 x g i 3 min. Dekanter supernatanten og trekke ut pK184-genet utvinning plasmid fra pelleten ved hjelp av et plasmid mini-prep kit (Materialer Table) og produsentens protokoll.
  • pK184 - genet Mutants
    Note: Grunning designet for slettinger, innsettinger og / eller punktmutasjoner kan enkelt ut med produsentens nett tilgjengelige verktøy.
    1. Utforme hver fremover primer med å velge en 18-32 bp lang nukleotid-sekvens som er homolog til 5'-enden av genet av interesse, inkludert startkodonet. Design primere slik at hver forover primer hybridiserer 30-180 bp nedstrøms fra den foregående, noe som resulterer i delesjonsmutanter som mangler N-terminale peptid-fragmenter med passende lengder.
    2. Designe en revers primer ved å plukke en 18-32 bp lang nukleotid-sekvens som er homolog til den 3 'ende av genet av interesse, inkludert stoppkodonet. Kopier denne primer til enny tilgjengelige bioinformatikk programmet og konvertere sekvens i sin revers komplement. Dette er revers primer.
      1. I tilfelle av gener som koder for periplasmatiske proteiner, utforme den reverse primer som er den omvendte komplement av 3'-enden av en ledersekvens som flankerer 5'-enden av genet og er nødvendig for riktig lokalisering av proteinproduktet i periplasmaet.
    3. Ved hjelp av alle tilgjengelige oligo-analysator program, sjekk at slettingen primere har GC innhold mellom 40-60%, lav hårnål smeltetemperatur (T m), lav selv og hetero dimerization T m 's. Bestill primere for syntese og forsendelse fra alle tilgjengelige bioteknologiselskap.
    4. Bruke pK184-genkonstruksjonen oppnådd i protokoll 1.3 som mal og retningslinjene i 1.2.7-1.2.8, PCR forsterke sletting konstruksjoner med primere utformet i trinn 1.4.1-1.4.3 å generere pK184-genet AX amplikonene . Oppbevares forsterket DNA ent -20 ° C.
    5. Ligate den forsterkede konstruksjonen ved hjelp av alle tilgjengelige mutagenese kit (Materialer tabell).
    6. Transform hver av de pK184-genet AX ligates separat i kjemisk kompetente DH5a cellene ved hjelp av en standard varmesjokk-protokollen (se 1.3.11-1.3.13).
    7. Alikvot et 100 ul volum av prøve fra hver ligeringsreaksjonen i 1.4.12 på en agarplate inneholdende 50 mikrogram / ml Km og spre cellene ved hjelp av en steril sprederen. Hold området sterilt og arbeide i nærheten av en flamme. Inkuber platen opp-ned ved 37 ° C over natten.
    8. Ved hjelp av en steril pipette eller sløyfe, høste en enkelt distinkt koloni av celler og inokulere en 20 ml steril LB-media med 50 ug / ml Km. Hold området sterilt og arbeide i nærheten av en flamme. Dyrke cellene O / N ved 37 ° C med risting ved 200 rpm.
    9. Gjør 3-5 glyserol aksjer av de transform DH5a celler ved å blande 500 mL av O / N kultur med 500 pi sterilt 100% glyserol (fginalen 50% v / v) i sterile kryo-rør. Oppbevar ved -80 ° C.
    10. Sentrifuge 6-8 ml O / N kultur ved værelsestemperatur, 5000 x g i 3 min. Dekanter supernatanten og trekke ut pK184 genet AX plasmid konstruere fra pelleten ved hjelp av et plasmid mini-prep kit (Materialer Table) og produsentens protokoll. Oppbevares DNA ved -20 ° C.
  • 2. generasjon av pOX38-Tc Δgene :: Cm Stammer

