Labortechniken zur Aufrechterhaltung und Differenzierung von Biotypen von * These authors contributed equally

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Dieses Manuskript beschreibt die richtigen Vibrio Cholerae-Instandhaltungstechniken zusätzlich zu einer Reihe von biochemischen Assays, die gemeinsam für eine schnelle und zuverlässige Differenzierung zwischen klinischen und ökologischen V verwendet werden. Cholerae-Biotypen im Laborbereich.

Cite this Article

Copy Citation | Download Citations

Brumfield, K. D., Carignan, B. M., Ray, J. N., Jumpre, P. E., Son, M. S. Laboratory Techniques Used to Maintain and Differentiate Biotypes of Vibrio cholerae Clinical and Environmental Isolates. J. Vis. Exp. (123), e55760, doi:10.3791/55760 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Das aquatische Gram-negative Bakterium Vibrio cholerae ist der ätiologische Wirkstoff der infektiösen Magen-Darm-Cholera. Wegen der globalen Prävalenz und Schwere dieser Krankheit, V. Cholerae wurde sowohl im Umwelt- als auch im Laborbereich umfassend untersucht und erfordert eine ordnungsgemäße Instandhaltungs- und Kultivierungstechniken. Klassik und El Tor sind zwei Hauptbiotypen, die das V bilden . Cholerae O1 Serogruppe, die jeweils einzigartige genotypische und phänotypische Eigenschaften aufweisen, die zuverlässige Mechanismen für die Biotypcharakterisierung liefern und unterschiedliche Virulenz induzierende Kultivierungsbedingungen erfordern. Unabhängig von der Biotype des ursächlichen Stammes für jede gegebene Infektion oder Ausbruch, die Standard-Behandlung für die Krankheit beinhaltet Rehydratationstherapie ergänzt mit einem Regime von Antibiotika. Allerdings kann eine Biotyp-Klassifikation für Laboruntersuchungen erforderlich sein und kann im biomedizinischen Bereich breitere Auswirkungen haben.In den frühen 2000er Jahren wurden klinische Isolate identifiziert, die genotypische und phänotypische Merkmale sowohl von klassischen als auch von El Tor Biotypen aufweisen. Die neu identifizierten Hybriden, die als El Tor-Varianten bezeichnet wurden, haben dazu geführt, dass die klinische und ökologisch isolierte Biotypidentifikation komplexer wird als die bisherigen traditionellen Einzelassay-Identifikationsprotokolle. Neben der Beschreibung von V. Cholerae-Instandhaltungs- und Kultivierungstechniken beschreibt dieses Manuskript eine Reihe von gen- spezifischen ( ctxB- und tcpA ) PCR-basierten genetischen Bildschirmen und phänotypischen Assays (Polymyxin B-Resistenz, Citrat-Metabolismus, proteolytische Aktivität, hämolytische Aktivität, Motilität und Glukosestoffwechsel über Voges- Proskauer-Assay), der gemeinsam zur Charakterisierung und / oder Unterscheidung zwischen klassischen und El-Tor-Biotypen verwendet wird. Gemeinsam bieten diese Assays einen effizienten systematischen Ansatz als Alternative oder zusätzlich zu kostspieligen, arbeitsintensiven Experimenten in der CharakteristikVon V. Cholerae klinische (und umwelt-) isolate.

Introduction

Cholera ist eine Erkrankung des distalen Dünndarms, die durch den Verzehr von kontaminierten Lebensmitteln oder Wasser verursacht wird, die das aquatische Gram-negative Bakterium Vibrio cholerae enthalten. Symptome der Cholera sind Erbrechen und unkontrollierbare wässrige Durchfall, was zu schweren Dehydratation, die, wenn nicht richtig behandelt, wird zum Tod führen. V. Cholerae können in über 200 Serogruppen aufgeteilt werden, basierend auf der Struktur des Zelloberflächen-Lipopolysaccharids O-Antigens. Allerdings haben nur 2 Serogruppen, O1 und O139, epidemisches oder pandemisches Potential 1 , 2 gezeigt . Darüber hinaus ist die Serogruppe O139 in erster Linie nach Südostasien 3 , 4 isoliert, während die Serogruppe O1 weltweit verteilt ist. Darüber hinaus kann die O1-Serogruppe in 2 Haupt-Biotypen unterteilt werden: klassisch und El Tor. Der klassische Biotyp war für die erste 6 Cholera-Pandemie verantwortlichS zwischen 1817 und 1923. Die laufende siebte Pandemie ist ein Ergebnis des El Tor Biotyps, der weltweit den klassischen Biotyp in der Umwelt 5 , 6 , 7 vertrieben hat . In letzter Zeit sind Stämme aufgetreten, die charakteristische Merkmale sowohl der klassischen als auch der El Tor-Biotypen 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 enthalten und seither als El Tor-Varianten 13 , 17 bezeichnet werden . Einige El Tor-Varianten haben erhöhte Virulenz-Fähigkeiten mit einer schnelleren und schweren Krankheitsprogression gezeigt als bisher beobachtet, betontDie Notwendigkeit eines umfassenderen Ansatzes zur Identifizierung von Mitteln und zur Vorbeugung von Krankheiten 8 , 9 , 18 . Während die Biotyp-Identifizierung nicht sofort die Behandlung diktiert, können weitere Fortschritte in der Impfstoffentwicklung und zukünftigen therapeutischen Mitteln von der Biotypunterscheidung profitieren.

Die erste Reihe von Protokollen, die hier aufgelistet sind, ermöglicht es den Ermittlern, V richtig zu pflegen. Cholerae-Stämme im Laborbereich. Konsistenz und anschließende Analyse erfordert die Vorbereitung und das Wachstum von Isolaten, die nicht biotypabhängig sind. Um jedoch die Virulenzgenexpression optimal zu induzieren, sind unabhängige biotypspezifische Kultivierungstechniken erforderlich. Darüber hinaus ist die Vorbereitung für verschiedene genetische und biochemische Assays in diesem Manuskript skizziert.

Cholera-Toxin (CT) und das Toxin co-reGulf Pilot (TCP) sind zwei Hauptvirulenzfaktoren, die vom Masterregler ToxT in beiden Biotypen des V gesteuert werden. Cholerae O1 serogruppe 20 CT ist ein bipartites Toxin aus fünf CtxB Untereinheiten, die eine einzelne CtxA-Untereinheit umgeben, und ist verantwortlich für den schnellen Elektrolytverlust, der mit Cholera verbunden ist. TCP ist ein Typ-IV-Pilus, der von dem tcp- Operon ( tcpABQCRDSTEF ) codiert wird, und ist an der Anhaftung und Besiedlung des distalen Dünndarms beteiligt. TcpA ist das erste Gen des tcp- Operons, das für die einzelnen Pilinuntereinheiten kodiert, die für den Bau des Pilus 8 wesentlich sind. Die Gensequenz für ctxA ist vollständig zwischen klassischen und El Tor Biotypen konserviert , während ctxB und tcpA sich über die beiden Biotypen unterscheiden, aber in jedem Biotyp 8 konserviert sind. CtxB ist vollständig zwischen Biotypen außer bei zwei Base posi konserviert(115 und 203). Im El-Tor-Biotyp befindet sich Thymin an den Basenpositionen 115 und 203, während der klassische Biotyp an diesen Basen Cytosin enthält. TcpA ist in jedem Biotyp vollständig konserviert, unterscheidet sich aber bei mehreren Basen zwischen Biotypen. Diese genetischen Unterscheidungen dienen als primäre Biotyp-Identifikationsmarker, und nach der Sequenzierung des Polymerasekettenreaktions- (PCR-) Amplifikationsprodukts einschließlich dieser Stellen können Isolationssequenzen mit Wildtyp (WT) klassischem O395 oder WT El Tor N16961 verglichen werden, um den Biotyphintergrund zu bestimmen Von CT und TCP in einem gegebenen V. cholerae- Isolat.

Es wurden zahlreiche Protokolle entwickelt, um die phänotypischen Unterscheidungen zwischen den klassischen und den El Tor Biotypen 21 , 22 , 23 zu charakterisieren. Polymyxin B ist ein Peptid-Antibiotikum, das die Integrität der äußeren Zellmembran im Gram-negativen bac kompromittiertTeria und Polymyxin B-Resistenz können durch den Polymyxin-B-Resistenz-Assay 21 sichtbar gemacht werden. Citrat ist ein primäres Substrat des Kreb-Zyklus, und die Fähigkeit, Citrat als einzige Kohlenstoffquelle zu metabolisieren, kann unter Verwendung des Citratmetabolismus-Assays 22 bestimmt werden . HapR kodiert einen globalen regulator und den master quorum-sensing regulator in V. cholerae, HapR, der an verschiedene Promotorregionen bindet und die Gen- und Operon-Expression 24 reguliert. Einige pathogene Stämme von V. cholerae haben eine natürlich vorkommende Frame-Shift-Mutation im hapR- Gen, die diese dichteabhängige Regulation der Virulenzgenexpression verursacht hat, um 24 , 25 verloren zu werden. Die Messung der HapR-regulierten Protease-Aktivität unter Verwendung von Milch-Agar-Medien ermöglicht es dem Forscher zu identifizieren, ob ein bestimmtes Isolat eine funktionelle HapR 23 enthält . DasHämolyse-Assay-Tests für die Fähigkeit eines Stammes, hämolytische Enzyme zu sezernieren, die rote Blutkörperchen lysieren; Der Grad der Hämolyse kann auf Blut-Agarplatten 23 sichtbar gemacht werden. Die Motilität ist oft mit der Virulenz in V. cholerae assoziiert und kann mit Motilitäts-Agarplatten 23 analysiert werden. Die Voges-Proskauer-Assay-Tests für die Fähigkeit eines Stammes, Glukose als einzige Kohlenstoffquelle zu gären und das Nebenprodukt Acetoin zu produzieren 21 . Mit der Entstehung von El Tor-Varianten ist es schwierig, die Ergebnisse eines gegebenen phänotypischen Assays ohne umfangreiches genotypisches Screening vorherzusagen und vor dem Ableiten des Biotyp-Hintergrunds von V. Cholerae-Isolate ist es empfehlenswert, diese Assemblierung von Assays 23 durchzuführen und die Ergebnisse mit Referenzstämmen wie in Tabelle 2 zu vergleichen.

