De

Published 2/13/2017
0 Comments
  CITE THIS  SHARE 
Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





By clicking "Submit", you agree to our policies.

 

Summary

Cite this Article

Copy Citation

Udden, S. M., Waliullah, S., Harris, M., Zaki, H. The Ex Vivo Colon Organ Culture and Its Use in Antimicrobial Host Defense Studies. J. Vis. Exp. (120), e55347, doi:10.3791/55347 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Tarmen viser en arkitektur av repetitive krypten strukturer bestående av forskjellige typer epitelceller, lamina propria inneholder immunceller og stroma. Alle disse heterogene celler som bidrar til intestinal homeostase og delta i antimikrobiell vertens forsvar. Derfor, identifisere en surrogatmodell for å studere immunrespons og antimikrobiell aktivitet i tarmen i en in vitro-innstillingen er ekstremt krevende. In vitro studier ved bruk av udødeliggjorte intestinale epitel-cellelinjer eller til og med primær krypt organoid kulturen ikke representerer den nøyaktige fysiologi normal tarmen og dens mikromiljøet. Her har vi diskuterer en fremgangsmåte for dyrkning mus colon vev i en dyrkningsskål og hvordan denne ex vivo organ kultursystem kan gjennomføres i studier relatert til antimikrobielle vertsforsvarsresponser. I representative eksperimenter viste vi at kolon i organkultur uttrykke antimikrobielle peptider i hhvonse til eksogent IL-1β og IL-18. Videre kan de antimikrobielle effektor molekyler produsert av kolon vev i organkultur effektivt drepe Escherichia coli in vitro. Denne tilnærmingen kan derfor benyttes til å dissekere rolle pathogen- og fare-assosierte molekylære mønstre og deres cellulære reseptorer i regulering av tarm medfødte immunresponser og antimikrobielle vertsforsvarsresponser.

Introduction

Tarmen representerer et dynamisk system som fungerer som en barriere for kommensale mikroorganismer, kjemper mot invaderende patogener, og regulerer den mikrobielle sammensetningen 1. Intestinal epitelceller, som består av enterocytes, slimceller, Paneth celler og enteroendocrine celler, er de store cellepopulasjoner som gir vertsforsvarsresponser mot tarmfloraen. Slimcellene produserer slimstoffer som skaper en demineralisert sone på toppen av epitellaget 2. De Paneth celler og enterocytes produsere antimikrobielle peptider, cytokiner, og reaktive oksygen- og nitrogenforbindelser som utgjør antimikrobielle vert forsvar svar og bidrar til å forme tarm mikrobiell sammensetning 3, 4. I tillegg til epitelceller, immunceller, inkludert makrofager, dendrittiske celler, neutrofiler og naturlige drepeceller, lymfocytter, og inna te lymfoide celler i lamina propria og submucosa spille en avgjørende rolle i tarm antimikrobielle vert forsvar svar ved å produsere cytokiner, kjemokiner og andre meklere 5 - 7. For å forstå hvordan det mukosale immunsystemet regulerer bakterieflora og gir beskyttelse mot mikrobiell infeksjon, er det viktig å vurdere et komplekst samspill mellom de heterogene cellepopulasjoner i tarmen. Men en in vitro modell som omfatter alle funksjonene i tarmen er ikke tilgjengelig. Derfor molekylære studier på host-patogen interaksjoner i tarmen er svært utfordrende.

I løpet av de siste årene har flere modellsystemer som etterligner deler av tarmslimhinnen blitt utviklet for å undersøke de patofysiologiske prosessene som er involvert i inflammatoriske tarmsykdommer (IBD) og andre gastrointestinale forstyrrelser 8 -= "xref"> 14. Udødeliggjorte intestinale epitel-cellelinjer blir ofte brukt til å studere epiteliale celle spesifikke responser. Men på grunn av differensial genekspresjon og funksjon i udødeliggjorte celler blir data oppnådd fra ved hjelp av disse cellene ofte ikke samsvarer med de som ble observert i in vivo studier. Intestinal krypten organoid kultur nylig har dukket opp som et potensielt verktøy for å vurdere responsen tarmepitelet til ulike stimuli 13. I dette systemet, er krypten stamceller lov til å vokse og utvikle en 3D organoid struktur. Mens organoid kultursystem er meget nyttig for å studere mange aspekter av tarmepitelet, den ikke etterligne et komplekst samspill av immunceller, epitelceller og mikrobielle produkter. Den ex vivo kultur av tarmvevet har en bedre representasjon av in vivo-vertsforsvarsresponser. I denne fremgangsmåten blir en del av tarmen er dyrket i et cellekulturplate vetth egnede media slik at de forskjellige typer av celle populasjoner i tarmen for å være metabolsk aktive i minst 48 timer. Således kan en ex vivo kultur av organet benyttes for å måle ekspresjonen av antimikrobielle gener og vertsforsvarsresponser i tarmen til et bestemt stimulus.