    1. DY330R pOX38-Tc Δgene :: Cm knockouts
      1. Fremstille en O / N kultur av DY330R pOX38-Tc-celler i 10 ml steril LB inneholdende 10 ug / ml Tc. Grow kultur O / N ved 32 ° C og 200 rpm.
      2. Foreta en 1:70 fortynning av O / N kultur i 20 ml sterilt friskt LB. Dyrke cellene ved 32 ° C til midt-log fase (OD 600nm 0,4-0,6) vekst.
      3. Overføring av 10 ml kultur til en steril kolbe og inkuberes ved 42 ° C i 15 minutter ved 150 rpm på en ristevann bath. Dette vil indusere ekspresjonen av spesifikke proteiner rekombinasjon i DY330R.
      4. Chill kulturen i et is-vannbad i 10 min. Forbered elektrokompetente celler som følger.
        1. Overfør kjølt celler i pre-kjølt koniske rør og sentrifuger ved 4000 xg for 7 min ved 4 ºC. Alle rør og pipetter som skal brukes i den kommende trinnene bør plasseres ved 4 ° C eller på is for å kjøle.
        2. Fjern supernatanten og forsiktig resuspendert cellene i 1 ml iskald DDH 2 O. legg til 30 ml iskald DDH 2 O.
        3. Sentrifuger cellene (4000 xg, 7 min, 4 ° C), kast supernatanten og forsiktig resuspendert cellene i 1 ml iskald DDH 2 O.
        4. Overfør de resuspenderte cellene i på forhånd nedkjølte 1,5 ml mikrofugerør og sentrifuger ved 15 000 xg i 1 min ved 4 ° C.
        5. Forsiktig resuspendert pelleten i 200 ul iskald DDH 2 O og aliquot på 50 ul volumer. Electrocompetent cellene kan bli lagret ved -80 ° C
      5. Tilsett 300 ng av de amplifiserte CAT kassetten fra 1,2 til 50 ul av elektrokompetente DY330R pOX38-Tc-celler under omrøring på is, forsiktig ved å pipettere opp og ned. Gjenta dette trinnet bruker umodifisert pBAD33 plasmid som en positiv kontroll.
      6. Overfør cellene til en på forhånd avkjølt (-20 ° C) 1 mm elektroporasjon kyvette. Electroporate cellene ved 1,8 kV med en tidskonstant på 5,5 ms, ved hjelp av en electroporator. Umiddelbart etter påføring av puls, fortynnes cellene med 1 ml SOC-media og overføre til en frisk mikrosentrifugerør. Inkuber cellene ved 32 ° C i 2 timer.
      7. Alikvot 100 ul av hver prøve på agarplater inneholdende 10 ug / ml Tc og 20 pg / ml Cm og spres ved hjelp av en steril sprederen. Hold området sterilt og arbeide i nærheten av en flamme. Inkuber platen opp-ned ved 32 ° C over natten for å selektere for den vellykkede rekombinanter. CAT kassetten innføres i cellen vil gjennomgå homolog rekombinasjon med genet av interesse og skape DY330R pOX38-Tc Δgene :: Cm (Rif R, Tc R, Cm R) klone.
        Merk: Det er viktig å vokse DY330R celler ved 32 ° C, med unntak av 15 min induksjon ved 42 ° C i Trinn 2.1.3 før generering av elektrokompetente celler, som langvarig vekst ved forhøyede temperaturer risikerer celledød som følge av produksjonen av giftige produkter fra p L operon ansvarlig for rekombinasjon funksjoner i DY330R. 33,34
      8. Fremstille en O / N av DY330R pOX38-Tc Δgene :: Cm celler ved høsting av en enkelt distinkt koloni av celler med en steril pipette eller sløyfe, og inokulering av en 20 ml steril LB-medium med 10 pg / ml Tc, og 20 ug / mL cm. Hold området sterilt og arbeide i nærheten av en flamme. Dyrke cellene O / N ved 32 ° C med risting ved 200 rpm.
      9. Gjør 3-5 glyserol aksjer fra O / N ved å blande 500 mL av O / N kultur med 500 pi sterilt 100% glycerol (endelig 50% v / v) i sterile kryo-rør. Oppbevar ved -80 ° C.
      10. Sentrifuge 6-8 ml O / N kultur ved værelsestemperatur, 5000 x g i 3 min. Dekanter supernatanten og trekke ut pOX38-Tc Δgene :: Cm konstruere fra pelleten ved hjelp av et plasmid mini-prep kit (Materialer Table) og produsentens protokoll; lagre renset DNA ved -20 ° C.
      11. Utfør en konjugerbare parring analysen bruker XK1200 celler som mottakeren til å bekrefte avbrudd av konjugering av genet knockout i henhold til protokollen 3,1.
    2. DY330R pOX38-Tc Δgene :: Cm + pK184-genet
      1. Transform elektrokompetente DY330R pOX38-Tc Δgene :: Cm celler med 300 ng av pK184-genkonstruksjonen via electroporation som per trinn 2.1.4-2.1.7. Alle selektive medier må inneholde 20 mikrogram / ml Cm og 50 mikrogram / ml Km. Inkuber ved 32 ° C. Gjenvinningen plasmidet i de elektroporerte cellene vil nå gjenopprette funksjonen til genet slått ut i DY330R pOX38-Tc Δgene :: Cm celler.
      2. Fremstille en O / N av DY330R pOX38-Tc Δgene :: Cm + pK184-genet rekombinante celler ved høsting av en enkelt distinkt koloni av cellene med en steril pipette eller sløyfe, og inokulering av en 20 ml steril LB-medium med 20 pg / ml Cm og 50 ug / ml Km. Hold området sterilt og arbeide i nærheten av en flamme. Dyrke cellene O / N ved 32 ° C med risting ved 200 rpm.
      3. Gjøre 3-5 glyserol aksjer fra O / N ved å blande 500 pl av O / N-kultur med 500 ul steril 100% glycerol (slutt 50% v / v) i sterile kryo-rør. Oppbevar ved -80 ° C.
      4. Også utføre protokollen 3.1 til å generere XK1200 pOX38-Tc Δgene :: Cm rekombinante celler.
    3. XK1200 pOX38-Tc Δgene :: Cm + pK184-genet og mutanter
      1. Forbered elektrokompetente XK1200 pOX38-Tc Δgene :: Cm celler (fra trinn 2.2.4).
      2. Separat electroporate 300 ng av pK184-genet eller pK184-genet muterte plasmider i 50 mL av electrocompetent XK1200 pOX38-Tc Δgene :: Cm celler som per trinn 2.1.4-2.1.7. Alle selektive medier bør inneholde 10 ug / ml nalidixinsyre (Nal), 20 pg / ml Cm, og 50 mikrogram / ml Km, og inkuberes ved 37 ° C.
      3. Fremstille en O / N av XK1200 pOX38-Tc Δgene :: Cm + pK184-genet rekombinante celler ved høsting av en enkelt distinkt koloni av cellene med en steril pipette eller sløyfe, og inokulering av en 20 ml steril LB-medium med Nal, 20 ug / mL cm og 50 ug / ml Km. Hold området sterilt og arbeide i nærheten av en flamme. Dyrke cellene O / N ved 37 ° C med risting ved 200 rpm.
      4. Gjøre 3-5 glyserol aksjer fra O / N ved å blande 500 pl av O / N-kultur med 500 ul steril 100% glycerol (slutt 50% v / v) i sterile kryo-rør. Oppbevar ved -80 ° C.