Hier haben wir eine Reihe von Protokollen vorgestellt, die gemeinsam den Vorläufer nutzenGenotypische und phänotypische Assays für einen umfassenderen Ansatz zur Charakterisierung von V. Cholerae biotypen Darüber hinaus haben wir die genotypischen und phänotypischen Unterscheidungen der bekannten V beschrieben. Cholerae El Tor-Varianten (MQ1795 und BAA-2163) im Vergleich zu den üblicherweise verwendeten Biotyp-Referenzstämmen (WT-Klassik O395, WT El Tor C6706 und WT El Tor N16961, Tabelle 1 ). Die Entstehung von El Tor-Varianten hat Herausforderungen für die Zuverlässigkeit von zuvor eingesetzten Single-Assay-Biotyp-Charakterisierungsprotokollen herausgestellt; Dieses Mehrfach-Assay-Identifizierungssystem wird jedoch eine zuverlässigere Charakterisierung von klinischen und ökologischen V ermöglichen. Cholerae isoliert.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Hinweis: Zeitliche Betrachtungen für jeden Assay müssen gemacht werden, da einzelne Medienvorbereitungen unterschiedliche Zeiten erfordern. Zum Beispiel sollten feste Agarplattenmedien ausreichend kühlen und trocknen lassen (1-2 Tage). Zusätzliche Zeitüberlegungen ( dh Einzelkolonie und Übernachtkulturwachstum) werden unter jedem Protokoll spezifiziert und sind in Tabelle 2 zu finden .

1. Vorbereitung der Medien

  1. 1x Phosphatgepufferte Salzlösung (PBS)
    1. Wiegen 4,0 g NaCl, 0,1 g KCl, 0,72 g Na 2 HPO 4 und 0,12 g KH 2 PO 4 . Die Bestandteile werden in einem 1 l Erlenmeyerkolben vermischt, mit deionisiertem Wasser auf 500 ml eingestellt, mit einem pH-Meter den pH-Wert auf 7,2 eingestellt und HCl tropfenweise zu der Lösung gegeben und mit einem 0,22 μm-Filter autoklaviert oder filtriert. 1x PBS kann bei Raumtemperatur auf unbestimmte Zeit gelagert werden.
      ACHTUNG: HCl ist eine konzentrierte Säure und sollte entsprechend behandelt werdenZu institutionellen, lokalen, staatlichen und bundesstaatlichen Vorschriften. Für entsprechende Handhabungsrichtlinien beachten Sie bitte das Sicherheitsdatenblatt des Herstellers.
  2. Luria-Bertani (LB) Brühe
    1. Wiegen 5,0 g Trypton, 2,5 g Hefeextrakt und 2,5 g NaCl. Kombinieren Sie die Bestandteile in einer 1 l Flasche, stellen Sie das Volumen auf 500 ml mit entionisiertem Wasser, Autoklav und speichern Sie bei Raumtemperatur für bis zu 6 Monate. Für klassische Biotyp-Virulenz-induzierende Bedingungen, pH-Wert auf 6,5 mit HCl vor dem Autoklavieren einstellen.
  3. AKI Medium mit 0,03% (w / v) NaHCO 3
    1. Für Komponente 1 (AKI-Medium): 7,5 g Pepton, 2,0 g Hefeextrakt und 2,5 g NaCl wiegen. Kombinieren Sie die Bestandteile in einer 1 l Flasche, stellen Sie das Volumen auf 450 ml mit deionisiertem Wasser und Autoklav ein. AKI-Medium kann bei Raumtemperatur bis zu 6 Monate gelagert werden.
    2. Für Komponente 2 (NaHCO 3 ): 1,5 g NaHCO 3 wiegen und Volumen einstellenBis 50 ml mit deionisiertem Wasser in einem sterilen Vesikel. Filter sterilisieren NaHCO 3 mit einem 0,22 μm Filter. NaHCO 3 muss unmittelbar vor Gebrauch hergestellt werden.
    3. Aseptisch kombinieren die beiden Komponenten ein 1:10 Verhältnis durch Filtern von Komponente 2 in Komponente 1 vor der Verwendung.
  4. Luria-Bertani (LB) Agar Platten
    1. 5,0 g Trypton, 2,5 g Hefeextrakt, 2,5 g NaCl und 7,5 g Agar abwiegen. Die Bestandteile in einem 1 l Erlenmeyerkolben vereinigen, das Volumen auf 500 ml mit deionisiertem Wasser, Autoklaven einstellen und in Standard-100 mm x 15 mm sterilen Petrischalen vorbereiten. Überzogene Medien können bis zu 6 Monate in Plastik verpackt werden, Deckel-Seite bis 4 ° C.
  5. LB-Agarplatten ergänzt mit Polymyxin B
    1. Für Komponente 1 (LB-Agar): 5,0 g Trypton, 2,5 g Hefeextrakt, 2,5 g NaCl und 7,5 g Agar. Kombinieren Sie die Bestandteile in einem 1 l Erlenmeyerkolben, stellen Sie das Volumen auf 500 ml wi einTh deionisiertes Wasser und Autoklav.
    2. Für Komponente 2 (Polymyxin B): Polymyxin B in deionisiertem Wasser in einem sterilen 2 mL Mikrozentrifugenröhrchen auf eine Konzentration von 50.000 IE / μl auflösen und mit einem 0,22 μm Filter filtrieren.
    3. Sobald die Komponente 1 zu der Berührung kalt ist, aber noch nicht verfestigt ist, fügen Sie 500 μl der Komponente 2 zu der Komponente 1 aseptisch hinzu, wodurch eine Endkonzentration von 50 IE / μL entsteht und sorgfältig vermischt wird. Bereiten Sie in standardisierten 100 mm x 15 mm sterilen Petrischalen vor, indem Sie gemischte Agarmedien in die Petrischalen gießen. Überzogene Medien können bis zu 3 Monate in Plastik verpackt werden, Deckel-Seite bis 4 ° C.
  6. Minimale Citrat-Mittel-Agar-Platten
    1. Für Komponente 1 (Agar mit Bromthymolblau): 7,5 g Agar und 0,02 g Bromthymolblau wiegen. Die Bestandteile in einem 1 l Erlenmeyerkolben vereinigen, das Volumen auf 450 ml mit deionisiertem Wasser einstellen und die Mischung autoklavieren.
    2. Für Komponente 2 (10x VBMM): wiegen 10 g MgSO 4 7H 2 O, 10,0 g Zitronensäure H 2 O, 50,0 g wasserfreies K 2 HPO 4 und 17,5 g NaNH 4 HPO 4 4H 2 O. Die Bestandteile in einem 1 l Erlenmeyerkolben vereinigen, das Volumen auf 500 ml einstellen Mit entionisiertem Wasser und Autoklav oder Filter sterilisieren mit einem 0,22 μm Filter. 10x VBMM kann bei Raumtemperatur bis zu 6 Monaten gelagert werden.
    3. Fügen Sie 50 ml Komponente 2 zu Komponente 1 hinzu und bereiten Sie in standardisierten 100 mm x 15 mm sterilen Petrischalen vor, indem Sie gemischte Agarmedien in die Petrischalen gießen. Überzogene Medien können bis zu 6 Monate in Plastik verpackt werden, Deckel-Seite bis 4 ° C.
  7. Milch-Agar-Platten
    1. Für Komponente 1 (Milch): 8,0 g sofortige fettfreie Trockenmilch in einem 1 l Erlenmeyerkolben wiegen, das Volumen auf 200 ml mit entionisiertem Wasser und Autoklav einstellen.
    2. Für Komponente 2 (Agar mit Hirn-Herz-Infusion): 3,68 g Hirn-Herz-Infusion und 6,0 ​​g Agar. Kombinieren Sie die conSubstituenten in einem 500 mL Erlenmeyerkolben, Volumen auf 200 ml mit deionisiertem Wasser und Autoklav einstellen.
    3. Kombinieren Sie die beiden Komponenten, indem Sie die Komponente 2 nach dem Autoklavieren in die Komponente 1 gießen und gründlich mischen. Vorbereiten in 150 mm x 15 mm sterilen Petrischalen. Milchplatten können bis zu einer Woche in Plastik gepackt werden, Deckel-Seite nach unten bei 4 ° C. Bereiten Sie in 150 mm x 15 mm sterilen Petrischalen vor, indem Sie gemischte Agarmedien in die Petrischalen gießen.
  8. Motility Agar Platten
    1. Für Komponente 1 (LB-Agar): 5,0 g Trypton, 2,5 g Hefeextrakt, 2,5 g NaCl und 2,0 g Agar. Die Bestandteile in einem 1 l Erlenmeyerkolben vereinigen, das Volumen auf 500 ml mit entionisiertem Wasser und Autoklav einstellen.
    2. Für Komponente 2 (1% (Gew./Vol.) Triphenyltetrazoliumchlorid, TTC): 0,25 g TTC. Einstellen des Volumens auf 25 ml mit deionisiertem Wasser in einem sterilen Vesikel und Filter sterilisieren mit einem 0,22 μm Filter. Lagerung bis zu 6 Monate bei Raumtemperatur eingewickeltIn der Folie, um die Belichtung zu minimieren.
    3. Füge 2,5 ml 1% (w / v) sterile TTC zu autoklavierten Medien hinzu.
    4. Gießen Sie die Medien so dick wie möglich (≥ 50 ml / Platte) in große 150 mm x 15 mm sterile Petrischalen. Überzogene Medien können bis zu einer Woche in Plastik gepackt werden, Deckel-Seite nach oben bei 4 ° C. Bereiten Sie in 150 mm x 15 mm sterilen Petrischalen vor, indem Sie gemischte Agarmedien in die Petrischalen gießen.
  9. Voges-Proskauer (VP)
    1. Für die Komponente 1 (Methyl-Rot-Voges-Proskauer-Brühe, MR-VP): 1,7 g MR-VP-Medium in einem 500 mL Erlenmeyerkolben abwiegen, das Volumen auf 100 ml mit entionisiertem Wasser und Autoklaven einstellen. Sterile MR-VP-Brühe kann bei Raumtemperatur bis zu 6 Monate gelagert werden.
    2. Für Komponente 2 (5% (w / v) alpha (α) Naphthol): 1,0 g α-Naphthol in einer sterilen Vesikel abwiegen und das Volumen auf 20 ml mit 95% igem Ethanol einstellen. Α-Naphthol kann bei Raumtemperatur bis zu 1 Woche in Folie eingewickelt werden, um Licht exp zu minimierenOsure
    3. Für Komponente 3 (40% (w / v) Kaliumhydroxid, KOH): 20,0 g KOH in einer sterilen Vesikel wiegen, das Volumen auf 50 ml mit sterilem deionisiertem Wasser einstellen. KOH kann bis zu 6 Monate bei Raumtemperatur in einem Kunststoffgefäß aufbewahrt werden.