Etterforskerne har brukt ex vivo orgel kultur system for å studere vertsforsvarsresponser mot mikrobiell infeksjon i tarmen 15-21. Vi har nylig vedtatt orgelet kultur system for å studere rollen til inflammasome i antimikrobielle vert forsvar svar i mus kolon 22. Den inflammasome er en molekylær plattform for aktivering av kaspase-1, som er nødvendig for fremstillingen av modne IL-1β og IL-18. Vi viste at IL-1β og IL-18 induserer antimikrobielle peptider som effektivt dreper commensal pathobionts som E. coli E. coli byrde i inflammasome-defekte mus kolon 22. Dette systemet kan derfor brukes til å studere rollen til mønstergjenkjennings reseptorer (PRRS) og andre medfødte immunmolekyler i tarm antimikrobielle vertsforsvarsresponser, samt patogenesen av tarmsykdommer som for eksempel inflammatorisk tarmsykdom (IBD) og tykktarmskreft (CRC). Det er mer enn 200 IBD resistensgener, og mutasjoner i mange av disse genene er assosiert med endret mikrobiell sammensetning i tarmen. Det er av stor klinisk betydning for å fastslå den nøyaktige mekanisme som de IBD-mottakelighet gener regulerer tarmfloraen. Det overordnede målet med denne metoden er å innføre en grunnleggende protokollen av ex vivo tykktarm orgel kultur og vise hvordan denne kulturen metoden kan brukes til å studere antimikrobielle vert forsvar svar av tarmen.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle forsøkene beskrevet her ble utført ved hjelp av 6-8 uker gammel mannlig villtype (C57BL6 / J) mus opprettholdt i en bestemt patogen gratis (SPF) anlegg på (ARC), UT Southwestern Medical Center Animal Resource Center. Alle studier ble godkjent av Institutional Animal Care og bruk Committee (IACUC) og ble utført i samsvar med de IACUC retningslinjer og National Institutes of Health Guide for omsorg og bruk av forsøksdyr.

1. Innsamling og klargjøring av Colon

  1. Avlive mus med CO 2 kvelning fulgt ved halshugging.
  2. Spray mus med 70% etanol og pin lemmer til et feste styret å holde musen ryggsiden ned på bordet.
  3. Ved hjelp av pre-sterilisert dissekere saks og pinsett, lage en midtlinjen snitt i peritoneum av magen. Åpne buken ved å brette peritoneum med tang.
  4. Fjern tarmen fra bukhulen with dissekere pinsett og saks. Separer den colon fra tynntarmen ved å kutte i bunnen av cecum og den andre ende ved endetarmen.
  5. Plasser tykktarmen i en steril petriskål som inneholdt iskald PBS. Spyle innholdet i hulrommet i tykktarmen med iskald PBS ved anvendelse av en 20 ml sprøyte som holder en 20 G nål eller et oralt inntak nålen slik krakk i hulrommet i tykktarmen er fjernet.
  6. Skjær tykktarmen med saks langs. Vask den tykktarmen ved å riste kraftig i iskald PBS i en steril petriskål.
  7. Skjær kolon vev i biter ca 1 cm lang med en steril skalpell eller saks.
  8. Ta opp vekten av tykktarmen stykker.
    MERK: Alle trinnene i § 1 kan utføres enten innenfor eller utenfor et biologisk sikkerhetskabinett. Når kolon er klar for kultur, må alle trinnene skal utføres i et biologisk sikkerhetskabinett for å opprettholde sterilitet.

