Bruke Syntetisk biologi Ingeniør levende celler som grensesnitt med Programmerbare Materials

* These authors contributed equally
JoVE Journal
Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Dette notatet presenterer en rekke protokoller for å utvikle konstruerte celler og funksjon overflater som muliggjør syntetisk konstruert E. coli å kontrollere og manipulere programmerbare materialoverflater.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Heyde, K. C., Scott, F. Y., Paek, S. H., Zhang, R., Ruder, W. C. Using Synthetic Biology to Engineer Living Cells That Interface with Programmable Materials. J. Vis. Exp. (121), e55300, doi:10.3791/55300 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Vi har utviklet en abiotiske-biotiske grensesnitt som gjør det mulig modifiserte cellene for å kontrollere materialegenskapene til en funksjonalisert overflate. Dette systemet er fremstilt ved å lage to moduler: et syntetisk konstruert stamme av E. coli-celler og en funksjonalisert materiale grensesnitt. Innenfor denne artikkelen, vi detalj en protokoll for genetisk ingeniør utvalgte atferd innenfor en stamme av E. coli ved hjelp av molekylære kloning strategier. En gang utviklet, denne stammen produserer høye nivåer av biotin når de utsettes for en kjemisk inducer. I tillegg har vi detaljerte protokoller for å skape to forskjellige funksjonaliserte overflater, som hver er i stand til å svare på celle-syntetiserte biotin. Til sammen presenterer vi en metode for å lage en link, abiotiske-biotiske system som gjør det mulig konstruert celler for å kontrollere materiell sammensetning og montering på nonliving underlag.

Introduction

Her rapporterer vi fremgangsmåten for å utvikle en programmerbar substrat er i stand til å reagere på et kjemisk signal fra en manipulert cellelinje. 1 Vi gjør dette ved å opprette en biotin-streptavidin grensesnitt som svarer til biotin produsert av syntetisk konstruert Escherichia coli (E. coli) celler. Tidligere har programmerbare overflater er konstruert for en rekke bruksområder fra toksin påvisning 2 og point-of-care diagnose tre til forsvar og sikkerhet. 4 Selv om programmerbare overflater kan være anvendelige som sensorer og aktuatorer, kan de gjøres "smartere" av endowing dem med evne til å tilpasse seg ulike miljøutfordringer. I motsetning til dette, selv enkle mikroorganismer, slik som E. coli, har iboende tilpasningsevne og er i stand til å reagere på utfordringer med sofistikerte og ofte uventede løsninger. Denne tilpasningsevne har aktivert E.coli-populasjoner, kontrollert av sine komplekse genet nettverk, kostnadseffektivt søke ressurser, fem skape verdiøkende produkter, 6 og til og med makt mikro-skala robotikk. 7 Ved å koble den adaptive fordelene av levende celler ved bruk av programmerbare flater, kan vi skape en smart substrat er i stand til å reagere på forskjellige miljøforhold.

Syntetisk biologi har gitt forskerne nye evner å programmere oppførselen til levende organismer. Ved å konstruere celler til å inneholde nye gennettverk, kan forskerne designe celler som viser en rekke programmerte atferd. 8, 9 Beyond grunnforskning, kan disse atferd brukes for applikasjoner som styrer material montering og biologisk produsere verdiøkende produkter. 10 Heri, vi detalj hvordan vi brukte verktøyene i syntetisk biologi til eningeniør en E. coli stamme som syntetiserer biotin ved induksjon. Denne stamme ble utviklet ved hjelp av restriksjonsenzymkloningsfremgangsmåter for å sette sammen et plasmid, pKE1-lacl-bioB. Dette plasmid, når transformert inn i E. coli-stamme K-12 MG1655, begaver celler med evnen til å uttrykke høye nivåer av bioB, et essensielt enzym for biotin syntese. Når transformerte celler ble indusert med isopropyl-β-D-1-tiogalaktopyranosid (IPTG) og er forsynt med en biotin-forløper, desthiobiotin (DTB), ble forhøyede nivåer av biotin fremstilles.

Biotin 's binding interaksjon med streptavidin er en av de sterkeste ikke-kovalente bindinger som finnes i naturen. Som sådan, er biotin-streptavidin samhandling både godt karakterisert og høyt ansatt i bioteknologi. 11 Innenfor dette manuskriptet, presenterer vi to strategier anvender biotin-streptavidin samspillet til å oppfatte og gjenkjenne celle-produsert biotin med en funksjon overflate. Vireferere til disse kontrasterende flater som "indirekte" og "direkte" kontrollordninger. I den indirekte kontrollsystemet, konkurrerer celle-produsert biotin med biotin som har blitt konjugert og immobilisert på en polystyren-overflate for streptavidin bindingsseter. I tillegg er streptavidin konjugert med pepperrot peroksidase (HRP). HRP modifiserer 3, 3 ', 5, 5'-tetrametylbenzidin (TMB), for å frembringe et optisk signal, 12 som kan bli overvåket ved å kvantifisere den spektrale absorbans (dvs. optisk tetthet) ved 450 nm (OD 450). Således tillater den indirekte kontroll ordningen forskere for å måle celle-produsert biotin ved å måle dempning av OD 450 signalet.

Den direkte kontrollsystem utnytter den streptavidin-biotin hendelse ved å immobilisere streptavidin direkte til en materialoverflate og tillate celle-produsert biotin og biotinylert HRP-streptavidin til å konkurrere om bindingsseter. Igjen,relative nivåer av celle-produsert biotin blir overvåket ved å måle en OD 450 signal.