2. Instandhaltung und Wachstum von V. Cholerae- Stämme

  1. Vorbereitung und Verwendung von Tiefkühlkulturen
    1. Pellet 1,8 ml flüssige über Nacht Kultur für 2 min durch Zentrifugation (≥8,600 xg) in einem sterilen 2 mL Mikrozentrifugenröhrchen, entfernen Sie den Überstand und re-suspendieren Sie das Zellpellet in 900 & mgr; l frische LB-Brühe durch Pipettieren.
    2. Fügen Sie 900 μl steriles 60% (v / v) Glycerin der Kultur hinzu und mischen durch Vortexen.
    3. Übertragen Sie die Mischung auf ein steriles 2 mL Kryo-Röhrchen und lagern Sie auf unbegrenzt bei -80 ° C.
    4. Um zu verwenden, entfernen Sie eine kleine Menge von gefrorenen Bestand mit einer sterilen Impfschleife und Streifen für einzelne Kolonien auf LB agAr Platten. Sofort Rücklauf von gefrorenem Lager auf -80 ° C nach Gebrauch, um zu verhindern, dass Kulturen vollständig auftauen. Inkubieren Sie die Platten Deckel-Seite nach unten für 12 bis 16 h bei 37 ° C.
  2. Wachstum von Übernachtkulturen in flüssigem Medium
    1. Streifen für Einzelkolonien (nach Abschnitt 2.1.4) aus gefrorenem Bestand auf LB-Agarplatten. Inkubieren Sie die Platten Deckel-Seite nach unten für 12 bis 16 h bei 37 ° C.
    2. 4 ml flüssige LB-Brühe in einem sterilen 10-ml-Kulturrohr mit einer einzigen Kolonie inokulieren, indem man die Oberfläche der einzelnen Kolonie mit einem sterilen Applikatorstock berührt und die Kolonie in die flüssige Brühe überführt.
    3. Inkubieren mit Belüftung in einem Shaker-Inkubator bei 225 U / min für 12 bis 16 h bei 37 ° C.
  3. Wachstumskurve
    1. Bereiten Sie über Nacht Kultur in flüssiger LB Brühe vor, wie oben in Protokoll 2.2 angegeben.
    2. Mischen Sie eine 1: 100-Verdünnung der Übernachtkultur durch Übertragen von 250 μl über Nacht Kultur auf 25 ml frische LB-Brühe in einem sterilen 250 mL Erlenmeyerkolben.
    3. Messen Sie die optische Dichte der Flüssigkulturen bei 600 nm (OD 600 ) jede Stunde, die zum Zeitpunkt der Inokulation beginnt (T 0 ).
    4. Inkubieren Sie eine 1: 100-Verdünnung der Übernachtkultur mit Belüftung in einem Shaker-Inkubator bei 225 U / min für bis zu 30 h bei 37 ° C oder bis die Kultur die maximale Dichte erreicht.
    5. Zeichnen Sie die OD 600 vs. Time und verwenden Sie eine lineare Regression, um die ungefähre Verdopplungszeit für jeden Stamm zu bestimmen.
  4. El Tor Biotype Virulenz Inducing Bedingungen
    1. Streifen für einzelne Kolonien aus gefrorenem Bestand auf LB-Agarplatten. Inkubieren Sie die Platten Deckel-Seite nach unten, für 12 bis 16 Stunden bei 37 ° C.
    2. Inokulieren Sie 10 ml AKI-Medium, das 0,03% (w / v) NaHCO 3 mit einer einzigen Kolonie enthält.
    3. Inkubieren Sie die Kultur ohne Belüftung bei 37 ° C für 3,5 h.
    4. 7 ml Kultur entfernen und die restlichen 3 ml Kultus inkubierenRe mit Belüftung in einem Shaker-Inkubator bei 225 U / min für weitere 4 h.
  5. Klassische Biotyp Virulenz Inducing Bedingungen
    1. Streifen für einzelne Kolonien aus gefrorenem Bestand auf LB-Agarplatten. Inkubieren Sie die Platten Deckel-Seite nach unten für 12 bis 16 h bei 37 ° C.
    2. 4 ml flüssige LB-Brühe (pH 6,5) mit einer einzigen Kolonie inokulieren.
    3. Inkubieren mit Belüftung in einem Shaker-Inkubator bei 225 U / min für 12 bis 16 h bei 30 ° C.
  6. Waschzelle Pellet in 1x PBS
    1. Pellet 1,8 ml über Nacht Kultur für 2 min durch Zentrifugation (≥8,600 xg) in einem sterilen 2 mL Mikrozentrifugenröhrchen und entfernen Sie den Überstand mit einer Pipette. Das Pellet in 1,8 ml 1x PBS durch Pipettieren erneut suspendieren.
    2. Wiederholen Sie den Waschvorgang dreimal, gefolgt von einer abschließenden Resuspension in 1,8 ml 1x PBS.