    3. konjugerbare Mating Analyser

    1. Konjugerbare Mating å generere XK1200 pOX38-Tc Δgene :: Cm Cells
      1. Forbered en 20 ml steril LB O / N Culture of DY330R pOX38-Tc Δgene :: Cm + pK184-gen-celler ved hjelp av en steril pipette eller sløyfe for å inokulere en 20 ml steril LB inneholdende 20 pg / ml Cm og 50 ug / ml Km med en glycerol lager eller enkelt koloni på en agar plate. Vokse ved 32 ° C med risting ved 200 rpm. Forberede det samme for XK1200 celler i 20 ml steril LB med 10 ug / ml Nal, vokser ved 37 ° C.
      2. Lage 1:70 fortynninger av hver kultur separat i 2 ml steril LB med samme antibiotiske innhold; legge til glukose til en sluttkonsentrasjon på 100 mM til alle donorceller. Dyrke celler til midt-log fase (OD600 0,5-0,7) ved 37 ° C med risting ved 200 rpm.
      3. Sentrifuge (4000 x g i 5 min ved 4 ° C) for å pelletere cellene, kaste supernatanten, vask en gang med kaldt sterilt LB for å fjerne antibiotika, og resuspender cellene i 2 ml kald steril LB.
      4. Alikvot 100 ul av hver kultur i 800 mikroliter sterilt LB-media og tillate dem å mate ved 32 ° C i 1 time uten risting.
      5. <li> Vortex cellene i 30 s for å forstyrre paring parene og plassere dem på is i 10 min for å hindre ytterligere parring.
      6. Alikvot 100 ul av celleblandingen på en agarplate inneholdende 10 ug / ml Nal og 20 pg / ml Cm for å selektere for XK1200 pOX38-Tc Δgene :: Cm celler. Spre cellene ved hjelp av en steril sprederen. Hold området sterilt og arbeide i nærheten av en flamme. Inkubert platen O / N ved 37 ° C opp-ned.
      7. Høste en enkelt koloni av den nye XK1200 pOX38-Tc Δ genet :: Cm knockout-stamme ved hjelp av en steril pipette eller løkke og vokse i sterilt LB med 20 ug / ml Cm, O / N i 37 ° C med risting ved 200 rpm. Gjøre 3-5 glyserol aksjer fra O / N ved å blande 500 pl av O / N-kultur med 500 ul steril 100% glycerol (slutt 50% v / v) i sterile kryo-rør. Oppbevar ved -80 ° C.
        Merk: De resulterende cellene er nå i stand til å bli gjort kompetente for transformasjon med pK184-genkonstruksjoner (protokoller 1.3 og 1.4) for assessing genet og dets mutanter på evnen til å gjenopprette konjugativt overføringsprotokoll i 3,2.
    2. Konjugerbare Mating analysen fra XK1200 givere til MC4100 Mottakere
      1. Forbered en O / N kultur XK1200 pOX38-Tc Δgene :: Cm + pK184-genet celler i 20 ml steril LB med 20 pg / ml Cm, 50 ug / ml Km og MC4100-celler i 5 ml LB med 50 ug / ml streptomycin (SM) ved bruk av celler fra en glyserol lager eller enkelt koloni på en agarplate og sterile pipette eller sløyfe. Grow kulturer på 37 ° C med 200 rpm risting.
      2. Lage 1:70 fortynninger fra hver O / N kultur separat i 2 ml steril LB med de samme antibiotika. Legg glukose til en sluttkonsentrasjon på 100 mM til alle donorceller. Dyrke celler til midt-log fase (OD600 0,5-0,7) ved 37 ° C med risting ved 200 rpm.
      3. Sentrifuge (4000 x g i 5 min ved 4 ° C) for å pelletere cellene, kaste supernatanten, vask en gang med kaldt sterilt LB for å fjerne antibiotics, og resuspender celler i 2 ml kaldt sterilt LB.
      4. I duplikat, alikvot 100 ul av hver kultur i 800 mikroliter sterilt LB-media og tillate dem å mate ved 37 ° C i 1 time uten risting.
      5. Vortex cellene i 30 s for å forstyrre de sammenpassende par og plassere dem på is i 10 minutter for å hindre ytterligere parring.
      6. Bruke mid-logg kulturer fra trinn 3.2.2 og frisk sterilt LB, forberede 6 serielle fortynninger av giver- og mottakerceller fra 10 -2 til 10 -7.
      7. På hver av to halvdeler av en agarplate inneholdende 10 ug / ml Nal, 20 pg / ml Cm og 50 ug / ml Km, flekk 10 ul aliquoter av hver fortynning av XK1200 donorceller, som vist i figur 2. Gjenta for de fortynninger av mottaker MC4100-celler på agarplater inneholdende 50 ug / ml Sm. Inkuber platene O / N ved 37 ° C.
      8. Bruke virvles blandingen fra trinn 3.2.5 og frisk sterilt LB, forberede 6 fortynninger (10 -2 til 10 -7 figur 2. Gjenta for begge like blandinger. Hold området sterilt og arbeide i nærheten av en flamme. Inkuber platene O / N ved 37 ° C.
      9. Bestem tilpassede effektiviteten av hver enkelt konstruksjon som beskrevet i protokollen 3,3.
      10. Gjenta denne protokollen for alle gjenvinnings plasmider for å evaluere effekten av en bestemt mutasjon på effektiviteten av konjugering.
    3. Beregning av Mating Efficiency
      1. Tell antall kolonier fra samme fortynning spotting for hver donor, mottaker og transconjugant celler på sine respektive plater.
      2. Count mottaker kolonier å teste eventuelle skjevheter som ville følge av å ha et større antall transkonjuganter enn mottakere på at gitt fortynning.
      3. Calculate parring effektivitet som antall transconjugant kolonier delt på antall donor kolonier. Multipliser med 100 for å oppnå effektivitet verdi per 100 donorceller.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    Prosessen med F plasmid-drevet Konjugasjon er en koordinert prosess som involverer overføring av proteiner i tra regionen av F-plasmidet som monterer en T4SS å lette pilus syntese og konjugativt DNA-overføring. Proteinet Traf (GenBank tiltredelse # BAA97961; Uniprot ID P14497) er nødvendig for konjugerbare F-pilus formasjon. 10,14,35 - 37 Proteinet inneholder et C-terminalt tioredoksin-lignende domene, selv om den ikke har den katalytiske CXXC motiv. 35,38 selv om det har vært forutsagt å samvirke med Trah protein gjennom dens N-terminale domene, 39 en region vist seg å være mer dynamisk enn den C-terminale domene, 37 ikke mye annet er kjent om proteinets strukturelle trekk. For å vurdere de funksjonelle aspektene av Traf protein i forbindelse med strukturstudier, må vi først slo ut tra genet på pOX38-Tc via homologrekombinasjon, genererer den pOX38-Tc ΔtraF :: Cm plasmid (tabell 1) i E. coli-celler DY330R. 33,34 Også genereres var den pK184-TRAF plasmid fra TRAF-spesifikke primere (tabell 2) for å tilveiebringe utvinning av konjugering og aktiverer sentret proteinets sekvens. Overføringen av den pOX38-Tc ΔtraF :: Cm plasmidet inn i XK1200 celler 40 fra DY330R cellene når pK184-TRAF ble gitt i trans (transkonjuganter dyrket på 10 ug / ml Nal, 10 ug / ml Tc og 20 ug / mL Cm) angir at (a) Traf knockout i pOx38-Tc ΔtraF :: Cm gir en ramme CAT kassett, og (b) at pK184-tra kan gjenopprette konjugerbare funksjon.