Tatt sammen, de modifiserte cellene og funksjonaliserte overflater tillate oss å kontrollere egenskapene til en programmerbar overflate ved å indusere nettverk i levende celler. Med andre ord, har vi laget et system som utnytter tilpasning av levende organismer og pålitelighet og spesifikasjon av et konstruert materiale grensesnitt ved å knytte disse systemene sammen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Media og kultur Forberedelse

  1. Forbered lysogeni buljong (LB) materiale ved å blande 25 g av LB pulver lager med 1 liter deionisert (DI) vann, og autoklavering av oppløsningen ved 121 ° C i 20 minutter for å sterilisere.
    1. For å forberede LB-plater, tilsett 15 g agar (1,5%) til LB media før sterilisering
    2. Fremstille stamløsninger av 1,000x karbenicillin (Cb) i DI vann (50 mg / ml).
    3. Hvis forbereder LB media som inneholder et antibiotikum for valg av resistente transformanter, vente til den steriliserte LB medienes temperaturen er under 60 ° C, og deretter legge en mL av antibiotika lager for hver 1 ml LB media.
  2. For M9 minimal media (tabell 1), utarbeide egne stamløsninger av følgende: 5X M9 salter (56,4 g / L), 1 M MgSO4, en M CaCl 2, 20% glukose, og 2% biotin fritt kasaminosyrer.
    1. I en autoklav trygg flaske, kombiner 20 ml 5 x M9 salter, 200 &# 181; L 1M MgSO4, 10 ul av 1 M CaCl2, 2 ml 20% glukose, 1 ml av 2% biotin-fri kasaminosyrer, og 76,8 ml av DI vann.
    2. Autoklav løsningen fremstilt i trinn 1.2.1 ved 121 ° C i 20 min.
  3. Inkuber alle kulturer ved 37 ° C under omrøring ved 400 rpm. Inkubasjonstider variere avhengig av eksperimentet og belastning, men vanligvis vare 8.-12 timer.

2. Generering av Biotin produserende E. coli (Plasmid pKE1-lacl-bioB)

MERK: genetiske Kretsen inneholder to deler: en lacl-repressor, drevet av en P L, Teto-1 promoter som resulterer i konstitutiv ekspresjon på grunn av fraværet av en tetR repressor protein, så vel som et biotin ekspresjonssystem inneholdende P TRC-2- -promoteren, etterfulgt av en sterk ribosom bindingssete (rbs) som driver ekspresjon av bioB. All kloning ble henrettet i en kommersiell, raskt dele E. coli strai. Den endelige konstruksjon ble transformert inn i E. coli MG1655WT for testing. Primere (Tabell 2) ble kjøpt kommersielt.