2. Colon Orgen kultur

  1. Plassere et cellefilter (100 um) på en 6-brønners cellekulturplate. Overføre alle de kolon stykker samlet fra en mus inn i cellen sil.
  2. Tilsett 5 ml DMEM / F12 medium inneholdende 5% FBS, Penicillin-Streptomycin (1x), og Gentamycin (20 ug / ml). Fullstendig dekke kolon stykker med media.
  3. Inkuber i 2 timer ved 37 ° C i en inkubator med 5% CO2 og 95% luft.
  4. Løft celle sil og aspirer media.
  5. Sett celle sil tilbake på godt og tilsett 5 ml nytt medium uten antibiotika. Løft celle sil og aspirer media.
  6. Gjenta den ovenfor angitte vasketrinnet (trinn 2.5) to ganger mer (total 3x) for å fjerne alle gjenværende antibiotika.
  7. Overfør kolon stykker fra en enkelt celle sil inn i en enkelt brønn i en steril 12-brønners cellekulturplate.
  8. Legg DMEM / F12 medium inneholdende 5% FBS (uten antibiotika). Juster volumet av mediet med weight av kolon stykker, f.eks, 1 ml medium til 100 mg vev. Inkuber i 12 timer ved 37 ° C i en inkubator injisering av 5% CO2 og 95% luft.
  9. Samle kultursupernatanten i et sterilt 1,5 ml rør.
  10. Sentrifuger ved 12.000 xg ved 4 ° C i 5 minutter. Separere supernatanten til et nytt 1,5 ml rør for bruk i bakteriene drept analysen og / eller andre immunanalyser. Supernatanten kan lagres ved -80 ° C inntil analyse.
  11. Samle kolon brikker i et rør for RNA isolering.

3. E. coli Killing analysen

  1. Inokulere E. coli i 5 ml Luria-Bertani (LB) medium i et 15 ml rør og inkuberes ved 37 ° C med risting ved 200 rpm over natten. Hold hetten av kulturen røret litt løs.
  2. Sentrifuger bakteriekultur røret ved 1200 xg i 10 min ved 4 ° C. Fjern supernatanten og resuspender den bakterielle pelleten i 5 ml iskald PBS.
  3. Overføring 1 ml av den bacterial suspensjon i en kyvette og måle OD ved 600 nm. Bruk PBS som en blank.
  4. Beregn kolonidannende enhet (cfu) ved bruk av en forhåndsbestemt standardkurve. Her antar at en OD = 2 x 10 9 cfu / ml (ca.).
  5. Fortynn bakteriesuspensjonen for å gjøre massesuspensjon 1 x 10 5 cfu / ml.
  6. Overfør kolon-organkultur-supernatanten (500 pl / brønn) samles opp i avsnitt 2.10 i duplikate brønner på en 24-brønners cellekulturplate.
  7. Tilsett 10 ul E. coli kultur (1000 cfu) inn i en brønn inneholdende 500 ul tykktarm-organkultur-supernatant. La den andre godt uten noen E. coli vaksinasjon for å bekrefte at kolon organ kultursupernatanten ikke inneholder noen forurensning.
  8. Inkuber det samme antall bakterier (cfu 1000) i dyrkningsmedium (DMEM / F12 pluss 5% FBS) uten noen antibiotika som en kontroll.
  9. Inkuber ved 37 ° C i 1 time.
  10. Plasser 50 mL av hver prøve rulle wise på MacConkey agar plater. Inkuber MacConkey agar-platene ved 37 ° C over natten.
  11. Telle antall kolonier og beregne cfu / ml.

4. Effekten av Ytre og indre faktorer på Kolon Antimikrobielle Host forsvar svar

NB: Den antimikrobielle dreping analysen som er beskrevet her, kan tas i bruk for å undersøke effekten av patogen forbindelse molekylmønstre (PAMPs) og cytokiner med baktericide aktivitet av organkultur-supernatant. Et eksempel på et slikt eksperiment ved bruk av IL-1β og IL-18 er beskrevet nedenfor.