3. Charakterisierung von V. Cholerae Biotypen

  1. PCR-basierte Genetische Bildschirme mit ctxB und tcpA
    1. Entwerfen Sie einen Satz von Primern, die etwa 50-70 bp stromaufwärts und stromabwärts der Translationsstart- und Stoppstellen von ctxB bzw. tcpA anlagern.
    2. Bereiten Sie über Nacht Kultur in flüssiger LB Brühe vor, wie oben in Protokoll 2.2 angegeben.
    3. Isolieren Sie chromosomale DNA mit einem handelsüblichen Kit, der für Gram-negative Bakterien entwickelt wurde. Gereinigte chromosomale DNA kann unbegrenzt bei -20 ° C gelagert werden. Die chromosomale DNA-Isolierung unter Verwendung von im Handel erhältlichen Kits dauert im allgemeinen etwa 4 h.
    4. Verwenden Sie ein Mikro-Volumen-Spektrophotometer, um sicherzustellen, dass die chromosomale DNA-Probe von hoher Qualität ist (A 260/280 > 1,8).
    5. Für jedes chromosomale DNA-Isolat wird die Polymerase-Kettenreaktion (PCR) auf Eis in sterilen 200 & mgr; l PCR-Röhrchen hergestellt und die Bereiche von ctxB und tcpA unter Verwendung von Standard-PCR-Komponenten amplifiziert: Taq- Polymerase und BuFfer (oder äquivalente), dNTP-Lösung und Vorwärts- / Rückwärts-Primer. Verwenden Sie Standard-PCR-Parameter (~ 3 Std.). Verwenden Sie zum Beispiel das folgende Protokoll:
      1. Anfängliche Denatur bei 95 ° C für 120 s.
      2. Denaturierung bei 95 ° C für 60 s.
      3. Anneal-Primer bei 60 ° C für 45 s.
      4. Verlängere bei 72 ° C für 90 s.
      5. Wiederholen Sie die Schritte 3.1.5.2 bis 3.1.5.4 für 34 Zyklen.
      6. Endverlängerung 72 ° C für 600 s.
      7. Unendlicher Halten bei 4 ° C.
    6. Färben Sie 5 & mgr; l des jeweiligen PCR-Produkts unter Verwendung eines Standard-6 × DNA-Gel-Beladungsfarbstoffs und laden Sie etwa 10 & mgr; l 1 kb-Leiter und 10 & mgr; l PCR-Produkt auf ein 1% Agarosegel in 1x Tris-Borat-EDTA (TBE) Puffer.
    7. Führen Sie die Gelelektrophorese bei 130 V aus, bis die Farbstofffront das Ende erreicht hat, aber nicht aus dem Gel (ca. 90 min). Eine ständige Überwachung wird empfohlen, da die Spannungs- und Laufzeiten je nach Ausstattung variieren können.
    8. Bei der Überprüfung vonErfolgreiche PCR-Amplifikation bei der erwarteten Größe, reinigen die verbleibenden 45 μL PCR-Produkte mit einem handelsüblichen DNA Clean & Concentrator Kit.
    9. Sequenz gereinigtes PCR-Produkt (e) unter Verwendung der gleichen Primer, die für die PCR-Amplifikation verwendet werden, und die Vorbereitung pro lokalen Sequenzierungsrichtlinien-Richtlinien.
    10. Vergleichen Sie das FASTA-Format von Gensequenzen von jedem Isolat zu der veröffentlichten Sequenz, die auf der NCBI-Website (http://www.ncbi.nlm.nih.gov/gene/) verfügbar ist, indem Sie die folgenden Zugangsnummern im Suchabfragefeld durchsuchen.
    11. CtxB : (klassische) Region zwischen VC0395_A1059 bis VC0395_A1060 (El Tor) VC_1456
    12. TcpA : (klassisch) VC0395_A0353 (El Tor) VC_0828
  2. Phänotypische Assays zur Biotyp-Klassifikation über Spotting
    1. Bereiten Sie über Nacht Kultur in flüssiger LB Brühe vor, wie oben in Protokoll 2.2 angegeben.
    2. Waschen Sie das Zellpellet (s) gemäß Protokoll 2.6.
    3. Verwenden Sie eine Pipette zuSpritzen 1 & mgr; l gewaschene Kultur auf dem jeweiligen Medium. Für mittlere Auswahl- und Inkubationsangaben siehe Tabelle 2.
  3. Motilitätsassay
    1. Bereiten Sie über Nacht Kultur (en) in flüssiger LB-Brühe vor, wie zuvor in Protokoll 2.2 angegeben.
    2. Waschen Sie das Zellpellet (s) gemäß Protokoll 2.6.
    3. Inokulieren Sie Motilitäts-Agarplatten, indem Sie Inokulationsstab in die gewaschene Flüssigkeitskultur einfügen und "vertikal" in das Medium "stab". Zwischen jeder Inokulation sterilisieren Sie den Drahtstab mit einem Bunsenbrenner, und wenn Sie Agar stechen, stellen Sie sicher, dass sich der Impfstab nicht beugt, da dies die Ergebnisse verändern kann.
    4. Inkubieren Sie die Platten Deckel-Seite für 14 bis 24 h bei 37 ° C. Nach 14 h, überwachen Motilitätsplatten eng zu verhindern Überwachsen von Kulturen.
  4. Voges-Proskauer (VP) Assay
    1. Bereiten Sie über Nacht Kultur (en) in flüssiger LB-Brühe vor, wie zuvor in Protokoll 2.2 angegeben.
    2. Inokulieren 4Ml Methylrot Voges-Proskauer oder MR-VP-Brühe durch Pipettieren von 10 & mgr; l der zuvor hergestellten Übernachtkultur in 4 ml MR-VP-Brühe in einem sterilen Kulturrohr und Inkubieren mit Belüftung in einem Schüttel-Inkubator bei 225 U / min für 12 bis 16 H bei 37 ° C.
    3. Füge 150 μl 5% (w / v) α-Naphthol und 50 μl 40% (w / v) KOH zu 1 mL Aliquoten der MR-VP-Übernachtkultur in sterilen Kulturröhrchen hinzu.
    4. Kurz vorwirbeln und bei Raumtemperatur bis zu 4 h stehen lassen, bis sich Farbwechsel entwickelt.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Für die ordnungsgemäße Instandhaltung und Verwendung von Bakterienstämmen empfiehlt es sich, die Verdopplungszeit der betreffenden Stämme zu kennen. Hierbei sind die unterschiedlichen Wachstumsraten der üblichen V Cholerae-Stämme wurden durch eine Wachstumskurve nachgewiesen, und ungefähre Verdopplungszeiten wurden unter Verwendung einer linearen Regression berechnet. WT El Tor N16961 und El Tor Variante MQ1795 zeigten kürzere Verdopplungszeiten (~ 1 h bzw. ~ 1 h) als WT klassisch O395 (~ 2 h) (Abbildung 1 , Tabelle 2 ).

V. cholerae genetische Manipulation und anschließende Analyse beruht häufig auf der Fähigkeit, zwischen Biotypen richtig zu unterscheiden. PCR-basierte genetische Bildschirme und phänotypische Assays wurden gemeinsam als ein zuverlässiges System zur Unterscheidung zwischen Biotyp-Hintergründen von V implementiert. Cholerae klinisch und umweltfreundlichSolides; Zur Darstellung wurden Biotyp-Referenzstämme (WT-Klassik O395, WT El Tor C6706 und WT El Tor N16961) sowie repräsentative El Tor-Varianten (MQ1795 und BAA-2163) aufgenommen ( Tabelle 1 ). WT klassische O395 zeigten klassische ctxB- und tcpA- Sequenzen. Umgekehrt zeigten WT El Tor-Stämme N16961 und C6706 El Tor ctxB und tcpA- Sequenzen. Interessanterweise enthielten MQ1795 und BAA-2163 die klassische Biotyp- ctxB -Untereinheit, die mit O395 vergleichbar war, doch enthielten beide El-Tor-Varianten das tcpA, das den El-Tor-Biotyp-Hintergrund anzeigt ( Tabelle 1 ). WT-klassischer Biotyp-Stamm O395 zeigte eine Sensitivität gegenüber Polymyxin B, während WT El Tor Biotyp-Stämme (C6706 und N16961) Resistenz zeigten und ein Wachstum auf LB-Agarplatten zeigten, die mit Polymyxin B ergänzt wurden. Die repräsentativen El Tor-Variantenstämme (MQ1795 und BAA-2163) zeigten Ähnliche Resistenz gegenüber dem Antibiotikum gegenüber dem WT El Tor Biotyp StraIns (C6706 und N16961) (Abbildung 2 , Tabelle 2 ). WT-klassischer Biotyp-Stamm O395 wuchs nicht auf minimalen Citrat-Medien, während WT El Tor-Stämme (C6706 und N16961) in der Lage waren, Citrat als Kohlenstoffquelle zu verwenden und ein Wachstum auf minimalen Citrat-Medien zu zeigen. Repräsentative El Tor-Varianten-Biotyp-Stämme (MQ1795 und BAA-2163) zeigten ein vergleichbares Wachstum wie das der WT El Tor Biotyp-Stämme (C6706 und N16961) (Abbildung 3 , Tabelle 2 ). WT-klassischer Stamm O395 und WT El Tor-Stamm N16961 besitzen ein nicht-funktionelles HapR und zeigten daher keine HapR-regulierte Proteaseaktivität; WT-El-Tor-Stamm C6706 und repräsentative El-Tor-Varianten (MQ1795 und BAA-2163) werden als eine von der Stelle der Inokulation ausgehende Abstandszone abgeschieden (Abbildung 4 , Tabelle 2 ). WT klassischen Stamm O395 sekretiert nicht hämolytische Enzyme und war dafürE-γ-hämolytisch, während die WT-El-Tor-Biotyp-Stämme (C6706 und N16961) und die repräsentativen El Tor-Variantenstämme (MQ1795 und BAA-2163) hämolytische Enzyme absondern, die rote Blutzellen, die den Impfpunkt umgeben, vollständig lysieren und β-Hämolyse zeigen ( Abb 5 , Tabelle 2 ). Motilität variiert über und innerhalb von Biotyp-Stämmen; Der WT El Tor-Stamm N16961 und die El Tor-Varianten (MQ1795 und BAA-2163) zeigten jedoch eine Hypermotilität im Vergleich zu dem relativ weniger beweglichen WT-klassischen Stamm O395 und dem WT-El-Tor-Stamm C6706 (Abbildung 6 , Tabelle 2 ). WT-Klassik-Stamm O395 und repräsentative El-Tor-Varianten veränderten nicht Glukose, um Acetoin zu produzieren, während WT El Tor Biotyp-Stämme Acetoin als Nebenprodukt der Glukosefermentation produzierten, wie durch die Entwicklung einer tiefroten Farbe während des Voges-Proskauer-Assays ( Abb. 7 Tabelle 2 ).