  1. Isolere bioB-genet fra E. coli genomet ved å utføre hel-celle-polymerase kjedereaksjon (PCR):
    1. Grow E. coli MG 1655WT celler over natten ved 37 ° C.
    2. I et 0,2 ml PCR-rør, kombinere en mL av over natten-kulturen fremstilt i trinn 2.1.1 med 9 ul sterilt avionisert vann.
    3. Inkuber røret ved 95 ° C i 5 minutter i en termosykler og umiddelbart overføre røret til en -80 ° C fryser i 10 minutter for å lysere cellene. Dette gjør det mulig genomisk DNA for å tjene som en PCR-templat.
    4. Tine løsningen og tilsett (i) 2,5 ul av hver av primerne nBioB2-F1 og nBioB2-r, (ii) 5 pl 5x DNA-polymerase-buffer, (iii) 0,25 ul av DNA-polymerase, (iv) 0,5 ul dNTP mix og (v) 6,75 pl DI vann til et totalt reaksjonsvolum på 25 ul(Tabell 4).
    5. Strike siden av (dvs. flick) røret for å blande innholdet. Deretter straks spinne ned i røret raskt (~ 2 e) for å sikre at prøven er på bunnen av røret.
    6. Plasser røret på en PCR termosykler og bruke programmet som er beskrevet i tabell 3, med et ytterligere trinn av 3 min ved 95 ° C ved begynnelsen av protokollen.
    7. Bekrefte vellykket PCR ved anvendelse av gelelektroforese (1,0 til 1,2% agarose i DI-vann + etidiumbromid) i Tris-base, eddiksyre, og EDTA-buffer (TAE). PCR-produktet skal være 1,070 basepar (bp) lange.
    8. Bruk kommersielle kits i henhold til produsentens instruksjoner for å trekke ut DNA-fragmenter fra gel fra trinn 2.1.7.
  2. Isoler P TRC-to-promoteren og lacl operon fra plasmidet pKDL071 13 (courtesy of laboratoriet av James Collins ved MIT):
    1. Dyrke E. coli-celler inneholdden pKDL071 plasmid over natten i LB + Cb ved 37 ° C.
    2. Ekstrahere plasmid DNA fra cellene ved bruk av et kommersielt miniprep-sett i overensstemmelse med produsentens instruksjoner. Plasmidet vil tjene som en PCR-templat.
    3. Følg PCR protokoll fra trinn 2.1.4. til 2.1.8. med følgende endringer:
    4. Erstatte lyserte celler med plasmidet ekstrakten i trinn 2.2.2.
    5. Bruk 2,5 mL hver av primere 1-f og en-r for lacl kassett utvinning. Alternativt bruke 2,5 mL hver av primere nBioB1-f og nBioB1-R for P TRC-2 utvinning.
    6. Utføre gelelektroforese (trinn 2.1.7) for å bekrefte PCR-produktene er lacl-kassetten og P trc-2 promoter-området. De bør være 1213 bp og 109 bp lange, henholdsvis.
  3. Bruk skjøting av overlapping forlengelse (SOE) PCR for å bygge bioB kassett som inneholder P TRC-2, et syntetisk ribosombindingssete (RBS) i primer nBioB2-f2, og bioB tabell 3.
  4. Sett konstruksjoner (P L, Teto-1 + lacl og P TRC-2 + bioB) i pKE1-MCS plasmidvektor 13 ryggrad (courtesy of laboratoriet av James Collins ved MIT) ved å fordøye vektoren og sett med restriksjonsenzymer:
    1. Ekstraher gener ved hjelp av restriksjonsenzymer og gelelektroforese. Hver reaksjonsblanding inneholder (i) 5 pl 10x reaksjonsbuffer, (ii) en pl restriksjonsenzym 1, (iii) 1 pl restriksjonsenzym 2, (iv) minst 1 ug av DNA, og (v) DI vann til bringe det endelige volumet til 50 mL (tabell 5). Digest med enzymer Aatll og EcoRI for lacl kassett og med enzymer Hindi og SacII for bioB kassetten.
    2. Etter at reaksjonene er montert, raskt vortex dem og kort sentrifuge (~ 2 s) før inkubering i 1 time ved 37 ° C.
    3. I løpet avfordøyelsen, forberede gels for elektroforese ifølge standardprotokoller.
    4. Kombiner fordøyd DNA med gel elektroforese 6x lasting buffer.
    5. Bruk en 2-log stigen for å kontrollere plasseringen av ønskede konstruksjon, kutt DNA fragment fra gelen, og bruke kommersielle gel utvinning kit i henhold til produsentens instruksjoner for å trekke ut DNA-fragmenter fra gelen.
  5. Kvantifisere DNA ved hjelp av spektroskopi og beregne volumene til 0: 1, 1: 1 og 3: 1 molforhold mellom innsatsen til vektor ved bruk av ligning 1:
    ligning 1 ligning 1
    I ligning 1, M er forholdet mellom innsatsen til vektor (0, 1 eller 3), X i er mengden av innsatte DNA, bp i er lengden av innsatsen i basepar, er bp v lengden av vektoren i basepar, og X v er den mengde av vektor (50 ng).
  6. Bland ligeringsreaksjon ved å kombinere (i) en pl 10X ligasebuffer, (ii)1 pl av T4-ligase, (iii) 50 ng vektor-DNA, (iv) en masse av innsatte DNA spesifikke for hver reaksjon, og (v) DI vann til 10 pl totalt reaksjonsvolum (Tabell 6).
  7. Inkuber ved romtemperatur (RT) i 1 time.
  8. Under ligation inkubasjon i trinn 2.7, forberede kjemisk kompetente celler.
    1. Alikvot 1 ml natt kulturer i 1,5 ml sentrifugerør.
    2. Sentrifuger ved 16200 x g i 1 min.
    3. Dekanter supernatanten og resuspender pelleten i 200 pl avkjølt (i is) 100 mM CaCl2. Resuspender pelleten ved forsiktig pipettering. Ikke vortex.
    4. Plasser mikrosentrifugerør på is i 10 min.
    5. Sentrifuger, fjern supernatanten, resuspender pelleten i 100 pl kald 100 mM CaCl2, og plassere røret på is igjen.
    6. Sentrifuger røret en endelig tid, og resuspender pelleten i 50 mL av kjølt 100 mM CaCl2.
    7. Plassrøret på is og bruke de kjemisk kompetente celler umiddelbart.
  9. Tilsett 5 mL av ligert DNA utarbeidet i trinn 2.6 og 2.7, i hvert rør av kompetente celler, utarbeidet i trinn 2.8.
  10. Vend røret kort ved å slå på siden (dvs. flicking) rørene og deretter plassere rørene på is i 30 min.
  11. Varmesjokk rørene i 45 s ved 42 ° C og tilbake rørene på is i 2 min.
  12. Pipette celler ut mot selektiv LB agar + antibiotika plater og spre celler ved hjelp av glass plating perler.
  13. Platene inkuberes over natten ved 37 ° C.
  14. Følgende morgen, plukke kolonier fra innleggs-positive plater (dvs. 1: 1 og 3: 1 plater). Plukk 3 kolonier dersom 0: 1 negativ kontroll plate viser ingen vekst, eller plukke 5-8 kolonier dersom 0: 1 plate har en viss vekst. Bruk plukket koloniene for å inokulere 5 ml LB + antibiotikum og vokse i 8 timer ved 37 ° C under omrøring.
  15. Ekstrahere plasmid DNA fra cellene ved hjelp av en miniprep kit, etter produsentens anvisninger. Utføre en test snitt ved hjelp av restriksjonsenzymer (etter den samme fremgangsmåten beskrevet i trinn 2.4.1.).
  16. Identifisere celler med fremgangsrike konstruksjoner ved å sammenligne lengden av de fordøyde DNA-fragmenter med de resultatene som forventes fra en riktig konstruksjon. Kulturer som bærer vellykkede plasmidkonstruksjoner kan konserveres ved å blande like deler kultur med en oppløsning av sterilfiltrert, 40% glycerol (i DI-vann) og frysing av blandingen ved -80 ° C.
    MERK: Transformasjoner av plasmider inn i andre E. coli-stammer (dvs. MG1655WT) kan oppnås ved å følge den ovenfor angitte prosedyre for fremstilling av kjemisk-kompetente celler.

3. Cell Karakterisering: Vekst Curve og Dose Response

  1. Grow utviklet stammer over natten i LB media med en passende antibiotika.
  2. For vekstkurver, forberede 50 ml av minimal M9 media med og uten IPTG (fra en 0,5 M stakk) og / eller DTB (fra en 500 mg / ml stock) som følger:
    1. Forbered 0 ng / ml DTB (0 mL av lager) / 0 mM IPTG (0 mL av lager).
    2. Forbered 200 ng / ml DTB (200 mL av lager) / 0 mM IPTG (0 mL av lager).
    3. Forbered 0 ng / ml DTB (0 mL av lager) / 0,5 mM IPTG (50 mL av lager).
    4. Forbered 200 ng / ml DTB (200 mL av lager) / 0,5 mM IPTG (50 mL av lager).
    5. Vaksinere med overnatting kultur på 1: 100 i media er spesifisert ovenfor.
    6. I en 96-brønns plate, 200 ul alikvoter av kultur, i tre eksemplarer, til hver brønn.
    7. Måle OD 600 hver 5 min i løpet av 24 timer med kontinuerlig rysting og inkubering ved 37 ° C i plateleser.
  3. For dose respons studier erstatte bioB genet i pKE1-lacl-bioB med mCherry (en rød fluorescerende protein) for sanntids optisk kvantifisering.
  4. Legg varierende mengder av IPTG som strekker seg fra 0,1 mM til 5 mM for å indusere ekspresjoni LB media.
  5. Inokuler med dyrking over natten ved en fortynning på 1: 100.
  6. Måle fluorescens hvert 30 min i 15 timer.