  1. Samle kolon fra mus som beskrevet i punkt 1.
  2. Plasser kolon på et sterilt papirhåndkle. Skjær kolon lengderetningen inn i tre deler ved hjelp av saks (figur 2).
  3. Vask hver del av tykktarmen i iskald PBS som beskrevet i punkt 1.
  4. Skjær hver del av tykktarmen i små biter og veie aseptisk. Overfør stykker av hver deli tykktarmen i tre atskilte celle siler (100 um) som er plassert på tre brønner i en 6-brønners cellekulturplate (figur 2).
  5. Tilsett 2 ml DMEM / F12 medium inneholdende 5% FBS, Penicillin-Streptomycin (1x), og Gentamycin (20 ug / ml).
  6. Inkuber i 2 timer ved 37 ° C i en inkubator injisering av 5% CO2 og 95% luft.
  7. Vask kolon stykker som beskrevet i 2.4 til 2.6. Overfør kolon stykker av en enkelt celle sil inn i en enkelt brønn i en steril 12-brønners cellekulturplate. De tre brønner som inneholdt tre deler av kolon fra en enkelt mus bør være utpekt som ubehandlet, IL-1β, og IL-18 (figur 2).
  8. Legg DMEM / F12 medium inneholdende 5% FBS (uten antibiotika). Juster volumet av mediet med vekten av kolon stykker, f.eks, 1 ml medium til 100 mg vev.
  9. Stimulere organkultur tykktarm med IL-1β (20 ng / ml) eller IL-18 (20 ng / ml) i 12 timer. Den ubehandlede kolon organkultur tjener som kontroll.
  10. Etter 12 timers inkubering ved 37 ° C i en inkubator injisering av 5% CO2 og 95% luft, samle kultursupernatanten i et sterilt 1,5 ml rør.
  11. Overfør 500 ul kultursupernatant inn i duplikate brønner på en 24-brønners plate.
  12. Inokuler E. coli (1000 cfu) i tykktarmen organkultur-supernatanten som beskrevet i seksjon 3. For hver tilstand, inokulering av E. coli i en enkelt brønn. Den andre brønn inneholdende samme organ kultursupernatant uten E. coli vil tjene som en kontroll for bakteriell forurensning.
  13. Inkuber samme mengde bakterier i kulturmedium uten antibiotika som en kontroll.
  14. Inkuber ved 37 ° C i 1 time.
  15. Plassere 50 ul av hver prøve dråpevis på MacConkey-agar-plater. Inkuber MacConkey agar-platene for over natten ved 37 ° C.
  16. Telle antall kolonier og beregne cfu / ml (figur 4).
e_title "> 5. Måling av Expression of Antimicrobial Genes

  1. Etter inkubasjon over natten (12 timer) av colonic organ kultur som beskrevet i punkt 2 og 4, vaske kolon stykker med 2 ml iskald PBS (2x).
  2. Samle kolon brikker i et 2 ml RNase / DNase gratis skrukork. Plasser rørene på is.
  3. Tilsett 1 ml kommersiell Trizol reagens og lyserende matriseperler inn i røret.
  4. Lyse vevet ved hjelp av en automatisert vevshomogenisator.
  5. Samle vevet lysatet til et nytt mikrosentrifugerør.
  6. Isoler RNA ved hjelp av standardprotokollen.
  7. Mål RNA konsentrasjon.
  8. Fortynn RNA hensiktsmessig med avionisert vann og bruke 500 ng RNA for å syntetisere cDNA.
  9. Bruk cDNA for real-time RT-PCR analyse av målrettede antimikrobielle gener, cytokiner, kjemokiner og andre gener av interesse.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Et representativt bilde av kolon i organkultur er vist i figur 1. Kolon brikker i kulturen forblir metabolsk og fysiologisk aktiv. De svarer effektivt på eksogene stimuli lagt til kulturmedier. En skjematisk arbeidsflyt for fremstilling av tykktarmen vev for ex vivo-kultur og stimulering med eksogene stimuli, for eksempel IL-1β og IL-18, er vist i figur 2. De representative data i figur 3 viser at kolon i organkultur uttrykke antimikrobielle peptider slik som β-defensin 2 (BD2), Reg3γ, S100a8, S100a9, og iNOS i respons til IL-1β og IL-18.

Meglerne utgitt av kolon implantater utviser en antimikrobiell drapet effekt som demonstrert ved signifikant redusert vekst av E. coli inkuberes med orgelet kultur supernatanten ( 4B). Et slikt E. coli-drepende aktivitet er ytterligere forsterket ved stimulering av IL-1β og IL-18 (figurene 4A og 4B). Colon organ kultursupernatanter ruges uten E. coli viser ingen bakterievekst etter kultur på MacConkey agar (Tall 4C og 4D). Disse resultatene tyder på at ytterligere den inflammasome spiller en viktig rolle i den intestinale antimikrobielle vertens forsvar.