    En rekke Traf mutanter ble generert for analyse ved hjelp av konjugerbare parring analysen 37 bruker XK1200 pOX38-Tc ΔtraF :: Cm + pK184-tra AXceller og MC4100-celler 41 som givere og mottakere, henholdsvis. En representant mutant er TRAF 55-247 (tabell 1), en N-terminal delesjonsmutant som fjerner den regionen av proteinet anslått til å interagere med Trah. Når full-lengde TRAF-proteinet er anordnet til donorcellene er konjugativt overføring gjenopprettet (figur 2), samtidig som de tomme plasmidet pK184 ikke (tabell 3). Tilsvarende er konjugativt funksjon i XK1200 donorcellene ikke gjenopprettes når forsynt med plasmid pK184-TRAF 55-247 (tabell 3). Dette indikerer at den avkortede regionen av proteinet er viktig for TRAF sin funksjon i konjugativt anordningen, sannsynligvis gjennom interaksjon med Trah, og tilveiebringer en region av proteinet til mål for ytterligere mutasjonsanalyse.

    Figur 1
    i trans via en recovery plasmid (pK184-genet). Den resulterende pOX38-Tc Δgene :: Cm plasmidet blir overført til en XK1200 belastning (trinn 2) for ytterligere vurdering av genet ved hjelp av samvirkende analyser med en MC4100 mottaker (trinn 3). Klikk her for å se en større versjon av dette tallet.

    Figur 2
    Figur 2: Mating assay for å bedømme målgenet funksjon i konjugasjon. Giver- og mottakercellene var E. coli XK1200 pOX38-Tc ΔtraF :: Cm transformert med pK184-tra og MC4100, henholdsvis. De resulterende transkonjuganter (MC4100 pOX38-Tc ΔtraF :: cm) vokser på plater som inneholder Sm og Cm, indikerer vellykket gjenoppretting av konjugerbare funksjon. Eksperimentet blir utført i duplikat på en enkel agarplate, og serielle fortynninger ble anvendt for å beregne den sammenpassende effektiviteten av gjenopprettende genet mutanter (tabell 2). Klikk her for å se en større versjon av dette tallet.