4. Induksjon Biotin Produksjonen fra Konstruerte celler og supernatant Forberedelse

  1. Grow pKE1-lacl-bioB i E. coli MG1655 belastning over natten i LB media.
  2. Supplement M9 media med DTB fra 30 til 200 ng / ml.
  3. Tilsett 0,5 mM IPTG for å indusere biotin syntese.
  4. Vaksinere supplert, biotin frie minimale M9 medier med over natten kultur på 1: 100 fortynning.
  5. Etter 24 timer av vekst, sentrifuger cellene og samle den biotin-anrikede supernatant.
  6. Mål biotin-anrikede supernatant med den indirekte kontroll og direkte kontroll funksjonaliserte overflater. Bruk av væsken i stedet for biotin prøven i trinn 5.23 og 6.12 henholdsvis.

5. Indirekte regulering funksjon Forbehandling

  1. Forbered the følgende løsninger.
    1. Fremstille en SMCC oppløsning bestående av 20 mg / ml av suksinimidyl trans-4- (maleimidylmethyl) cykloheksan-1-karboksylat (SMCC) i dimetylsulfoksyd (DMSO).
    2. Fremstille en SPDP oppløsning bestående av 20 mg / ml av succinimidyl-3- (2-pyridylditio) propionat (SPDP) i DMSO.
    3. Forbered 20 mg / ml LC-LC-biotin i DMSO.
    4. Fremstille 10 mg / ml pepperrot-peroksydase (HRP) i fosfatbufret saltvann (PBS).
    5. Fremstille 10 mg / ml streptavidin (SA) i PBS.
    6. Fremstille 10 mg / ml bovint serumalbumin (BSA) i PBS.
    7. Forbered 100 mM ditiotreitol (DTT) i DI vann.
    8. Fremstille 5 mM ethylenediaminetetaacetic syre (EDTA) i PBS.
    9. Forbered 0,5% kasein i PBS.
    10. Forbered 20% Tween 80 lager i DI vann.
    11. Forbered 0,05% Tween 80 (fra 20% lager) i PBS.
    12. Forbered 50 mM natriumacetat i DI vann.
    13. Forbered 1% TMB i DMSO.
    14. Forbered 3% H 2 O 2 in DI vann.
    15. Forbered to MH 2 SO 4 i DI vann.
  2. Legg 1,4 mL av SPDP oppløsning til 20 ul SA løsning.
  3. Inkuber oppløsningen fra 5,2 til 1,5 timer ved romtemperatur, innpakket i aluminiumsfolie for å unngå eksponering for lys. Dette trinnet gjør at SPDP kryssbinder for å binde seg til SA via en aminogruppe danner en pyridyldithio-aktivert SA.
  4. Legg 2.4 mL av DDT løsning til løsningen fra trinn 5.3 og inkuberes i 1 time ved RT. Dette gjør det mulig for en pyridin-2-tion spalting, noe som resulterer i en sulfhydryl-aktivert SA.
  5. Legg 7,5 mL SMCC løsning til 72 mL HRP-løsning og inkuberes i 1,5 timer ved RT, innpakket i aluminiumsfolie for å unngå eksponering for lys. Dette resulterer i en maleimid-aktivert HRP bundet til en aminogruppe.
  6. Bland 17 ul LC-LC-biotin oppløsning med 200 ul BSA-oppløsning og inkuberes i 1,5 timer ved romtemperatur, innpakket i aluminiumsfolie for å unngå eksponering for lys. Dette trinnet kan biotin til konjugerte to BSA via en amidbinding.
  7. Overfør løsningene fra trinn 5.4, 5.5 og 5.6 for å skille sentrifugale konsentra innenfor ring rør.
  8. For rør som inneholder SA-SPDP, fra trinn 5.4, sentrifuger ved 10 000 xg inntil røret volum når 100 mL eller i 16 min. Fyll spin rør til 500 mL med PBS-EDTA.
    1. Gjenta steg 5,8 fem ganger. Oppbevar lager ved 4 ° C.
  9. For rør som inneholder HRP-SMCC, fra trinn 5.5, sentrifuger ved 10 000 xg til volumet når 25 mL eller for 16 min. Fyll spin rør til 500 mL med PBS.
    1. Gjenta steg 5,9 fem ganger. Oppbevar lager ved 4 ° C.
  10. For rør inneholdende BSA-biotin, fra trinn 5.6, sentrifuger ved 10 000 xg inntil volumet har nådd 100 pl eller i 12 min. Fyll spin rør til 500 mL med PBS.
    1. Gjenta trinn 5,10 fire ganger.
    2. Sentrifuger ved 10000 xg inntil volumet har nådd 100 uleller i 12 min. Tilsett 100 ul PBS til røret. Oppbevar lager ved 4 ° C.
  11. Legg 25 mL av 10 mg / ml HRP-løsning med 25 mL av 10 mg / ml SA løsning og oppbevares ved 4 ° C over natten. Dette bevirker at SA til å bli konjugert med HRP via en tioeterbinding.
    1. Forbered en 1: fungerende løsning med overnatter løsning og butikk i 4 ° C kjøleskap 4. Oppbevares gjenværende oppløsning ved -20 ° C.
  12. Fremstille to løsninger bestående av BSA-Biotin (eller BSA) i PBS, ved tilsetning av 10 ul av BSA-biotin lager (eller 10 ul BSA lager) til 490 ul av PBS.
  13. Tilsett 100 pl av oppløsningen fra trinn 5,12 til hver brønn i en 96-brønners polystyren plate.
  14. Inkuber platen ved 37 ° C i 1 time, innpakket i folie.
  15. Vask brønnene i platen med 0,05% Tween 80.
    1. Tilsett 200 ul av 0,05% PBS-Tween 80 til brønnene. Inkuber i 2 min ved RT. Dekanter væsken.
    2. <li> Gjenta trinn 5.15.1 tre ganger.
  16. Tilsett 200 ul av 0,5% kaseinløsning til hver av brønnene i 96-brønns plate.
  17. Inkuber platen ved 37 ° C i 1 time.
  18. Gjenta trinn 5,15 til å vaske brønnene tre ganger.
  19. Forbered en løsning ved å blande 12 ml av 0,5% kasein løsning med 7,5 mL av 0,05% Tween 80.
  20. Fortynn SA-HRP lager 1: 10.000 med oppløsningen fremstilt i trinn 5,19.
  21. Legg 80 ul av oppløsningen fremstilt i trinn 5,20 til hver brønn av en 96-brønns plate.
  22. Tilsett 20 mL av den fremstilte biotin prøven til hver brønn av polystyren plate. Supernatanten fremstilt i 4,6 kan brukes som biotin prøven i dette trinnet.
  23. Inkuber platen ved 37 ° C i 1 time. Dette trinnet åpner for konkurrerende binding mellom fri biotin og immobilisere BSA-biotin for SA-HRP bindingssteder.
  24. Gjenta trinn 5,15 til å vaske brønnene tre ganger.
  25. Bland 50 mM natriumacetat-oppløsning, 1% TMB-løsning,og 3% H to O to oppløsning ved en 1000: 10: 1-forhold (20 ml totalt volum).
  26. Tilsett 200 pl av oppløsningen fra trinn 5,25 til hver brønn og tillates å stå i 15 minutter ved romtemperatur, dekket med folie.
  27. Tilsett 50 ul av 2 MH 2 SO 4 til hver brønn for å stoppe reaksjonen. Mål OD 450 med en plateleser.