Samlet viser dataene som er presentert her antyder at ex vivo colonic organkultur er en meget nyttig teknikk for å studere tarm antimikrobielle immunresponser in vitro.

GAPDH_F TGGCAAAGTGGAGATTGTTGCC
GAPDH_R AAGATGGTGATGGGCTTCCCG
β-defensin 2 (BD2) _F TGACCACTGCCACACCAATG
β-defensin 2 (BD2) _R CCTGGCAGAAGGAGGACAAA
Reg3γ_F CAAGGTGAAGTTGCCAAGAA
Reg3γ_R CCTCTGTTGGGTTCATAGCC
S100a8_F TGTCCTCAGTTTGTGCAGAATATAAA
S100a8_R TCACCATCGCAAGGAACTCC
S100a9_F GGTGGAAGCACAGTTGGCA
S100a9_R GTGTCCAGGTCCTCCATGATG
iNOS_F TGTGACACACAGCGCTACAACA
iNOS_R GAAACTATGGAGCACAGCCACAT

Tabell 1: Liste over mus primere for real-time PCR.


Figur 1: Representant bilde av muse kolon brikker i kulturen. (A) Inkubasjon av kolon stykker på et cellefilter (100 um) plassert på en 6-brønns plate. Colon brikkene er nedsenket i 2 ml kultur media supplert med antibiotika. (B) Ved å følge to timers inkubering blir kolon stykker overført til brønnen i en ny 12-brønners cellekulturplate inneholdende antibiotika-fritt medium. Klikk her for å se en større versjon av dette tallet.

Figur 2
Figur 2: Skjematisk fremstilling av trinnene for utarbeidelse av kolon vev og ex vivo stimulering med IL-1β og IL-18. Tykktarmen fra en mus er langs gående retning deles opp i tre deler. Hver del ble skåret i små stykker og veiet. Kolon stykker fra hver del av tykktarmen blir overført til celle siler som er plassert på brønnene i en 6-brønns plate inneholdende 2 ml DMEM / F12-medium pluss 5% FBS og antibiotika. Etter en 2 timers inkubering blir kolon stykker fra en enkelt celle sil overført til en enkelt brønn av en 12-brønners cellekulturplate. DMEM / F12 pluss 5% FBS (uten antibiotika) tilsettes i hver brønn, og volumet av mediet blir justert i henhold til vekten av vevet (1 ml media for 100 mg vev). Colon vev er stimulert med IL-1β (20 ng / ml) og IL-18 (20 ng / ml) i 12 timer. Kultursupernatanter sentrifugeres og brukes til å drepe E. coli-analysen og / eller andre immunanalyser. Kolon vev er samlet i kommersielle trypsin reagens for RNA isolering og påfølgende analyser av antimikrobiell genuttrykk ved real-time PCR..jpg "target =" _ blank "> Klikk her for å se en større versjon av dette tallet.

Figur 3
Figur 3: Muse tykktarm vev uttrykker cytokiner og antimikrobielle peptider som svar på IL-1β eller IL-18 i løpet av ex vivo kultur. Colon organkulturer ble stimulert med IL-1β (20 ng / ml) eller IL-18 (20 ng / ml) i 12 timer. Ekspresjonen av BD2, Reg3γ, S100a8, S100a9, og iNOS ble målt ved hjelp av sanntids-RT-PCR (tabell 1). Data representerer gjennomsnitt ± SD; * P <0,05, ** p <0,01. Klikk her for å se en større versjon av dette tallet.