Belastung CtxB- Gen TcpA Referenz
Basis 115 Basis 203 Biotyp Biotyp
O395 C C Klassisch Klassisch 8
C6706 T T El Tor El Tor 8
N16961 T T El Tor El Tor 8
MQ1795 C C Klassisch El Tor 13
BAA-2163 C C Klassisch El Tor 8

Tabelle 1: Biotypabhängige genetische Unterscheidungen von Vibrio cholerae Referenzstämme. In dieser Tabelle sind die DNA-Base- Änderungen und relativen Positionen in den Genen ctxB und tcpA dargestellt . WT klassischen O395 und WT El Tor Stämme N16961 und C6706 sind häufig verwendet Biotyp Referenzstämme. MQ1795 und BAA-2163 sind bekannt für El Tor Varianten.

Assay Anwendung Mittlere Auswahl Inkubation erwartete Ergebnisse
O395 C6706 N16961 MQ1795 BAA-2163
2.3) Wachstumskurve 27 Bestimmt die Verdopplungszeiten verschiedener V. cholerae-Stämme 1.2) Flüssigkeit LB Brühe Bis zu 30 h (37 ° C mit Belüftung) ~ 2 h ND * ~ 1 h ~ 1 h ND *
3.1) PCR-basierter Genetischer Bildschirm mit ctxB und tcpA 8 Unterscheidet zwischen klassischen und El Tor Biotype Hintergründe von ctxB N / A N / A Klassisch El Tor El Tor Klassisch Klassisch
Unterscheidet zwischen klassischen und El Tor Biotyp Hintergründe von tcpA N / A N / A Klassisch El Tor El Tor El Tor El Tor
3.2) Polymyxin B Widerstand 21 Empfindlichkeit gegenüber dem Antibiotikum Polymyxin B 1,5) LB-Agarplatten, ergänzt mit Polymyxin B 18 h (37 ° C) - + + + +
3.2) Citratstoffwechsel 22 Fähigkeit, Citrat als einzige Kohlenstoffquelle zu metabolisieren 1.6) Minimale Citrat-Mittel-Agarplatten 24 h (37 ° C) - + + + +
3.2) Caseinhydrolyse 23 HapR-regulierte Proteaseaktivität 1.7) Milch-Agarplatten 18 h (37 ° C) - - + + +
3.2) Hämolyse 23 Misst hämolytische Aktivität Blut-Agar-Platten 48 Stunden (37 ° C) Gamma Beta Beta Beta Beta
3.3) Motilität 23 Misst den Grad der Motilität 1.8) Motilitäts-Agarplatten 14-24 h (37 ° C) 10 mm 15 mm 21 mm 25 mm 29 mm
3.4) Voges-Proskauer 21 Misst Fähigkeit, glocose zu pflegen und Acetoin als Nebenprodukt zu produzieren 1.9) Liquid Voges-Proskauer Medium Bis 4 h (Raumtemperatur) - + + - -
Anmerkung: "ND *" bedeutet nicht bestimmt; "+" Bezeichnet ein positives Ergebnis; "-" bezeichnet ein negatives Ergebnis

Tabelle 2: Zusammenfassung der verwendeten genetischen und phänotypischen Assays Vibrio cholerae Biotyp Unterscheidung. Diese Tabelle fasst die verschiedenen genetischen und phänotypischen Assays, Anwendungen und erwarteten Ergebnisse zusammen, die zusammen verwendet werden, um zwischen klassischen und El Tor-Biotypen zu unterscheiden, die in dieser Studie verwendet werden. Protokollnummern und Verweise auf spezifische Protokolle sind in der Spalte Assay angegeben. "ND *" bedeutet nicht bestimmt; "+" Bezeichnet ein positives Ergebnis; "-" bezeichnet ein negatives Ergebnis.

Abbildung 1
Abbildung 1: V. Cholerae Growth Curve von WT Klassik O395, WT El Tor N16961 und El Tor Variant MQ1795. Die Wachstumsraten der Biotyp-Referenzstämme (WT klassischen O395 und WT El Tor N16961) und der repräsentativen El Tor Variant MQ1795, die in LB-Brühe mit Belüftung bei 37 ° C gezüchtet wurden, wurden durch Messung der OD 600 e analysiertSehr Stunde beginnend bei T 0 . Wachstumskurven wurden an 8 unabhängigen experimentellen Replikaten durchgeführt, wobei jedes Replikat ein unabhängiges Kultivierungsereignis für jede Studie darstellt. WT El Tor-Stamm N16961 und El Tor-Variante MQ1795 zeigten kürzere Verdopplungszeiten (~ 1 h bzw. ~ 1 h) relativ zum klassischen WT-Stamm O395 (~ 2 h), wie bei einer längeren Verdopplungszeit beobachtet. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Figur 2
Abbildung 2: Bestimmung der Polymyxin-B-Resistenz unter Verwendung von LB-Agar, ergänzt mit Polymyxin B. Die Resistenz gegenüber dem Peptid-Antibiotikum Polymyxin B wurde durch die Fähigkeit bestimmt, auf LB-Agar zu wachsen, ergänzt mit 50 IE / & mgr; l Polymyxin B. WT-klassischer Stamm O395 zeigte kein Wachstum auf Agar SupplMit Polymyxin B und wurde als empfindlich für das Antibiotikum. Während WT El Tor-Stämme (C6706 und N16961) und repräsentative El Tor-Varianten (MQ1795 und BAA-2163) ein Wachstum in Gegenwart des Antibiotikums zeigten und als resistent gegen Polymyxin B angesehen wurden. Die Platten wurden bei 37 ° C für 18 h inkubiert. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Abbildung 3
Abbildung 3: Messung des Citrat-Metabolismus unter Verwendung von minimalem Citrat-Medium. Die Fähigkeit, Citrat als einzige Kohlenstoffquelle zu verwenden, wurde durch die Fähigkeit des Isolats, auf minimalen Citratmedien zu wachsen, bestimmt. WT klassischer Stamm O395 wuchs nicht auf minimalen Citrat-Medien (negativ). Das Wachstum zeigte sich bei allen WT-El-Tor-Stämmen (C6706 und N16961) und dem repräsentativen ElTor-Varianten (MQ1795 und BAA-2163), die die Fähigkeit, Citrat als einzige Kohlenstoffquelle (positiv) zu nutzen, gezeigt haben. Die Platten wurden bei 37 ° C für 18 h inkubiert. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Abbildung 4
Abbildung 4: Messung der HapR-regulierten proteolytischen Casein-Hydrolyse unter Verwendung von Milch-Agar-Medien. Die Casein-Hydrolyse durch die HapR-regulierte Protease-Aktivität wurde durch eine visuelle Zone der Clearance um den Impfpunkt auf Milch-Agar bestimmt. Stämme, die ein nicht-funktionelles HapR, wie WT-klassischen Stamm O395 und WT El Tor-Stamm N16961, enthielten, erzeugten keine Zone des Abstands um den Impfpunkt ( hapr- negativ). WT El Tor Stammbaum C6706 und repräsentative El Tor Varianten (MQ1795 und BAA-2163) enthalten eine funktionelle HapR, die als unterschiedlich große Distanzzonen ( hapR- positiv) visualisiert werden kann. Die Platten wurden bei 37 ° C für 18 h inkubiert. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Abbildung 5
Abbildung 5: Messung der hämolytischen Aktivität unter Verwendung von Blut-Agar-Medien. Die hämolytische Aktivität wurde unter Verwendung von Agarplatten gemessen, die mit Schafblut ergänzt wurden. WT klassischer Stamm O395 seziert nicht Enzyme, die rote Blutkörperchen lysieren (γ-hämolytisch). Die WT-El-Tor-Stämme (N16961 und C6706) und die repräsentativen El-Tor-Varianten (MQ1795 und BAA-2163) sezernieren hämolytische Enzyme, was zu einer lichtdurchlässigen Distanzzone um den Impfpunkt (β-hämolytisch) führte. Die Platten wurden bei 37 ° C inkubiert° C für 48 h. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Abbildung 6
Abbildung 6: Bestimmung der Motilität mit Motility-Agar-Platten. Die Zone der Motilität wurde durch eine visuelle Farbveränderung des Salzes TTC, die von klar nach rot, wenn metabolisiert, was darauf hinweist, wo die Bakterien bewegt haben angezeigt. WT-Klassik-Stamm O395 (10 mm) und WT El Tor-Stamm C6706 (15 mm) zeigten eine minimale Beweglichkeit, während der El Tor-Stamm N16961 (21 mm) und repräsentative El Tor-Varianten (MQ1795 (25 mm) und BAA-2163 (29 mm) ) Zeigte Hypermotilität gegenüber O395 und C6706. Die Platten wurden bei 37 ° C für 18 h inkubiert. bitte klickenHier eine größere Version dieser Figur zu sehen.