    Bakteriestamme / Plasmid relevante Kjennetegn Selektiv Marker (e) Henvisning
    bakteriestammer
    DY330R W3110 ΔlacU169 gal490 Åc1857 Δ (cro-bioA) Rif R Rif 33,34
    XK1200 F - lacΔU124 Δ (NADA AROG gal attλ bio Gyra) Nal 40
    MC4100 araD139 Δ (argF-lac) U169 rpsL150 relA1 flbB3501 deoC1 ptsF25 rbsR Sm 41
    Vektorer og konstruksjoner
    pBAD33 Plasmid for til uttrykk under fra P araBAD cm 32
    pK184 2.4 kb kloning vektor, p15A replikon km 31
    pK184-Traf </ Td> F Traf fra pOX38 i pK184 km 35
    pK184-Traf 56-247 F Traf aa 56-247 fra pK184-tra km
    konjugerbare Plasmider
    pOX38-Tc IncFI, Tra +, RepFIA +, f1 Hindlll fragment av F, mini-Tn tc 29,30
    pOX38-Tc ΔtraF :: Cm pOX38-Tc med CAT satt inn i tra Tc Cm 35
    † Cm, kloramfenikol; Km, kanamycin; Nal, nalidiksinsyre; Rif, rifampicin; Sm, streptomycin; Tc, tetracyklin
    ‡ Alle TRAF-konstruksjoner inneholder den 19-resters ledersekvensen for å sikre lokalisering til det periplasmatiske rom.

    Tabell 1: coli-stammer og plasmider anvendt i denne studien.

    Konstruer primer *
    Traf-Cm-For 5'GATCGAGGCTGGCAGTGGTATAACGAGAAAATAAATCCGAAGGA - CTGTGACG GAAGATCACTTC -3 '
    Traf-Cm-Rev 5'TCTTCAGAAACGTTCAGGAACTGTTTTGCCAGGTCGTCCT - CTTATTCAGGCGT AGCACCAG -3 '
    pK184-tra-For 5'tttttt GAATTC TATGAATAAAGCATTACTGCCAC -3 '
    pK184-tra-Rev 5'tttttt AAGCTT TAAAAATTGGGTTTAAAATCTTCAGAAA -3 '
    pK184-Traf 55-247 -For 5'TACG CATATG ATGGCCGCACTGCAGACGG -3 '
    pK184-Traf 55-247 5'TACG CATATG TCCTGACGCCGGAAAAATAAAGCAGCAGAGTAA -3 '
    † Tabell tilpasset fra Lento et al. 2016 35 med tillatelse
    * Traf hengende regionene er kursiv. Restriksjonsenzymseter er understreket (Hindi: AAGCTT, EcoRI: GAATTC, Ndel: CATATG)

    Tabell 2: En liste over primere brukt i denne studien.

    Donor Plasmid † Recovery Plasmid Transkonjuganter ‡ § (celler ml -1) Mating Efficiency§ ||
    pOX38-Tc ΔtraF :: Cm Ingen 0 0
    pOX38-Tc ΔtraF :: Cm pK184 0 0
    pOX38-Tc ΔtraF :: Cm pK184-Traf 5 x 10 3 0,0167
    pOX38-Tc ΔtraF :: Cm pK184-Traf 55-247 0 0
    * Tabell tilpasset fra Lento et al. 2016 35 med tillatelse
    † donorceller var E. coli XK1200, med en gjennomsnittlig konsentrasjon på 3 x 10 7 celler mL -1
    ‡ mottakercellene var E. coli MC4100. Antallet transkonjuganter for den positive kontrollen er fra en 10-5 fortynning. 0 indikerer ingen transkonjuganter fra en 10-2 fortynning.
    §An gjennomsnitt av to til fire sammenpassende eksperimenter ble utført for hver konstruksjon.
    || Mating effektivitet er defined som transkonjuganter per 100 donorceller. 0 parring effektivitet indikerer ingen transkonjuganter fra en 10-2 fortynning

    Tabell 3: Abolished parring effektiviteten av Traf sletting konstruksjoner.

    Subscription Required. Please recommend JoVE to your librarian.

    Discussion

    Konjugasjon fremgangsmåte tilveiebringer et middel som bakterier kan spres gener som gir en evolusjonær fordel for vekst i krevende miljøer, slik som spredning av antibiotika resistensmarkører. Fordi mange av konjugativt plasmider er så store, 12 funksjonelle studier på de som er involvert i sammenstillingen av overføringsapparatet gjennom mutasjon av målgener på konjugativt plasmid selv proteiner er uhåndterlig. Protokollene beskrevet heri tilveiebringe en anordning ved hvilken man kan lettere vurdere målgenet av interesse ved bruk av mindre, mer håndterlige ekspresjonsplasmider (figur 1). Vi benytter F-plasmid-derivatet pOX38-Tc (tabell 1) for å studere F plasmid-medierte konjugasjon; andre konjugerbare plasmider kan studeres ved hjelp av protokollene beskrevet her og egnede avledede plasmider. Den parring analyser skissert har blitt tilpasset fra Frost og kolleger, 42 med noen modifications. I tidligere studier ble 8,33,42 etableringen av pOX38-Tc Δgene :: Cm konstruksjon oppnås ved å spalte genet av interesse med de passende restriksjonsenzymer, og innsetting av det amplifiserte CAT kassetten i pOX38-Tc. 42 I dagens metode, ansetter vi homolog rekombinasjon i recombineering E. coli-stamme DY330R 33,34 til knockout målet genet og erstatte den med CAT kassett. Dette har en fordel av å la den resulterende DY330R belastning harbo pOX38-Tc Δgene :: Cm konstruere å fungere som en kontroll for gen-spesifikke knockout ut F-T4SS mediert konjugerbare overføring via utvinning av overførings bruke pK184-genet utvinning plasmid . Selv om det kan være mulig å generere knockouts med en skarpere-Cas9 metodikk, 43 har vi ikke på dette tidspunktet utforsket denne muligheten.