Figur 4
Figur 4: Overstående muse kolon organ kulture viser bakteriedrepende aktivitet. Colon stykker ble dyrket ex vivo i nærvær eller fravær av IL-1β (20 ng / ml) eller IL-18 (20 ng / ml) i 12 timer. 500 ul av kultursupernatantene ble inkubert med E. coli (1000 cfu) i 1 time ved 37 ° C. Colon organkultur-supernatanten uten E. coli ble også inkubert som kontroll. Etter 1 time inkubering ble 50 ul av hver prøve plassert dråpevis på MacConkey-agarplater og inkubert ved 37 ° C over natten. (A) Bilde av E. coli kolonier på MacConkey agar som viser antimikrobiell aktivitet av kolon organ kultur. (B) E. coli som viser drepende virkning av IL-1β- og IL-18-behandlede colon-organkultur-supernatant. (C) Bilde fra MacConkey agar plate viser ingen bakterievekst i tykktarmen organ kultur inkubert uten E. coli. (D) Ingen E. coli kolonier ble identifisert i tykktarmen organ cruk inkubert uten E. coli, noe som indikerer fravær av forurensende bakterier i prøven. Data representerer gjennomsnitt ± SD; ** P <0,01, *** p <0,001. Klikk her for å se en større versjon av dette tallet.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Den intestinale epitelceller er meget følsomme med hensyn til deres vekst krav, og derfor vanskelige å dyrke. Epitelcellene isolert ved EDTA behandling ikke overlever i konvensjonelle cellekulturmedier slik som DMEM 8. Derfor vert-patogen interaksjonsstudier med isolert krypten eller primære epitelceller er svært utfordrende. Nylig, Sato et al. beskrev en krypt organoid kultur system som er svært lovende og nyttig for studier knyttet til intestinal patofysiologi 13. Mens organoids representerer mange funksjoner i intestinal krypten, det er bekymringer om hvorvidt immunresponsen av organoid celler, som blir dyrket i et sterilt miljø, rekapitulere svarene av intestinale epitelceller in vivo. De nøyaktige teknikker som kreves for isolering og kultur av epiteliale stamceller og kravet om dyre reagenser for kulturen i organoids hindre many laboratorier fra å dra nytte av dette systemet. Mens bruken av ex vivo organ kultur er ikke et alternativ til organoid kultur, har dette systemet en enkel og billig metode for å studere de antimikrobielle responsene til tarmepitelet.

Den store fordelen med denne teknikken er at den vevsarkitektur av tarmen opprettholdes mens dyrking på rettene. Vi observerte at kolon vev er fysiologisk aktive i minst 24 timer etter deres kultur. Under kultur av tykktarmen, colonic epithelial celler reagerer på eksogene stimuli som målt ved ekspresjon av cytokiner og antimikrobielle peptider. Levedyktigheten av epitelceller intakt vev kan bli ytterligere forbedret ved tilsetning av egnede vekstfaktorer og inhibitorer av celledød i kulturmediet. Tidligere rapporter tyder på at det normalt humant kolonvev organ kunne opprettholdes ex vivo i flere dager 8 sup>, 23, 24.

Protokollen for ex vivo kultur mus colonic organ kan ha mange anvendelser i studier knyttet til antimikrobielle immunresponser av tarmepitelet. Patogener og deres PAMPs er anerkjent av PRRS som Toll-lignende reseptorer (TLR) og NOD-lignende reseptorer (NLRs) til stede i epitelceller og immunceller. Defekt ekspresjon og funksjon av mange TLR'ene og NLRs er forbundet med følsomhet for IBD, kolorektal tumorgenese, og bakterielle infeksjoner. Siden udødeliggjort epiteliale cellelinjer ikke representerer alle funksjonene i tarm nisje, er ex vivo kolon organ kultur et svært nyttig eksperimentelle verktøy. Ved hjelp av dette system, kan vi undersøke effekten av forskjellige PAMPs eller stimuli på induksjon av antimikrobielle effektor molekyler i de intestinale epitelceller. I representant eksperiment viste vi at cytokiner likerIL-1β og IL-18 utløser ekspresjon av antimikrobielle peptider (figur 3). Vi viser også her at antimikrobielle peptider produsert av kolon vev kan effektivt drepe E. coli (figur 4). Disse teknikkene kan anvendes for å teste innvirkningen av lipopolysakkarid (LPS), peptidoglykan (PGN), muramyldipeptide (MDP), og andre PAMPs i antimikrobielle vertsforsvarsresponser i tarmen.

Vi har litt modifisert kolon-organkultur-protokollen som beskrevet tidligere 12, 16, 20, 25. Vi dyrket kolon i to faser. Ved første inkubert vi tykktarmen vev i antibiotika inneholdende medium i 2 timer. Vi deretter fjernet antibiotika med gjentatte vaskinger av kolon stykkene etterfulgt av inkubasjon med antibiotika frie medier. Således kultursupernatanten oppnådd fra natt kultur avkolon utstillinger bare effekten av utskilt antimikrobielle peptider når inkuberes med E. coli. Denne fremgangsmåten kan benyttes til å se den bakteriedrepende effekt av tykktarmen eller tarm avledet antimikrobielle peptider på eventuelle bakterier av interesse. En passende selektiv agar media bør bli anvendt for å dyrke bakteriene.