6. Direct Control Scheme funksjon Forbehandling

  1. Forbered følgende løsninger.
    1. Forbered 20 mg / ml LC-LC-biotin i DMSO.
    2. Forbered 10 mg / ml HRP i PBS.
    3. Forbered 0,17 mg / ml SA i PBS.
    4. Forbered 0,5% kasein i PBS.
    5. Forbered 20% Tween 80 lager i DI vann.
    6. Forbered 0,05% Tween 80 (fra 20% lager) i PBS.
    7. Forbered 50 mM natriumacetat i DI vann.
    8. Forbered 1% TMB i DMSO.
    9. Forbered 3% H 2 O 2 i DI vann.
    10. Forbered to MH 2 SO 4 vann.
  2. Legg 7,5 mL LC-LC-biotin til 72 mL HRP og inkuber ved i 1,5 timer ved romtemperatur, innpakket i aluminiumsfolie for å unngå eksponering for lys. Dette trinnet fører til biotin-konjugat til HRP via en amidbinding.
  3. Overfør løsningen fra trinn 6,2 til en sentrifugal-konsentrator innenfor et spinnrøret
    1. Sentrifuger løsningen ved 10.000 xg inntil volumet har nådd 100 ul eller i 12 min. Fyll spinnrøret til 500 mL med PBS og gjenta sentrifugering og tilsetning PBS fire ganger. Oppbevar lager ved 4 ° C.
  4. Tilsett 100 ul av den SA-løsning fra 6.1.3 til hver brønn i en 96-brønners polystyren plate.
  5. Inkuber platen ved 37 ° C i 1 time, innpakket i folie.
  6. Vask brønnene i platen med 0,05% Tween 80.
    1. Tilsett 200 ul 0,05% Tween 80 til brønnene. Inkuber i 2 min ved RT. Dekanter væsken.
    2. Gjenta 6.6.1 tre ganger.
  7. Tilsett 200 ul av 0,5% kaseinløsning til hver av brønnene i 96-brønns plate.
  8. Inkuber platen ved 37 ° C i 1 time.
  9. Gjenta trinn 6.6 tre ganger for å vaske brønnene.
  10. Fortynn biotin-HRP lager 1: 10.000 med oppløsningen fremstilt i trinn 6.3.
  11. Legg 80 ul av oppløsningen fremstilt i trinn 6,10 til hver brønn av en 96-brønns plate.
  12. Tilsett 20 mL av den fremstilte biotin prøven til hver brønn av polystyren plate. Supernatanten fremstilt i 4,6 kan brukes som biotin prøven i dette trinnet.
  13. Inkuber platen ved 37 ° C i 1 time. Dette trinnet åpner for konkurrerende binding mellom fri biotin og biotin-HRP for immobilisert SA bindingssteder.
  14. Gjenta trinn 6,6 for å vaske brønnene tre ganger.
  15. Bland 50 mM natriumacetat-oppløsning, 1% TMB-løsning, og 3% H to O to oppløsning ved en 1000: 10: 1-forhold (20 ml totalt volum).
  16. Tilsett 200 pl av oppløsningen fra trinn 6.15 til hver brønn og inkuber i 15 minutter ved romtemperatur, dekket med folie.
  17. Tilsett 50 ul av 2 MH 2 SO 4 oppløsning til hver brønn for å stoppe reaksjonen. Mål OD 450 med en plateleser.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Representative resultater er presentert i de medfølgende fem figurer. Først presenterer vi kloning prosessen grafisk (figur 1), slik at leseren kan visuelt følge de kritiske trinnene for å lage syntetisk konstruert E. coli-stamme. For å karakterisere de populasjonsdynamikk i cellene, gir vi en vekstkurve (figur 2) genereres ved å måle den optiske tettheten ved 600 nm (OD 600) av befolkningen. Deretter viser vi hvordan det regulatoriske genet nettverk er bekreftet, ved hjelp mCherry som en proxy for bioB (figur 3), slik at vi kan optisk måle den relative mengden av bioB som ville bli produsert av cellen ved induksjon med IPTG. Deretter presenterer vi svardata for indirekte kontroll og direkte kontroll funksjon overflater. Disse dataplott (figur 4) ble utviklet ved hjelp av målte løsninger av gratisbiotin å karakterisere de funksjonaliserte overflater 'responsprofiler. Til slutt presenterer vi karakteristiske data som viser hvordan de konstruerte celler blir indusert til å produsere biotin (figur 5), for derved å modifisere de funksjonaliserte overflater.