    Prosessen begynner med genereringen av et gen knockout i F-derivatet plasmidet pOX38-Tc (figure 1). Dette oppnås via homolog rekombinasjon i DY330R-celler (tabell 1), kan andre stammer med lignende funksjoner som DY329, DY331 og DY378 også anvendes. Primerne er i utgangspunktet utformet for å PCR-amplifisere CAT kassetten fra pBAD33 plasmidet 32 og inneholde overhengende baser som er spesifikk for mål-genet (tabell 2); PCR-produktet blir så elektroporert inn i DY330R celler som pOX38-Tc. Homolog rekombinasjon genererer knock-out plasmid pOX38-Tc Δgene :: Cm hvor CAT kassetten er satt inn i ramme innenfor målet genet, effektivt forstyrre T4SS montering og konjugering samtidig som det gir Cm motstand. På samme tid blir target-genet PCR-amplifisert fra pOX38-Tc og satt inn i en liten ekspresjonsplasmid; i denne protokollen bruker vi pK184 for konstitutiv ekspresjon, men man kunne velge et plasmid med induserbar ekspresjon av målgenet hvis ønskelig. Den pK184-genet plasmid blir så transformertinn i DY330R pOX38-Tc Δgene :: Cm-celler, og disse cellene blir deretter brukt som donorer for å overføre pOX38-Tc Δgene :: Cm konstruere via konjugering inn i XK1200 celler for sammenpassende analyser. I paring analyser, giver- og mottakercellene er XK1200 pOX38-Tc Δgene :: henholdsvis Cm og MC4100,. Den pK184-genet utvinning plasmid, i tillegg til serien mutanter av målgenet (delesjoner eller punktmutasjoner), er anordnet til donorcellene for å vurdere deres evne til å gjenopprette parring, og bestemme dens effektivitet, med MC4100 mottakercellene (figur 2 ; Tabell 3).

    Kritisk for fremgangsmåten er bruk av egnet donor og mottaker-stammer (tabell 1), og utformingen av primerne anvendt. For hver primer utformet, det er generelle retningslinjer som bør følges. Mens vi strengt prøver å følge med 40-60% GC-innhold, kan dette ikke alltid være mulig. I slike tilfeller er det eksperimentator skjønn å teste en primer with GC innhold litt under eller over dette området. Smeltetemperaturen (T m) forover og bakover primeren må være like, og glødetemperaturen (T a) verdien bør alltid være lavere enn T m ved 2-5 ° C for PCR. Den frie energi som er tilgjengelig for å tillate at en hårnål for å utvikle bør være mye lavere enn T a, mens den homo- og hetero- dimerisering T m 's må være meget lav (mindre enn -10 kJ og 30 ° C). Primere kan utformes for å sondere delesjoner, innskudd eller punktmutasjoner som ønsket. Det er selvsagt viktig at det resulterende genkonstruksjon bli amplifisert og ligert inn i oppsamlings plasmidet i-ramme slik at den er riktig uttrykt. Transformasjon av kompetente celler kan gjøres via elektroporering eller varmesjokk ved hjelp av elektrokompetente eller kjemisk kompetente celler, respektivt. Vi finner at electroporation er mer effektiv for større konstruksjoner som pOX38-Tc og homolog rekombinasjon oligonucleotide, mens de mindre ekspresjonsplasmider som pK184-TRAF lett kan transformeres inn i cellene ved anvendelse av varmesjokk metoder. Endelig er det viktig å huske på at det vil være flere antibiotika som er i bruk over hele protokollen, som både giver- og mottakerstammer krever forskjellige motstandsverdier som er forskjellige fra de som anvendes på konjugativt og gjenvinning av plasmider.

    Bortsett fra de møtende analyser teknikkene som er beskrevet her, det finnes andre metoder som brukes til å studere Konjugasjon, varierende litt i sin tilnærming. Horisontal genoverføring er en prosess hvor bakterier overføre et plasmid til en mottagercelle, inkludert arts mottakere. 44 En studie av Dahlberg og kolleger 44 for eksempel brukes Konjugasjon å fastslå omfanget av arts horisontal genoverføring. De anvendes inkorporering av grønt fluorescerende protein (GFP) inn i et plasmid klonet inn KT2442 celler; kromosomal lac jeg q-genet i KT2442 celler undertrykke GFP uttrykk. Når det plasmid som bærer GFP overføres til en art uten lac Iq gen, blir fluorescens observert. 44 Til tross for sin begrensning å gi protein spesifikk funksjon i ulike arter, kunne arts konjugering forsøket eventuelt kombinert med protokollene som presenteres her for å gjøre evolusjonære spådommer for protein-protein interaksjoner mellom ulike arter.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    Forfatterne hevder at de ikke har noen konkurrerende økonomiske interesser.

    Acknowledgments

    Denne forskningen ble støttet av en Discovery Grant fra Natural Sciences & Engineering Council of Canada (NSERC).