Som de fleste teknikker, er det begrensninger på ex vivo organ kultursystemet. Først, i motsetning til cellekultur eller organoid kultur, organer ikke vokse og proliferere, og derfor kan ikke utvides. For det andre, intestinale epitelceller er svært følsomme og de dør relativt raskt uten ytterligere vekstfaktorer og apoptose-inhibitorer, som brukes for krypt organoid kultur. For det tredje er immunresponsen observert fra orgelet kultur en kollektiv reaksjon på ulike typer cellepopulasjoner. Derfor kan rollen til enkelte celletype i uttrykket av antimikrobielle og effektor genene ikke bli vurdert. Additionally, i motsetning til i cellelinjer og organoid kultur, kan ekspresjonen av antimikrobielle peptider og andre effektor molekyler i kolon varierer fra mus til mus av samme genetisk bakgrunn.

Oppsummert beskriver vi her en enkel protokoll for ex vivo colonic organkultur som er meget nyttig for å studere tarm antimikrobielle immunresponser. Denne tilnærmingen kan brukes til å teste hvilken rolle ulike medfødte immungener i uttrykket av antimikrobielle peptider ved dyrking kolon fra genetisk mutant mus av interesse. Videre kan denne protokollen kan tilpasses for bruk i kliniske studier for å undersøke tarm antimikrobielle svarene av IBD hos pasienter ved å utføre organkultur av colonic biopsiprøver.

Subscription Required. Please recommend JoVE to your librarian.

Acknowledgements

Dette arbeidet ble støttet av midler fra Crohns og Foundation of America kolitt, (CCFA; 3711) Cancer Prevention and Research Institute of Texas (CPRIT; RP160169), og UT Southwestern Medical Center gitt til MHZ

Materials

Name Company Catalog Number Comments
Advanced DMEM/ F12 Life Technologies 12634-010
Dulbecco's phosphate buffered saline, modified, w/o Calcium chloride & Magnesium chloride Sigma 5634
FBS, heat inactivated Sigma F4135
Penicillin-Streptomycin Life Technologies 15070063
Gentamicin solution Sigma G1272
Mouse IL-1b recombinan Reprokine RKP10749
Mouse IL-18 recombinant Reprokine RKP70380
TRIzol Reagent Thermo Fisher Scientific 15596018
Difco Luria-Bertani Broth  BD Bioscience 244620
BD Difco Dehydrated Culture Media: MacConkey Agar Fisher Scientific DF0075-17-1
NanoDrop 1000 Spectrophotometer Thermo Scientific Uded to measure RNA concentration
UV/Vis Spectrophotometer BECKMAN DU 530 Used to determine E. coli count
iScript RT Supermix, 100 rxns Bio-Rad 1708841
iTaq Univer SYBR Green Supermix  Bio-Rad 1725125 
Lysing Matrix S (1/8"), 2 ml Tube MP Biomedicals 116925500 Used to homgenize colon organ for RNA isolation
FastPrep-24 5G System Bio-Rad 116005500
100 mm x 15 mm Petri Dish Falcon 5687
Plate 6 well ps TC CS100, Cellstar, 6w, tc, F-bottom (Flat), w/lid, sterile Cellstar 5085
100 μm cell strainer Falcon 5698
Sorvall Legend Micro 21R Centrifuge Thermo Fisher Scientific
Sorvall ST40R Centrifuge Thermo Fisher Scientific
Forma Scientific orbital shaker Thermo Fisher Scientific

DOWNLOAD MATERIALS LIST

References

  1. Maloy, K. J., Powrie, F. Intestinal homeostasis and its breakdown in inflammatory bowel disease. Nature. 474, 298-306 (2011).
  2. Hooper, L. V., Macpherson, A. J. Immune adaptations that maintain homeostasis with the intestinal microbiota. Nat Rev Immunol. 10, 159-169 (2010).
  3. Vaishnava, S., Behrendt, C. L., Ismail, A. S., Eckmann, L., Hooper, L. V. Paneth cells directly sense gut commensals and maintain homeostasis at the intestinal host-microbial interface. Proc Natl Acad Sci U S A. 105, 20858-20863 (2008).
  4. Kamada, N., Chen, G. Y., Inohara, N., Nunez, G. Control of pathogens and pathobionts by the gut microbiota. Nat Immunol. 14, 685-690 (2013).
  5. Wu, H. J., Wu, E. The role of gut microbiota in immune homeostasis and autoimmunity. Gut Microbes. 3, 4-14 (2012).
  6. Zimmerman, N. P., Vongsa, R. A., Wendt, M. K., Dwinell, M. B. Chemokines and chemokine receptors in mucosal homeostasis at the intestinal epithelial barrier in inflammatory bowel disease. Inflamm Bowel Dis. 14, 1000-1011 (2008).
  7. Elliott, D. E., Siddique, S. S., Weinstock, J. V. Innate immunity in disease. Clin Gastroenterol Hepatol. 12, 749-755 (2014).
  8. Chopra, D. P., Dombkowski, A. A., Stemmer, P. M., Parker, G. C. Intestinal epithelial cells in vitro. Stem Cells Dev. 19, 131-142 (2010).
  9. Autrup, H. Explant culture of human colon. Methods Cell Biol. 21, 385-401 (1980).
  10. Qin, J., et al. A human gut microbial gene catalogue established by metagenomic sequencing. Nature. 464, 59-65 (2010).
  11. Wildenberg, M. E., vanden Brink, G. R. A major advance in ex vivo intestinal organ culture. Gut. 61, 961-962 (2012).
  12. Leushacke, M., Barker, N. Ex vivo culture of the intestinal epithelium: strategies and applications. Gut. 63, 1345-1354 (2014).
  13. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459, 262-265 (2009).
  14. Tsilingiri, K., et al. Probiotic and postbiotic activity in health and disease: comparison on a novel polarised ex-vivo organ culture model. Gut. 61, 1007-1015 (2012).
  15. Haque, A., et al. Early interactions of Salmonella enterica serovar typhimurium with human small intestinal epithelial explants. Gut. 53, 1424-1430 (2004).
  16. Hicks, S., Candy, D. C., Phillips, A. D. Adhesion of enteroaggregative Escherichia coli to pediatric intestinal mucosa in vitro. Infect Immun. 64, 4751-4760 (1996).
  17. Knutton, S., Lloyd, D. R., Candy, D. C., McNeish, A. S. In vitro adhesion of enterotoxigenic Escherichia coli to human intestinal epithelial cells from mucosal biopsies. Infect Immun. 44, 514-518 (1984).
  18. Senior, P. V., Pritchett, C. J., Sunter, J. P., Appleton, D. R., Watson, A. J. Crypt regeneration in adult human colonic mucosa during prolonged organ culture. J Anat. 134, 459-469 (1982).
  19. Smollett, K., Shaw, R. K., Garmendia, J., Knutton, S., Frankel, G. Function and distribution of EspG2, a type III secretion system effector of enteropathogenic Escherichia coli. Microbes Infect. 8, 2220-2227 (2006).
  20. Bareiss, P. M., et al. Organotypical tissue cultures from adult murine colon as an in vitro model of intestinal mucosa. Histochem Cell Biol. 129, 795-804 (2008).
  21. Tsilingiri, K., Sonzogni, A., Caprioli, F., Rescigno, M. A novel method for the culture and polarized stimulation of human intestinal mucosa explants. J Vis Exp. e4368 (2013).
  22. Hu, S., et al. The DNA Sensor AIM2 Maintains Intestinal Homeostasis via Regulation of Epithelial Antimicrobial Host Defense. Cell Rep. 13, 1922-1936 (2015).
  23. Moorghen, M., Chapman, M., Appleton, D. R. An organ-culture method for human colorectal mucosa using serum-free medium. J Pathol. 180, 102-105 (1996).
  24. Dame, M. K., et al. Human colon tissue in organ culture: preservation of normal and neoplastic characteristics. In Vitro Cell Dev Biol Anim. 46, 114-122 (2010).
  25. Grant, A. J., Woodward, J., Maskell, D. J. Development of an ex vivo organ culture model using human gastro-intestinal tissue and Campylobacter jejuni. FEMS Microbiol Lett. 263, 240-243 (2006).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Video Stats