Abbildung 7
Abbildung 7: Voges-Proskauer-Assay. Die Acetoinproduktion mittels Glucosefermentation wurde mit dem Voges-Proskauer-Assay bestimmt. WT-klassischer Stamm O395 und repräsentative El Tor-Varianten (MQ1795 und BAA-2163) erzeugten kein Acetoin als Ergebnis der Glukosefermentation (negativ). WT El Tor Stämme (N16961 und C6706) produzierten das Nebenprodukt Acetoin und können durch eine tiefrote Farbveränderung (positiv) visualisiert werden. Die Röhrchen wurden bei Raumtemperatur für 4 h inkubiert. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Von den über 200 identifizierten V. Cholerae Serogruppen, nur O1 und O139 haben epidemisches Potential. Die O1 Serogruppe kann in zwei Biotypen unterteilt werden: klassisch und El Tor. Allerdings sind Hybrid-Stämme, die als El Tor-Varianten 13 , 17 bezeichnet werden, entstanden, die den El-Tor-Biotyp-Hintergrund besitzen und klassische Merkmale 8 , 9 , 10 , 11 , 12 , 13 , 14 , 15 , 16 , 17 besitzen . Die in diesem Manuskript beschriebenen Protokolle sind darauf ausgelegt, den Ermittlern die Möglichkeit zu geben, verschiedene klinische und nicht-klinische Isolate von V. cholerae zu charakterisieren und / oder zu unterscheidenMulti-Assay-Identifikationssystem. Die Verwendung eines zuverlässigen Multi-Assay-Identifizierungssystems als Alternative ist eine Verbesserung gegenüber bisher etablierten Einzel-Assay-Identifizierungssystemen und arbeitsintensiven genetischen Bildschirmen. Alle genotypischen und phänotypischen Assays sollten WT klassischen Stamm O395 und WT El Tor Stämme C6706 und N16961 zum Vergleich enthalten ( Tabelle 1 ). Während die klassischen und El-Tor-Biotyp-Stämme als Referenz enthalten sind, können Isolate, wie MQ1795 und BAA-2163, die in unseren Studien enthalten sind, phänotypische Profile entweder aus dem Biotyp (Abbildung 2 , Abbildung 3 , Abbildung 4 , Abbildung 5 , Abbildung 6 , Abbildung 7 , Tabelle 2 ), die die Notwendigkeit einer Analyse von multiplen genotypischen und phänotypischen Merkmalen für eine zuverlässige Charakterisierung veranschaulicht. Alle Protokolle sollten aseptisch durchgeführt werdenLy 26 bei Raumtemperatur, wenn nicht anders angegeben. V. Cholerae ist ein Biosafety Level 2 (BSL-2) Pathogen, der der ätiologische Wirkstoff der potentiell tödlichen Magen-Darm-Cholera ist; Die ordnungsgemäße Handhabung und Entsorgung aller Materialien und Abfallprodukte muss nach institutionellen, örtlichen, staatlichen und bundesstaatlichen Vorschriften erzwungen werden.

Die Vorbereitung aller Medien und Reagenzien muss mit Hilfe von Reagenzien mit Reagenzien und Reinstwasser durchgeführt werden, die auf eine Mindestempfindlichkeit von 18 MΩ-cm deionisiert sind. Vor der Verarbeitung sollten die Medien vorbereitet und ausreichend trocken werden (1-2 Tage); Platten werden als ausreichend trocken angesehen, wenn keine Restflüssigkeit auf der Oberfläche des Agars vorhanden ist. Wegen des bewegten Bereichs und der Zonen des Abstandes um das Bakterienwachstum sollten Motilität und Milchplatten in großen Petrischalen (150 mm x 15 mm) bis zu 50 ml pro Platte hergestellt werden und können bis zu 1 Woche in Plastik gepackt werden , LiD-Seite unten bei 4 ºC. Zusätzlich kann die Agar-Konzentration der Motilitätsplatten angepasst werden, um die Motilität zu verlangsamen; Es wird jedoch nicht empfohlen, 3 g Agar pro 500 ml Lösung zu überschreiten, da dies die Gesamtmotilität erheblich verringern wird, so dass Unterschiede nicht beobachtbar sind. Alle anderen Plattenmedien sollten auf ca. 25 mL pro Platte in Standard-Petrischalen (100 mm x 15 mm) vorbereitet werden und können bis zu sechs Monate in Plastik gepackt werden, Deckelseite unten bei 4 ºC. Für die Herstellung von Polymyxin-B-Platten ist es wichtig, dass geschmolzene Medien nach dem Autoklavieren vor der Zugabe von Polymyxin B abkühlen lassen, da übermäßige Hitze Antibiotika abbauen kann. Polymyxin B-Platten können bis zu 3 Monate in Plastik gepackt werden, Deckel-Seite nach unten bei 4 ºC. Assays, die in diesem Manuskript diskutiert werden, erfordern einen Tag für ein einziges Koloniewachstum (12-16 h), einen zusätzlichen Tag für das Wachstum von Übernachtkulturen (12-16 h) und einen dritten Tag für Überlegungen von genotypischen (~ 4 h für chromosomale DNEine Isolierung und ~ 3 h für PCR) oder phänotypische Assays (18-48 h, Tabelle 2 ). Vor der biochemischen Analyse von phänotypischen Assays, die in diesem Manuskript beschrieben wurden, sollten Kulturen in 1x PBS gewaschen werden, um zu verhindern, dass Restkulturmedien-Verschleppung von Schiefegebnissen resultiert. Zusätzlich können Polymyxin B, Citrat, Proteaseaktivität, Hämolyse und Motilitätsassays gleichzeitig unter Verwendung einer einzigen gewaschenen Übernachtkultur inokuliert werden. Beim Auftragen von plattierten Medien kann es zu Spritzer von Kulturen kommen und kann zu einer Kreuzkontamination zwischen den Stämmen führen. Um Splatter zu vermeiden, vermeiden Sie die Ausübung der Kultur aus der Pipette, stattdessen stoppen Sie, die Kultur am ersten Anschlag der Pipette auszuwerfen. Darüber hinaus erlauben Flecken, vollständig in die Agar-Oberfläche vor der Inkubation zu absorbieren, und achten Sie darauf, nicht zu punktieren die Agar, die die Ergebnisse beeinflussen können. Phänotypische Assays, die zu Spielräumen führen (Abbildung 4 , Abbildung 5 , Tabelle 2) Und / oder Motilität ( Abb. 6 , Tabelle 2 ), die den Inokulationspunkt umgibt, sollte maximal beabstandet sein, um ein Verschmelzen von Flächen des Abstands bzw. Wachstums zu verhindern, bei denen die jeweiligen Durchmesser für eine Vergleichsanalyse gemessen werden können. Nach angezeigten Inkubationszeiten können Isolate in Bezug auf die Biotyp-Referenzstämme (WT klassisch O395, WT El Tor C6706 und WT El Tor N16961) abgebildet und analysiert werden.

Die in diesem Manuskript skizzierten PCR-basierten genetischen Bildschirme durch Sequenzierung können verwendet werden, um den Biotyp-Hintergrund des Isolats in Bezug auf ctxB und tcpA nach der anfänglichen PCR-Amplifikation zu identifizieren. Standard-Sequenzierungsrichtlinien erfordern eine bestimmte Menge an PCR-Produkt in Abhängigkeit von der Größe des amplifizierten Bereichs (580 bp für ctxB und 1420 bp für tcpA ), und für die Aufstellung der Reaktionen können etablierte Protokolle verfolgt werden. Kurz, individuell vorwärts und rEverse Sequenzierungsreaktionen sollten mit 3-5 pmol Primer / Reaktion hergestellt werden, und das Volumen sollte auf 20 μl mit sterilem Reinstwasser in einem 1,5 mL Mikrozentrifugenröhrchen eingestellt werden. Für die Hilfe bei der Primer-Konstruktion sowohl für die PCR-Amplifikation als auch für die Sequenzierung kann das NCBI-Primer-Design-Tool http://www.ncbi.nlm.nih.gov/tools/primer-blast/ verwendet werden. Eine erfolgreiche Amplifikation und Sequenzierung von ctxB und TCPA wurde unter Verwendung der folgenden Primer durchgeführt (5 '→ 3'): ctxB- vorwärts GGGAATGCTCCAAGATCATCGATGAGTAATAC, ctxB -Reverse CATCATCGAACCACAAAAAAGCTTACTGAGG, TCPA -forward CCGCACCAGATCCACGTAGGTGGG, TCPA -Reverse GTCGGTACATCACCTGCTGTGGGGGCAG. Es ist anzumerken, dass die gesamte codierende Region von ctxB über beide Biotypen mit Ausnahme der Basenpositionen 115 und 203 (sowohl Cytosin in Klassik als auch Thymin in El Tor) konserviert ist. Zusätzlich werden in tcpA mehrere Basenänderungen unter den Biotypen konserviert, die dIffer über die beiden Biotypen ( Tabelle 1 ), die zur Unterscheidung zwischen Biotypen verwendet werden können.