    Materials

    Name Company Catalog Number Comments
    GeneJet Plasmid Mini-Prep Kit Fisher Scientific K0503
    GeneJet Gel Extraction Kit Fisher Scientific K0692
    GeneJet PCR Purification Kit Fisher Scientific K0702
    Q5 Site-Directed Mutagenesis Kit New England Biolabs E0554S
    Broad Range DNA Ladder New England Biolabs N0303A
    Petri Dishes Fisher Scientific FB0875713
    Electroporator Eppendorf 4309000027
    Electroporation cuvettes Fisher Scientific FB101 Cuvettes have a 1 mm gap.
    Enzymes
    AvaI New England Biolabs R0152S
    EcoRI New England Biolabs R0101S
    HindIII New England Biolabs R0104L
    NdeI New England Biolabs R0111S
    Phusion DNA Polymerase New England Biolabs M0530L
    T4 DNA Ligase New England Biolabs M0202S
    DpnI New England Biolabs R0176S
    Antibiotics Final Concentrations
    Chloramphenicol (Cm) Fisher Scientific BP904-100 20 µg/mL
    Kanamycin (Km) BioBasic Inc. DB0286 50 µg/mL
    Nalidixic acid (Nal) Sigma-Aldrich N8878-25G 10 µg/mL
    Rifampicin (Rif) Calbiochem 557303 20 µg/mL
    Tetracycline (Tc) Fisher Scientific BP912-100 10 µg/mL
    Streptomycin (Sm) Fisher Scientific BP910-50 50 µg/mL