Figur 1
Figur 1: Prosjektering og bygging av induserbare, utviklet Cells. (A) primere ble konstruert for å isolere den bioB-genet fra E. coli genomet, som koder for et viktig enzym i biotin synteseveien. (B) P L, kan Teto-1 -lacI og P trc-2-sekvenser isoleres fra et plasmid inneholdende en genetisk vippebryter med tilsvarende primere. (C) Det ekstraherte bioB-genet og de to fragmenter fra vippebryteren kan deretter brukes til å lage genet krets. Tilsetningen av IPTG kan da indUCE ekspresjonen av bioB og derved biotin syntese når DTB blir tilsatt som et substrat for bioB. (D) Den sammensatte plasmid ble forvandlet til K-12 MG 1655 E. coli. Dette forårsaket tilstedeværelse av IPTG for å indusere ekspresjon av bioB og derved biotin syntese av den konstruerte cellelinje når DTB ble gitt som et substrat. Klikk her for å se en større versjon av dette tallet.

Figur 2
Figur 2: Vekstkurver for modifiserte cellene. Den konstruerte, induserbare MG1655 villtype-celler ble dyrket og overvåket på minimalt medium (dvs. biotin-fritt media M9), samt minimalt medium supplert med DTB (200 ng / ml) og / eller IPTG (0,5 mM). Tomtene viser OD 600 lesing, målt hvert 5 mi n i 24 timer. Klikk her for å se en større versjon av dette tallet.

Figur 3
Figur 3: Testing av Engineered Gene Network. Den fluorescerende protein mCherry ble anvendt i stedet for bioB-genet slik at vi kunne måle optisk induksjon profilen når modifiserte celler ble indusert med IPTG. Vi kontrast cellene indusert med IPTG (røde diamanter) med cellene ikke indusert med IPTG (blå diamanter). Disse resultatene viser effektiviteten av den induserbare genet nettverket. Klikk her for å se en større versjon av dette tallet.

/55300/55300fig4.jpg "/>
Figur 4: Verifisering av funksjon Material Interface. Ved å eksponere vår funksjonalisert overflate til varierende konsentrasjoner av biotin, er vi i stand til å måle den optiske responsen ved å måle OD 450 absorbans. Disse resultater tillater oss å generere en kalibreringskurve, som forbinder konsentrasjonen av biotin til den optiske intensiteten av responsen. Her presenterer vi biotin vs. optiske signalkurver for både indirekte (til venstre) og direkte (til høyre) funksjonoverflate ordninger. Klikk her for å se en større versjon av dette tallet.

Figur 5
Figur 5: Konstruert Cells kontrollmateriale Interface. Ved å benytte protokoll §§ 5 eller 6, er vi i stand til å bruke produkter av indusert, utviklet calen for kjemisk å modifisere den funksjonaliserte overflate. Vi kan overvåke disse svarene optisk ved å måle OD 450. Videre, ved å bruke kalibreringskurven utviklet i figur 4, kan vi knytte den optiske intensiteten av responsen til biotin i konsentrasjon. Vi presenterer her de ulike biotin konsentrasjoner målt etter vår indirekte kontroll ordningen funksjon overflaten, for villtype celler (hvite), ikke-induserte celler inneholder pKE1-lacl-bioB plasmid (oransje) og induserte celler som inneholder pKE1-lacl-bioB plasmid (grå). Klikk her for å se en større versjon av dette tallet.

Kjemisk endelig Konsentrasjon Beløp
5x M9 salter 1x 20 mL
1 M MgSO4 2 mm 200 mL
1 M CaCl 2 0,1 mm 10 mL
20% glucose 0,40% 2 mL
2% biotin fritt kasamino syre 0,02% 1 ml
DI Water N / A 76,8 ml

Tabell 1: M9 Media oppskrift.

Navn primer Sequence bruk
1-f CCGCCGGAATTCTCCCTATCAGTGATAGAGATT lacl kassett utvinning
1-r CCGACGTCTCACTGCCCGCTTTCCAGTC lacl kassett utvinning
nBioB1-f CCCAAGCTTCTGAAATGAGCTGTTGACAATTAATCAT P TRC-2 utvinning
nBioB1-r GGGGGGTTCTTTTAATAAAGGTACCGTGTGAAATTGTT P TRC-2 utvinning
nBioB2-f1 ACCCCCCTAAGGAGGTCATCATGGCTCACCGCCCACG bioB utvinning
nBioB2-r TCCCCGCGGTCATAATGCTGCCGCGTTGTAATATTC bioB utvinning
nBioB2-f2 ACGGTACCTTTATTAAAAGAACCCCCCTAAGGAGGTCATC Syntetisk RBS tillegg

Tabell 2: Liste over Grunning.

Trinn 1
Steg 2 trinn 3 Trinn 4 Trinn 5 Trinn 6 Trinn 7 Trinn 8 Trinn 9
98 ° C 98 ° C 70 ° C 72 ° C 98 ° C 60 ° C 72 ° C 72 ° C 4 ° C
00:30 00:10 00:30 01: 00 / kb 00:10 00:30 01: 00 / kb 02:00
Gjenta 12 ganger Gjenta 25 ganger
-1 ° C / syklus

Tabell 3: PCR-programmet.

Navn Volum
Cellelvsat (mal) 10 mL
Primer (hver) 0,625 ul (hver)
5x Q5 buffer 5 mL
Q5 Polymerase 0,25 mL
dNTP Mix 0,5 mL
DI Water 6,75 mL

Tabell 4: Whole Cell PCR-reaksjon (25 ul).

Navn Volum
10x Reaksjon buffer 5 mL
enzym 1 1 mL
enzym 2 1 mL
mal DNA 1 mikrogram
DI Water 43 mL - volum av DNA

Tabell 5: restriksjonsenzymspaltning reaksjon (50 ul).

Navn Volum
DNA 50 mikrogram vektor + X ug innsats
10x ligasebufferoppløsning 1 mL
T4-ligase 1 mL
DI Water 8 mL - volum av DNA

Tabell 6: Ringsreaksjonen (10 mL).