In vielen Laborstudien mit dem Modellorganismus V. Cholerae, ordnungsgemäße Instandhaltungs- und Kultivierungstechniken sind kritisch 27 . Die Wachstumsraten der häufig verwendeten V. Cholerae-Biotyp-Referenzstämme, wie der WT-Klassische Stamm O395 und der WT El Tor-Stamm N16961, können einen nützlichen Einblick in die Charakterisierung von El Tor-Variantenisolaten liefern (Abbildung 1 , Tabelle 2 ). Wegen der unterschiedlichen Wachstumsraten über V. Cholerae-Isolate ist es wichtig, die Spektrophotometer-Absorptionswerte jede Stunde zu nehmen, bis die Kulturen in der späten stationären Phase maximale Trübung erreichen. Die nachträgliche Todesphase kann aufgrund eines Plateaus in Trübungen, die sich aus überschüssigen Zelltrümmern ergeben, nicht sichtbar gemacht werden. Eine 1: 4-Verdünnung der Kultur zu sterilem L B Brühe sollte durchgeführt werden, um eine vollständige Wachstumskurve zu erhalten und die Präzision des Instruments beizubehalten, da die Absorptionswerte bei einer OD 600 ≈ 1,0 liegen. Bei der Durchführung von Wachstumskurven bei mehreren Stämmen sollten die Absorptionswerte für jeden Stamm etwa 5 Minuten voneinander entfernt sein, um die Konsistenz zwischen den Messungen zu gewährleisten. Verständnis V. Cholerae Biotyp Wachstumsraten sind entscheidend für viele Untersuchungen, einschließlich Virulenz Genexpressionsstudien, Analyse von metabolischen Aktivitäten und richtige Kultivierung und Lagerbedingungen. Für die anschließende Analyse sollten über Nachtkulturen im späten Protokoll bis zur frühen stationären Phase des Wachstums (12-16 h) verarbeitet werden, um das Zellwachstum zu maximieren und gleichzeitig die zelluläre Integrität aufrechtzuerhalten.

Die Kultivierungsbedingungen für klassische und El Tor-Biotypstämme sind jedoch ähnlich, jedoch die Analyse der Virulenzgenexpression in V. Cholerae erfordert biotypspezifische virulenzinduzierende ZuständeRef "> 19. Die beiden Hauptvirulenzfaktoren CT und TCP werden vom Masterregler ToxT kontrolliert und werden unter bestimmten Wachstumsbedingungen optimal exprimiert, z. B. unter El Tor-Virulenz-induzierenden Zuständen kann ToxT durch die Verarbeitung von Ganzzell-Extrakt ( WCE) oder das Zellpellet um 3,5 h, während die CT- und TCP-Expression durch Verarbeiten des zellfreien Überstandes und der WCE bei 7,5 h bzw. 8 , 20 analysiert werden kann . Die unterschiedlichen genotypischen und phänotypischen Merkmale, die in diesem Manuskript gezeigt werden, zeigen, wie Diverse V. Cholerae-Biotypen können und veranschaulichen die Notwendigkeit einer Alternative zur bisher verwendeten Single-Assay-Biotyp-Charakterisierung.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts zu offenbaren.

Acknowledgements

Forschung unterstützt von New Hampshire-INBRE durch einen Institutional Development Award (IDeA), P20GM103506, vom Nationalen Institut für Allgemeine Medizinische Wissenschaften des NIH.

Materials

Name Company Catalog Number Comments
1 kb DNA Ladder New England Biolabs N3232S https://www.neb.com/products/n3232-1-kb-dna-ladder
60% Glycerol Calbiochem 356352 http://www.emdmillipore.com/US/en/product/Glycerol%2C-Molecular-Biology-Grade---CAS-56-81-5---Calbiochem,EMD_BIO-356352
Agar Becto, Dickinson and Co. 214030 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=214030&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D214030%26typeOfSearch%3DproductSearch
Agar with brain-heart infusion Becto, Dickinson and Co. 237500 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=237500&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D237500%26typeOfSearch%3DproductSearch
Agarose Peqlab 732-2789 https://de.vwr.com/store/catalog/product.jsp?catalog_number=732-2789&_DARGS=/store/cms/de.vwr.com/de_DE/header_2016111711383215.jsp_AF&_dynSessConf=1766917479792147141&targetURL=/store/catalog/product.jsp%3Fcatalog_number%3D732-2789&lastLanguage=en&/vwr/userprofiling/EditPersonalInfoFormHandler.updateLocale=&_D%3AcurrentLanguage=+&currentLanguage=en&_D%3AlastLanguage=+&_D%3A/vwr/userprofiling/EditPersonalInfoFormHandler.updateLocale=+
Anhydrous K2HPO4 Fisher Scientific P288-500 https://www.fishersci.com/shop/products/potassium-phosphate-dibasic-anhydrous-crystalline-powder-certified-acs-fisher-chemical-5/p288500?searchHijack=true&searchTerm=P288500&searchType=RAPID
Blood Agar Plates Remel R01200 Store at 4 °C;  http://www.remel.com/Catalog/Item.aspx?name=Blood+Agar
Boric Acid Fisher Scientific A73-500 https://www.fishersci.com/shop/products/boric-acid-crystalline-certified-acs-fisher-chemical-6/a73500?searchHijack=true&searchTerm=A73500&searchType=RAPID
Bromothymol Blue Fisher Scientific B388-10 https://www.fishersci.com/shop/products/bromothymol-blue-certified-acs-fisher-chemical/b38810?searchHijack=true&searchTerm=B38810&searchType=RAPID
Cirtric acid ·H2O Fisher Scientific S72836-3 https://www.fishersci.com/shop/products/citric-acid-monohydrate-4/s728363#?keyword=s728363
Deoxynucleotide (dNTP) Solution Kit New England Biolabs N0446S Store at -20 °C;  https://www.neb.com/products/n0446-deoxynucleotide-solutionset
Disodium EDTA Fisher Scientific S311-500 https://www.fishersci.com/shop/products/ethylenediaminetetraacetic-acid-disodium-salt-dihydrate-crystalline-certified-acs-fisher-chemical-7/s311500?searchHijack=true&searchTerm=S311500&searchType=RAPID
DNA Clean & Concentrator™ -25 Kit Zymo Research D4007 http://www.zymoresearch.com/dna/dna-clean-up/zymoclean-gel-dna-recovery-kit
GelGreen Nucleic Acid Stain Biotium 41005 https://biotium.com/product/gelgreentm-nucleic-acid-gel-stain-10,000x-in-water/
Genesys 10SUV-VIS Spectrophotometer Thermo Scientific 840-208100 https://www.thermofisher.com/order/catalog/product/840-208100?ICID=search-840-208100
Gentra Puregene Yeast/Bact. Kit Qiagen 158567 https://www.qiagen.com/us/shop/sample-technologies/dna/dna-preparation/gentra-puregene-yeastbact-kit/#orderinginformation
HCl Fisher Scientific A144-212 Corrosive;  https://www.fishersci.com/shop/products/hydrochloric-acid-certified-acs-plus-fisher-chemical-10/a144212?searchHijack=true&searchTerm=A144212&searchType=RAPID
KCl Fisher Scientific P217-500 https://www.fishersci.com/shop/products/potassium-chloride-crystalline-certified-acs-fisher-chemical-4/p217500?searchHijack=true&searchTerm=P217500&searchType=RAPID
KH2PO4 Fisher Scientific P285-500 https://www.fishersci.com/shop/products/potassium-phosphate-monobasic-crystalline-certified-acs-fisher-chemical-5/p285500?searchHijack=true&searchTerm=P285500&searchType=RAPID
KOH Fisher Scientific P250-500 https://www.fishersci.com/shop/products/potassium-hydroxide-pellets-certified-acs-fisher-chemical-5/p250500?searchHijack=true&searchTerm=P250500&searchType=RAPID
Le Loop Decon Labs Inc. MP190-25 http://deconlabs.com/products/leloop/
Le Stab Decon Labs Inc. MP186-5 http://deconlabs.com/products/lestab/
MgSO4·7H2O Fisher Scientific M63-500 https://www.fishersci.com/shop/products/magnesium-sulfate-heptahydrate-crystalline-certified-acs-fisher-chemical-3/m63500?searchHijack=true&searchTerm=M63500&searchType=RAPID
Mini-Sub Cell GT Horizontal Electrophoresis System Bio Rad Labs 1704406 http://www.bio-rad.com/en-us/product/mini-sub-cell-gt-cell?WT.srch=1&WT.mc_id=aw-cbb-NA-sub_cell_systems_brand_gold&WT.knsh_id=7eb1981f-a011-42a3-aece-1236ff453373
MR-VP Broth Difco 216300 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=216300&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3Dmr-vp%2Bmedium%26typeOfSearch%3DproductSearch
Na2HPO4 Fisher Scientific S374-500 https://www.fishersci.com/shop/products/sodium-phosphate-dibasic-anhydrous-granular-powder-certified-acs-fisher-chemical-5/s374500?searchHijack=true&searchTerm=S374500&searchType=RAPID
NaCl Fisher Scientific S271-10 https://www.fishersci.com/shop/products/sodium-chloride-crystalline-certified-acs-fisher-chemical-6/s27110?searchHijack=true&searchTerm=S27110&searchType=RAPID
NaHCO3 Fisher Scientific S233-500 https://www.fishersci.com/shop/products/sodium-bicarbonate-powder-certified-acs-fisher-chemical-5/s233500?searchHijack=true&searchTerm=S233500&searchType=RAPID
NaNH4HPO4·4H2O Fisher Scientific S218-500 https://www.fishersci.com/shop/products/sodium-ammonium-phosphate-tetrahydrate-crystalline-certified-fisher-chemical/s218500?searchHijack=true&searchTerm=S218500&searchType=RAPID
NanoDrop Lite Spectrophtometer Thermo Scientific ND-LITE-PR https://www.thermofisher.com/order/catalog/product/ND-LITE-PR?ICID=search-ND-LITE-PR
Nonfat dry milk Nestle Carnation N/A N/A
Peptone Becto, Dickinson and Co. 211677 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=211677&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D211677%26typeOfSearch%3DproductSearch
Petri Dishes (100 mm x 15 mm) Fisher Scientific FB0875712 https://www.fishersci.com/shop/products/fisherbrand-petri-dishes-clear-lid-12/fb0875712#?keyword=FB0875712
Petri Dishes (150 mm x 15 mm) Fisher Scientific FB0875714 https://www.fishersci.com/shop/products/fisherbrand-petri-dishes-clear-lid-12/fb0875714?searchHijack=true&searchTerm=FB0875714&searchType=RAPID
Polymyxin B sulfate salt Sigma-Aldrich P1004-10MU Store at 2-4 °C; http://www.sigmaaldrich.com/catalog/product/sial/p1004?lang=en&region=US
Taq DNA Polymerase New England Biolabs M0273S Store at -20 °C; https://www.neb.com/products/m0273-taq-dna-polymerase-with-standard-taq-buffer
Taq Reaction Buffer New England Biolabs M0273S Store at -20 °C;  https://www.neb.com/products/m0273-taq-dna-polymerase-with-standard-taq-buffer
Thermal Cycler Bio-Rad C1000 Touch™  Bio Rad Labs 1840148 http://www.bio-rad.com/evportal/evolutionPortal.portal?_nfpb=true&_pageLabel=search_page&sfMode=search&sfStartNumber=1&clearQR=true&js=1&searchString=1840148&database=productskus+productcategories+productdetails+abdProductDetails+msds+literatures+inserts+faqs+downloads+webpages+assays+genes+pathways+plates+promotions&tabName=DIVISIONNAME
Triphenyltetrazolium chloride Alfa Aesar A10870 https://www.alfa.com/en/catalog/A10870/
Tris Base Fisher Scientific BP152-1 https://www.fishersci.com/shop/products/tris-base-white-crystals-crystalline-powder-molecular-biology-fisher-bioreagents-7/bp1521?searchHijack=true&searchTerm=BP1521&searchType=RAPID
Tryptone Becto, Dickinson and Co. 211705 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=211705&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D211705%26typeOfSearch%3DproductSearch
Yeast Extract Becto, Dickinson and Co. 212750 http://catalog.bd.com/nexus-ecat/getProductDetail?productId=212750&parentCategory=&parentCategoryName=&categoryId=&categoryName=&searchUrl=%2FsearchResults%3Fkeyword%3D212750%26typeOfSearch%3DproductSearch
α-napthol MP Biomedicals 204189 http://www.mpbio.com/product.php?pid=05204189