    DOWNLOAD MATERIALS LIST

    References

    1. Dobrindt, U., Hochhut, B., Hentschel, U., Hacker, J. Genomic islands in pathogenic and environmental microorganisms. Nat Rev Microbiol. 2, (5), 414-424 (2004).
    2. Furuya, E. Y., Lowy, F. D. Antimicrobial-resistant bacteria in the community setting. Nat Rev Microbiol. 4, (1), 36-45 (2006).
    3. Griffiths, A., Miller, J., Suzuki, D., Lewontin, R., Gelbart, W. An Introduction to Genetic Analysis, 7th Edition. W.H. Freeman. San Fransisco. (2000).
    4. Cooper, T. F. Recombination Speeds Adaptation by Reducing Competition between Beneficial Mutations in Populations of Escherichia coli. PLoS Biol. Barton, N. H. 5, (9), 225 (2007).
    5. Lujan, S. A., Guogas, L. M., Ragonese, H., Matson, S. W., Redinbo, M. R. Disrupting antibiotic resistance propagation by inhibiting the conjugative DNA relaxase. Proc Natl Acad Sci. 104, (30), 12282-12287 (2007).
    6. Carattoli, A. Plasmids and the spread of resistance. Int J Med Microbiol. 303, (6-7), 298-304 (2013).
    7. Shala, A., Ferraro, M., Audette, G. F. Bacterial Secretion Systems: Nanomachines for Infection and Genetic Diversity. Handbook of Clinical Nanomedicine: Nanoparticles, Imaging, Therapy and Clinical Applications. Bawa, R., Audette, G. F., Rubenstein, I. Pan Sanford Publishing. Singapore. 657-686 (2016).
    8. Tseng, T. T., Tyler, B. M., Setubal, J. C. Protein secretion systems in bacterial-host associations, and their description in the Gene Ontology. BMC Microbiol. 9, (1), Suppl 1 2 (2009).
    9. Alvarez-Martinez, C. E., Christie, P. J. Biological diversity of prokaryotic type IV secretion systems. Microbiol Mol Biol Rev. 73, (4), 775-808 (2009).
    10. Lawley, T. D., Klimke, W. A., Gubbins, M. J., Frost, L. S. F factor conjugation is a true type IV secretion system. FEMS Microbiol Lett. 224, (1), 1-15 (2003).
    11. Lederberg, J., Tatum, E. L. Gene Recombination in Escherichia Coli. Nature. 158, (4016), 558-558 (1946).
    12. Smillie, C., Garcillan-Barcia, M. P., Francia, M. V., Rocha, E. P. C., de la Cruz, F. Mobility of Plasmids. Microbiol Mol Biol Rev. 74, (3), 434-452 (2010).
    13. Willetts, N., Skurray, R. The Conjugation System of F-Like Plasmids. Annu Rev Genet. 14, (1), 41-76 (1980).
    14. Frost, L. S., Ippen-Ihler, K., Skurray, R. A. Analysis of the sequence and gene products of the transfer region of the F sex factor. Microbiol Rev. 58, (2), 162-210 (1994).
    15. Audette, G. F., Manchak, J., Beatty, P., Klimke, W. A., Frost, L. S. Entry exclusion in F-like plasmids requires intact TraG in the donor that recognizes its cognate TraS in the recipient. Microbiology. 153, Pt 2 442-451 (2007).
    16. Christie, P. J., Atmakuri, K., Krishnamoorthy, V., Jakubowski, S., Cascales, E. Biogenesis, Architecture, and Function of Bacterial Type Iv Secretion Systems. Annu Rev Microbiol. 59, (1), 451-485 (2005).
    17. Christie, P. J. Type IV secretion: the Agrobacterium VirB/D4 and related conjugation systems. Biochim Biophys Acta - Mol Cell Res. 1694, (1-3), 219-234 (2004).
    18. Bhatty, M., Laverde Gomez, J. a, Christie, P. J. The expanding bacterial type IV secretion lexicon. Res Microbiol. 164, (6), 620-639 (2013).
    19. Christie, P. J., Cascales, E. Structural and dynamic properties of bacterial Type IV secretion systems (Review). Mol Membr Biol. 22, (1-2), 51-61 (2005).
    20. Christie, P. J. Type IV secretion: Intercellular transfer of macromolecules by systems ancestrally related to conjugation machines. Mol Microbiol. 40, (2), 294-305 (2001).
    21. Christie, P. J., Whitaker, N., González-Rivera, C. Mechanism and structure of the bacterial type IV secretion systems. Biochim Biophys Acta. 1843, (8), 1578-1591 (2014).
    22. Cascales, E. The type VI secretion toolkit. EMBO Rep. 9, 735 (2008).
    23. Silverman, J. M., Brunet, Y. R., Cascales, E., Mougous, J. D. Structure and Regulation of the Type VI Secretion System. Annu Rev Microbiol. 66, (1), 453-472 (2012).
    24. Chandran, V., et al. Structure of the outer membrane complex of a type IV secretion system. Nature. 462, (7276), 1011-1015 (2009).
    25. Rivera-Calzada, A., et al. Structure of a bacterial type IV secretion core complex at subnanometre resolution. EMBO J. 32, (8), 1195-1204 (2013).
    26. Waksman, G., Fronzes, R. Molecular architecture of bacterial type IV secretion systems. Trends Biochem Sci. 35, 691 (2010).
    27. Fronzes, R., Christie, P. J., Waksman, G. The structural biology of type IV secretion systems. Nat Rev Microbiol. 7, (10), 703-714 (2009).
    28. Kaplan, M., et al. Probing a cell-embedded megadalton protein complex by DNP-supported solid-state NMR. Nat Methods. 12, (7), 5-9 (2015).
    29. Guyer, M. S., Reed, R. R., Steitz, J. A., Low, K. B. Identification of a sex-factor-affinity site in E. coli as gamma delta. Cold Spring Harb Symp Quant Biol. 45, Pt 1 135-140 (1981).
    30. Anthony, K. G., Sherburne, C., Sherburne, R., Frost, L. S. The role of the pilus in recipient cell recognition during bacterial conjugation mediated by F-like plasmids. Mol Microbiol. 13, (6), 939-953 (1994).
    31. Jobling, M. G., Holmes, R. K. Construction of vectors with the pl5a replicon, kanamycin resistance, inducible lacZα and pUC18 or pUC19 multiple cloning sites. Nucleic Acids Res. 18, (17), 5315 (1990).
    32. Guzman, L. M., Belin, D., Carson, M. J., Beckwith, J. Tight regulation, modulation, and high-level expression by vectors containing the arabinose P(BAD) promoter. J Bacteriol. 177, (14), 4121-4130 (1995).
    33. Yu, D., et al. An efficient recombination system for chromosome engineering in Escherichia coli. Proc Natl Acad Sci U S A. 97, (11), 5978-5983 (2009).
    34. Lawley, T. D., Gilmour, M. W., Gunton, J. E., Standeven, L. J., Taylor, D. E. Functional and Mutational Analysis of Conjugative Transfer Region 1 (Tra1) from the IncHI1 Plasmid R27. J Bacteriol. 184, (8), 2173-2180 (2002).
    35. Elton, T. C., Holland, S. J., Frost, L. S., Hazes, B. F-Like Type IV Secretion Systems Encode Proteins with Thioredoxin Folds That Are Putative DsbC Homologues. J Bacteriol. 187, (24), 8267-8277 (2005).
    36. Hazes, B., Frost, L. Towards a systems biology approach to study type II/IV secretion systems. Biochim Biophys Acta. 1778, 1839-1850 (2008).
    37. Lento, C., Ferraro, M., Wilson, D., Audette, G. F. HDX-MS and deletion analysis of the type 4 secretion system protein TraF from the Escherichia coli F plasmid. FEBS Lett. Tsolis, R. 590, (3), 376-386 (2016).
    38. Audette, G. F., Van Schaik, E. J., Hazes, B., Irvin, R. T. DNA-binding protein nanotubes: Learning from nature's nanotech examples. Nano Lett. 4, 1897-1902 (2004).
    39. Harris, R. L., Silverman, P. A. Tra proteins characteristic of F-like type IV secretion systems constitute an interaction group by yeast two-hybrid analysis. J Bacteriol. 186, (16), 5480-5485 (2004).
    40. Moore, D., et al. Characterization of the F-Plasmid Conjugative Transfer Gene traU. J Bacteriol. 172, (8), 4263-4270 (1990).
    41. Anthony, K. G., Sherburne, C., Sherburne, R., Frost, L. S. The role of the pilus in recipient cell recognition during bacterial conjugation mediated by F-like plasmids. Mol Microbiol. 13, (6), 939-953 (1994).
    42. Klimke, W. A., Frost, L. S. Genetic analysis of the role of the transfer gene, traN, of the F and R100-1 plasmids in mating pair stabilization during conjugation. J Bacteriol. 180, (16), 4036-4043 (1998).
    43. Jiang, W., Marraffini, L. A. CRISPR-Cas: New Tools for Genetic Manipulations from Bacterial Immunity Systems. Annu Rev Microbiol. 69, (1), 209-228 (2015).
    44. Dahlberg, C., Bergstrom, M., Andreasen, M., Christensen, B. B., Molin, S., Hermansson, M. Interspecies bacterial conjugation by plasmids from marine environments visualized by gfp expression. Mol Biol Evol. 15, (4), 385-390 (1998).

    Comments

    0 Comments


      Post a Question / Comment / Request

      You must be signed in to post a comment. Please or create an account.

      Usage Statistics