Navn Konsentrasjon Merknader
CaCl2 100 mm
Carbeniccilin 50 mg / ml (1000x)
DTB 50 ug / mL
IPTG 0,5 M
SMCC 20 mg / mL 2 mg til 100 pl DMSO
SPDP 20 mg / mL 2 mg til 100 pl DMSO
LC-LC-biotin 20 mg / mL 2 mg til 100 pl DMSO
HRP 10 mg / mL i PBS
SA (indirekte) 10 mg / mL i PBS
SA (direkte) 0,17 ug / mL i PBS
BSA 20 mg / mL i PBS
DTT 100 mM I DI Water
EDTA 5 mm 18,6 mg i 10 ml PBS
kasein 0,50% i PBS
Tween 80 20% I DI Water
Tween 80 i PBS 0,05%
Natriumacetat 50 mm I DI Vann, Juster til 5,1 pH ved hjelp av 3 M HCl
TMB 1% i DMSO
H to O to 3% I DI Water
H 2 SO 4 2 M I DI Water

Tabell 7: Oversikt over Reagent Solutions.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Vi har presentert en ny strategi for grensesnitt utviklet levende celler med en funksjonmaterialoverflaten. Dette ble oppnådd ved å utvikle en cellelinje som er i stand til å syntetisere forhøyede nivåer av biotin når de induseres med IPTG. De forhøyede nivåer av biotin kan deretter anvendes for å modifisere den funksjonaliserte overflate. Protokollene detaljert hvordan å konstruere E. coli cellelinje og hvordan å lage to forskjellige funksjon overflater.

Kritiske trinn i denne protokollen skje gjennom bygging av konstruerte cellelinje. For å unngå nedstrøms problemer, karakteriserer de konstruerte cellestammer med både vekstkurver (figur 2) og fluoriserende respons (figur 3) er oppmuntret. Skulle det oppstå saksbehandlingen, andre Molecular Cloning strategier, for eksempel PCR-ekstraksjon og Gibson enheten 14, kan substitueres for trinn der det er hensiktsmessig. For å optimalisere biotin yield av den konstruerte cellelinje, er det viktig å sikre at en tilstrekkelig mengde av DTB er gitt til cellene. I våre undersøkelser har vi funnet at 200 ng / ml DTB fremkalte en betydelig og statistisk signifikant økning av biotin produksjon når cellene ble indusert med IPTG. I tillegg er vellykket konjugering av BSA-Biotin, SA-HRP, og Biotin-HRP avgjørende for effektivt å utføre og overvåke de indirekte og direkte kontroll ordninger. Vær nøye med å unngå unødvendig eksponering for lys og tillate konjugatene inkubert over natten ved 4 ° C for å sikre en effektiv konjugat dannes.

Vår protokoll gir fordeler sammenlignet med alternative metoder 15 på grunn av sin evne til å detektere små mengder av biotin som er biologisk relevant (pg / ml skala) sammenlignet med kommersielt tilgjengelige biotin påvisningssett, slik som de basert på 4'-hydroxyazobenzene-2-karboksylsyre konkurrerende bindingsstrategier. Selv bruker streptavidin-biotinn system er vanlig i bioteknologi 16, 17, systemets evne til å svare på små mengder biotin tillater oss å direkte knytte vår genmodifisert cellelinje med funksjon overflaten.

En mulig begrensning av vår protokollen er den resulterende dynamiske område biotin deteksjon. I de indirekte og direkte kontroll ordninger, er vi i stand til å oppdage biotin mellom 10 2 -10 3 og 10 4 -10 6 pg / ml, henholdsvis (figur 4). Heldigvis det lave utvalget av indirekte kontroll ordningen tillater oss å lett oppdage biotin produksjon fra konstruerte celler. Men det stramt bånd av indirekte kontroll dynamisk område begrenser dens evne til å oppfatte store endringer (100 ganger) i biotin konsentrasjoner. Endring av dynamisk område for både indirekte og direkte kontroll ordninger vil kreve ytterligere prosjektering. Imidlertid, hvis påvisning av celle produsered biotin er et problem, forbereder fortynninger av biotin supernatant i trinn 4.6 bør tillate forskeren å målrette den dynamiske området for indirekte kontroll ordningen (figur 5). Vi fant ut at en 1: 5 fortynning av supernatanten tillatt oss å målrette den indirekte kontroll ordningens dynamisk område effektivt. Denne fortynningen strategi bør lindre behovet for å endre det dynamiske området direkte.

Den todelte, celle-materiale system som presenteres her muliggjør konstruert for celler for å modifisere sammensetningen av en funksjonalisert overflate. Dynamiske, levende celler kan tolke deres kjemiske omgivelser for å produsere en genetisk respons. Ved å konstruere denne genetiske reaksjon for å øke produksjonen biotin, kan vi utstyre modifiserte levende celler med evnen til å styre og manipulere en funksjonalisert overflate. Ved å følge protokollene som presenteres, modifiserte cellene er i stand til å fungere som dynamiske sensorer, i stand til å lese, behandling og registrering av forholdene rundt them via funksjon grensesnitt. Denne teknologien kan påvirke områder som spenner fra molekylærmedisin til analytten deteksjon for miljøtiltak.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ikke noe å avsløre.

Acknowledgments

Forfatterne ønsker å takke for støtten fra prisen FA9550-13-1-0108 fra Air Force Office of Scientific Research i USA. Forfatterne tillegg erkjenner støtte fra prisen N00014-15-1-2502 fra Office of Naval Research i USA, finansiering fra Institutt for Kritisk Technology and Applied Science ved Virginia Polytechnic Institute og State University, og fra National Science Foundation Graduate Research Fellowship Program, award nummer 1.607.310.

Materials

Name Company Catalog Number Comments
LB Broth, Miller  Fisher Scientific 12-795-027
Agar Fisher Scientific BP9744500
Carbenicillin  Fisher Scientific BP26481
M9, Minimimal Salts, 5x Sigma-Aldrich M6030
Casamino Acids  Fisher Scientific BP1424-100
Magnesium Sulfate, Anhydrous Fisher Scientific M65-500
Calcium Chloride, Dihydrate Fisher Scientific C79-500
Dextrose (D-Glucose), Anhydrous Fisher Scientific D16-1
NEB Turbo Cell Line New England Biolabs C2984l
Oligonucleotide Primers Thermo Fisher Scientific N/A 25N synthesis, DSL purification
Q5 High-Fidelity Polymerase New England Biolabs M0491S
Q5 Reaction Buffer New England Biolabs B9027S
dNTP Solution Mix New England Biolabs N0447S
Agarose Bioexpress E-3120-125
Ethidium Bromide, 1% Fisher Scientific BP1302-10
Gel Extraction Kits Epoch Biolabs 2260250
GenCatch Plasmid DNA Miniprep Kit Epoch Biolabs 2160250
AatII New England Biolabs R0117S
SacII New England Biolabs R0157S
HindIII-HF New England Biolabs R3104S
EcoRI-HF New England Biolabs R3101S
Cutsmart Buffer New England Biolabs B7204S
T4 DNA Ligase New England Biolabs M0202S
T4 DNA Ligase Reaction Buffer New England Biolabs B0202S
ColiRolle Glass Plating Beads  EMD Millipore 7101-3
Glycerol Fisher Scientific BP229-1
Isopropyl β-D-1-thiogalactopyranoside (IPTG) Fisher Scientific BP1755-10
NHS-Desthiobiotin (DTB) Thermo Fisher Scientific 16129
Succinimidyl Trans-4-(maleimidylmethyl) Cyclohexane-1-Carboxylate (SMCC)  Thermo Fisher Scientific S1534
Dimethyl Sulfoxide (DMSO)  Fisher Scientific BP231-100
Succinimidyl 3-(2-pyridyldithio) Propionate (SPDP)  Thermo Fisher Scientific S1531
NHS-LC-LC-biotin Thermo Fisher Scientific 21343
Horseradish Peroxidase (HRP)  Thermo Fisher Scientific 31490
Phosphate Buffered Saline (PBS), 10x Solution Fisher Scientific BP399500
Streptavidin (SA)  Thermo Fisher Scientific 21145
Bovine Serum Albumin (BSA) Fisher Scientific BP1600-100
Dithiothreitol (DTT) Fisher Scientific BP172-5
Ethylenediaminetetaacetic acid (EDTA)  Fisher Scientific S311-500
Tween 80  Fisher Scientific T164-500
Hydrogen Peroxide Fisher Scientific H325-4
3, 3', 5, 5'-tetramethylbenzidine (TMB) Fisher Scientific AC229280050
Vivaspin 500 Centrifugal Concentrators  Viva Products VS0192
Sodium Acetate, Anhydrous Fisher Scientific BP333-500
96-Well Polystyrene Plates Thermo Fisher Scientific 266120

DOWNLOAD MATERIALS LIST

References

  1. Zhang, R., Heyde, K. C., Scott, F. Y., Paek, S. -H., Ruder, W. C. Programming Surface Chemistry with Engineered Cells. ACS Synth. Biol. (2016).
  2. Zhou, X., et al. Reduced graphene oxide films used as matrix of MALDI-TOF-MS for detection of octachlorodibenzo-p-dioxin. Chem. Commun. 46, 6974-6976 (2010).
  3. Pardee, K., et al. Low-Cost Detection of Zika Virus Using Programmable Biomolecular Components. Cell. 165, 1255-1266 (2016).
  4. Bähring, S., et al. Design and Sensing Properties of a Self-Assembled Supramolecular Oligomer. Chem. Eur. J. 22, 1958-1967 (2016).
  5. Nicolau Jr, D. V., Armitage, J. P., Maini, P. K. Directional persistence and the optimality of run-and-tumble chemotaxis. Comp. Biol. Chem. 33, 269-274 (2009).
  6. Du, J., Shao, Z., Zhao, H. Engineering microbial factories for synthesis of value-added products. J. Ind. Microbiol. Biotechnol. 38, 873-890 (2011).
  7. Kim, H., Kim, M. J. Electric Field Control of Bacteria-Powered Microrobots Using a Static Obstacle Avoidance Algorithm. IEEE Trans. Rob. 32, 125-137 (2016).
  8. Gardner, T. S., Cantor, C. R., Collins, J. J. Construction of a genetic toggle switch in Escherichia coli. Nature. 403, 339-342 (2000).
  9. Heyde, K. C., Ruder, W. C. Exploring Host-Microbiome Interactions using an in Silico Model of Biomimetic Robots and Engineered Living Cells. Sci. Rep. 5, 11988 (2015).
  10. Rice, M. K., Ruder, W. C. Creating biological nanomaterials using synthetic biology. Sci. Tech. Adv. Mater. 15, 014401 (2014).
  11. Green, N. M. Avidin. 3. The nature of the biotin-binding site. Biochem. J. 89, 599-609 (1963).
  12. Mesulam, M. M. Tetramethyl benzidine for horseradish peroxidase neurohistochemistry: a non-carcinogenic blue reaction product with superior sensitivity for visualizing neural afferents and efferents. J Histochem. Cytochem. 26, 106-117 (1978).
  13. Litcofsky, K. D., Afeyan, R. B., Krom, R. J., Khalil, A. S., Collins, J. J. Iterative plug-and-play methodology for constructing and modifying synthetic gene networks. Nat. Meth. 9, 1077-1080 (2012).
  14. Gibson, D. G., et al. Complete Chemical Synthesis, Assembly, and Cloning of a Mycoplasma genitalium Genome. Science. 319, 1215-1220 (2008).
  15. Diamandis, E. P., Christopoulos, T. K. The biotin-(strept)avidin system: principles and applications in biotechnology. Clin. Chem. 37, 625-636 (1991).
  16. Nerurkar, L. S., Namba, M., Brashears, G., Jacob,, Lee, A. J., Sever, Y. J., L, J. Rapid detection of herpes simplex virus in clinical specimens by use of capture biotin-streptavidin enzyme-linked immunosorbent assay. J. Clin. Micro. 20, 109-114 (1984).
  17. Cui, Y., Wei, Q., Park, H., Lieber, C. M. Nanowire Nanosensors for Highly Sensitive and Selective Detection of Biological and Chemical Species. Science. 293, 1289-1292 (2001).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please sign in or create an account.

    Usage Statistics