DOWNLOAD MATERIALS LIST

References

  1. Shimada, T., et al. Extended serotyping scheme for Vibrio cholerae. Curr. Microbiol. 28, (3), 175-178 (1994).
  2. Yamai, S., Tadayuki, O., Toshio, S., Yasuji, K. Distribution of serogroups of Vibrio cholerae non-O1 non-O139 with specific reference to their ability to produce cholera toxin, and addition of novel serogroups. Jpn. J. Infect. Dis. 71, (10), 1037-1045 (1997).
  3. Karaolis, D. K., Lan, R., Reeves, P. R. The sixth and seventh cholera pandemics are due to independent clones separately derived from environmental, nontoxigenic, non-O1 Vibrio cholerae. J. Bacteriol. 177, (11), 3191-3198 (1995).
  4. Albert, M. J., et al. Large epidemic of cholera-like disease in Bangladesh caused by Vibrio cholerae O139 synonym Bengal. Lancet. 342, (8868), 387 (1993).
  5. Barua, D. History of Cholera. Cholera. Barua, D., Greenough III, W. B. Plenum Publishing Corporation. 1-36 (1992).
  6. Morales, R., Delgado, G., Cravioto, A. Population Genetics of Vibrio cholerae. Vibrio cholerae-Genomics and Molecular Biology. Faruque, S. M., Nair, G. B. Caister Academic Press. 29-47 (2008).
  7. Samadi, A. R., Chowdhury, M. K., Huq, M. K., Khan, M. U. Seasonality of classical and El Tor cholera in Dhaka, Bangladesh: 17-year trends. Trans. R. Soc. Trop. Med. Hyg. 77, (6), 853-856 (1983).
  8. Son, M. S., Megli, C. J., Kovacikova, G., Qadri, F., Taylor, R. K. Characterization of Vibrio cholerae O1 El Tor biotype variant clinical isolates from Bangladesh and Haiti, including a molecular genetic analysis of virulence genes. J. Clin. Microbiol. 49, (11), 3739-3749 (2011).
  9. Ghosh-Banerjee, J., et al. Cholera toxin production by the El Tor variant of Vibrio cholerae O1 compared to prototype El Tor and classical biotypes. J. Clin. Microbiol. 48, (11), 4283-4286 (2010).
  10. Ansaruzzaman, M., et al. The Mozambique cholera vaccine demonstration project coordination group. Cholera in Mozambique, variant of Vibrio cholerae. Emerg. Infect. Dis. 10, (11), 2057-2059 (2004).
  11. Ansaruzzaman, M., et al. Genetic diversity of El Tor strains of Vibrio cholerae O1 with hybrid traits isolated from Bangladesh and Mozambique. Int. J. Med. Microbiol. 297, (6), 443-449 (2007).
  12. Lan, R., Reeves, P. R. Pandemic spread of cholera: genetic diversity and relationships within the seventh pandemic clone of Vibrio cholerae determined by amplified fragment length polymorphism. J. Clin. Microbiol. 40, (1), 172-181 (2002).
  13. Nair, G. B., Faruque, S. M., Bhuiyan, N. A., Kamruzzaman, M., Siddique, A. K., Sack, D. A. New variants of Vibrio cholerae O1 biotype El Tor with attributes of the classical biotype from hospitalized patients with acute diarrhea in Bangladesh. J. Clin. Microbiol. 40, (9), 3296-3299 (2002).
  14. Nair, G. B., et al. Isolation of Vibrio cholerae O1 strains similar to pre-seventh pandemic El Tor strains during an outbreak of gastrointestinal disease in an island resort in Fiji. J. Med. Microbiol. 55, (11), 1559-1562 (2006).
  15. Nair, G. B., Mukhopadhyay, A. K., Safa, A., Takeda, Y. Emerging hybrid variants of Vibrio cholerae O1. Vibrio cholerae—Genomics and Molecular Biology. Faruque, S. M., Nair, G. B. Horizon Scientific Press. 179-190 (2008).
  16. Safa, A., et al. Genetic characteristics of Matlab variants of Vibrio cholerae O1 that are hybrids between classical and El Tor biotypes. J. Med. Microbiol. 55, (11), 1563-1569 (2006).
  17. Nusrin, S., et al. Diverse CTX phages among toxigenic Vibrio cholerae O1 and O139 strains isolated between 1994 and 2002 in an area where cholera is endemic. J. Clin. Microbiol. 42, (12), 5854-5856 (2004).
  18. Carignan, B. M., Brumfield, K. D., Son, M. S. Single nucleotide polymorphisms in regulator-encoding genes have an additive effect on virulence gene expression in a Vibrio cholerae clinical isolate. mSphere. 1, (5), e00253 (2016).
  19. Iwanaga, M., Yamamoto, K., Higa, N., Ichinose, Y., Nakasone, N., Tanabe, M. Culture conditions for stimulating cholera toxin production by Vibrio cholerae O1 El Tor. Microbiol. Immunol. 30, (11), 1075-1083 (1986).
  20. DiRita, V. J., Claude, P., Georg, J., Mekalanos, J. J. Regulatory cascade controls virulence in Vibrio cholerae. Proc. Natl. Acad. Sci. USA. 88, (12), 5403-5407 (1991).
  21. Kovacikova, G., Lin, W., Skorupski, K. Duel regulation of genes involved in acetoin biosynthesis and motility/biofilm formation by the virulence activator AphA and the acetate-responsive Lys-R type regulator AlsR in Vibrio cholerae. Mol. Microbiol. 57, (2), 420-433 (2005).
  22. Vogel, H. J., Bonner, D. M. Acetylornithinase of Escherechia coli: partial purification and some properties. J. Biol. Chem. 218, (1), 97-106 (1956).
  23. Son, M. S., Taylor, R. K. Genetic screens and biochemical assays to characterize Vibrio cholerae O1 biotypes: classical and El Tor. Curr. Protoc. Microbiol. 6A.2.1-6A.2.17 (2011).
  24. Kovacikova, G., Skorupski, K. Regulation of virulence gene expression in Vibrio cholerae by quorum sensing: HapR functions at the aphA promoter. Mol. Microbiol. 46, (4), 1135-1147 (2002).
  25. Wang, Y., et al. The prevalence of functional quorum-sensing systems in recently emerged Vibrio cholerae toxigenic strains. Environ. Microbiol. Rep. 3, (2), 218-222 (2011).
  26. Sanders, E. R. Aseptic laboratory techniques. J. Vis. Exp. (63), e3064 (2012).
  27. Martinez, R. M., Megli, C. J., Taylor, R. K. Growth and laboratory maintenance of Vibrio cholerae. Curr. Protoc. 6A.1.1-6A.1.6 (2010).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics