Generatie van genetisch gemodificeerde muizen via de microinjectie van oocyten

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

De microinjectie van muis oocyten wordt vaak gebruikt voor zowel klassieke transgenese ( dwz de willekeurige integratie van transgenen) en CRISPR-gemedieerde gen targeting. Dit protocol beoordeelt de nieuwste ontwikkelingen in microinjectie, met speciale nadruk op kwaliteitscontrole en genotyping strategieën.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Delerue, F., Ittner, L. M. Generation of Genetically Modified Mice through the Microinjection of Oocytes. J. Vis. Exp. (124), e55765, doi:10.3791/55765 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Het gebruik van genetisch gemodificeerde muizen heeft significant bijgedragen tot studies op zowel fysiologische als pathologische in vivo processen. De pronucleaire injectie van DNA-expressieconstructen in bevruchte oocyten blijft de meest gebruikte techniek om transgene muizen te genereren voor overexpressie. Met de introductie van CRISPR technologie voor gen targeting, is pronucleaire injectie in bevruchte oocyten uitgebreid tot de generatie van zowel knock-out en knockin muizen. Dit werk beschrijft de voorbereiding van DNA voor injectie en het genereren van CRISPR-gidsen voor gen targeting, met bijzondere nadruk op kwaliteitscontrole. De genotyperingsprocedures die nodig zijn voor de identificatie van potentiële oprichters zijn kritisch. Innovatieve genotyping strategieën die gebruik maken van de "multiplexing" mogelijkheden van CRISPR worden hierin gepresenteerd. Chirurgische procedures worden ook beschreven. Samen zullen de stappen van het protocol het genereren van gen mogelijk makenEtisch gemodificeerde muizen en voor de daaropvolgende vestiging van muiskolonies voor een overvloed aan onderzoeksvelden, waaronder immunologie, neurowetenschappen, kanker, fysiologie, ontwikkeling en anderen.

Introduction

Diermodellen, zowel bij gewervelde dieren als in ongewervelden, hebben bijgedragen tot het onderzoek naar de pathofysiologie van menselijke aandoeningen, zoals de ziekte van Alzheimer 1 , 2 . Ze zijn ook waardevolle hulpmiddelen om te zoeken naar ziekteveranderende middelen en uiteindelijk nieuwe behandelstrategieën te ontwikkelen in de hoop op een genezing. Hoewel elk model intrinsieke beperkingen heeft, is het gebruik van dieren als gehele systemische modellen van vitaal belang voor biomedisch onderzoek. Dit komt doordat de metabolische en complexe fysiologische omgeving niet volledig in de weefselkweek kan worden gesimuleerd.

Tot op heden blijft de muis de meest voorkomende zoogdiersoort die wordt gebruikt voor genetische manipulatie omdat het meerdere voordelen heeft. De fysiologische processen en genen die verband houden met ziekten worden sterk bewaard tussen muizen en mensen. De muis was het eerste zoogdier om zijn volledige genoom sequenced (2002) te hebben, een jaar voor het menselijk genoMij ​​(2003). Naast deze rijkdom genetische informatie heeft de muis goede fokcapaciteiten, een snelle ontwikkelcyclus (6 weken van bevruchting tot speen) en een redelijke omvang. Al deze voordelen, in combinatie met fysiologische indicatoren, zoals onderscheidende coat kleuren (vereist voor het oversteken van strategieën), maakte de muis een aantrekkelijk model voor genetische manipulatie. Met name in de vroege tijd van de moderne genetica begon Gregor Mendel met muizen te werken voordat ze naar planten 3 gaan .

Gene transfer technieken resulteerden in de generatie van de eerste transgene muis over drie decennia geleden 4 , oorspronkelijk gemaakt met behulp van virale levering. Echter, onderzoekers realiseerden snel dat een van de belangrijkste uitdagingen van de muis transgenese het onvermogen was om het lot van het exogene DNA te controleren. Omdat de virale afgifte van transgenen in muis-oocyten resulteerde in meerdere kopieën willekeurig geïntegreerd in het genoom, de mogelijkheidY van het opstellen van de volgende transgene lijnen was beperkt.

Een dergelijke beperking werd overwonnen toen Gordon et al. Genereerde de eerste transgene muislijn door microinjectie 5 , 6 . Dit begon het tijdperk van recombinante DNA technologie, en de parameters die het resultaat van een microinjectiesessie beïnvloeden zijn in grote mate bestudeerd 7 . Hoewel microinjectie geen controle biedt op de integratieplaats van het transgeen (dat uiteindelijk resulteert in specifieke expressieniveaus voor elke oprichtermuis), blijft het voornaamste voordeel van pronucleaire microinjectie de vorming van concatemers ( dat wil zeggen arrays van meerdere kopieën van het transgene, Gekoppeld in serie) voor genomische integratie 5 . Dit kenmerk is door de jaren heen gebruikt om duizenden transgene muislijnen te vormen die een gen van belang uitdrukken. Sindsdien is transgenese, de aRtmatige modificatie van het genoom van een organisme, is uitgebreid gebruikt om de rol van enkele genen bij het optreden van ziekten te identificeren.

Een verdere belangrijke prestatie bij het manipuleren van het muisgenoom werd bereikt toen Mario Capecchi succesvol een enkel gen in de muis ontwricht, waardoor het tijdperk van gen targeting 8 werd geopend. Echter, grote nadeel kwam snel uit ES-cel gebaseerde gen targeting, met inbegrip van de uitdagingen van het cultiveren van ES cellen, de ietwat variabele mate van chimerisme en de lengte van het proces ( dat wil zeggen 12-18 maanden, minimum, om de muis te verkrijgen) .

Onlangs zijn vooruitgang geboekt in nieuwe technologieën, zoals geanimeerde endonucleasen (bijvoorbeeld zinkvinger nucleasen (ZFN), transcriptie activator-achtige effector nucleasen (TALEN) en clusterde regelmatige interspaced korte palindromische herhalingen (CRISPR / Cas9)) Versnellen het proces van gen targeting in micE 9 , 10 . Deze endonucleasen kunnen gemakkelijk worden geïnjecteerd in muis-oocyten door microinjectie, waardoor de generatie van gen-gerichte muizen in zo weinig als 6 weken mogelijk wordt.

Sinds het eerste rapport over het gebruik van CRISPR voor genoombewerking 11 , heeft dit bacteriële adaptieve immuunsysteem ZFN en TALEN vervangen door zijn vele voordelen, waaronder het gemak van de synthese en het vermogen om meerdere loci tegelijk te richten (aangeduid als "multiplexing "). CRISPR werd voor het eerst gebruikt voor gen targeting in muizen 12 en is sindsdien toegepast op ontelbare soorten, van planten tot mensen 13 , 14 . Tot op heden is er geen rapport van een enkele soort resistent tegen CRISPR genoom bewerking.

De twee hoofdbeperkende stappen van de generatie transgene muizen zijn de injectie van oocyten en de reimplantatieVan deze oocyten in pseudo-zwangere vrouwtjes. Hoewel deze techniek is beschreven door ons 15 en anderen 16 , hebben de recente technische verbeteringen in de muisembryologie en genoverdrachtstechnieken het proces om genetisch gemodificeerde muizen te generen, omgezet. Deze verbeteringen zullen hierin beschreven worden.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alle procedures zijn goedgekeurd door de University of New South Wales Animal Care and Ethics Committee.

1. Bereiding van het transgeen (willekeurige integratie)

  1. Analytische agarosegel-elektroforese.
    1. Digest het plasmide om het transgen te accentueren door gebruik te maken van geschikte enzymen (1 u incubatie) of snel verteerbare enzymen (15 tot 30 min incubatie) in een thermocycler volgens de aanbevelingen van de fabrikant (zie figuur 2A en zijn legende).
    2. Giet een 1% tris-acetaat-ethylendiaminetetraazijnzuur (EDTA) (TEA) agarosegel, gekleurd met 0,5-1,0 μg / ml ethidiumbromide (EtBr).
      OPMERKING: Wees voorzichtig bij het gebruik van EtBr; Het is een krachtige mutage. Gebruik geschikte persoonlijke beschermende uitrusting (raadpleeg het veiligheidsinformatieblad).
    3. Laad een 1 kb molecuulgewicht aan.
    4. Laad de gelineariseerde fragmenten ( dwz transgen en ruggengraat). Doe de elektroforese bij 100 V gedurende 45 minuten.
    5. Visualiseer de gel op een ultraviolette (UV) transilluminator om te controleren of de spijsvertering volledig is en om de juiste grootte van het transgen te bevestigen ( dwz 7.333 bp, zie figuur 2A ).
  2. Preparatieve agarosegel-elektroforese.
    1. Giet een 1% TAE-agarosegel, gekleurd met een laag-toxiciteitsgelvlek. Laad 8 porties (1 μg elk) gelineariseerd transgeen zonder een molecuulgewichtmarkering en voer de elektroforese bij 100 V gedurende 45 minuten. Gebruik een scalpel om alle 8 bands die overeenkomen met het gelineariseerde transgen, te accijnzen.
    2. Extract het DNA met behulp van een gel extractie kit door de aanbevelingen van de fabrikant te volgen (zie de tabel van materialen ).
      1. Smelt de gelfragmenten gedurende minstens 15 minuten bij 50 ° C in 1,5 ml buizen. Precipiteer het met isopropanol en voeg vervolgens de bindingsbuffer toe.
      2. Combineer de hele DNA door het allemaal in één kolom te pipetteren. Uitsluiten in nuclease-vrije microinjectiebuffer (8 mM Tris-HCl en 0,15 mM EDTA). Filter door een 0,22 μm microcentrifugefilter en centrifuge gedurende 60 s bij 12.000 x g.
    3. Meet de concentratie en de kwaliteit van het DNA met behulp van een spectrofotometer. Controleer of de A260 / A280-verhouding ongeveer 1,8 bedraagt ​​( dat wil zeggen geen contaminatie door eiwitten) en de A260 / A230 verhouding is ten minste 2,0 ( dus geen verontreiniging door organische oplosmiddelen). Verdun tot 3 ng / μL in nuclease-vrije microinjectiebuffer, aliquot (20-50 μl) en vries bij -20 ° C.

2. Synthese van CRISPR Components (Gene Targeting)

  1. Cas9 mRNA.
    1. Verdun het Cas9 mRNA (verkregen uit een commerciële bron, zie de Tabel van Materialen ) tot een concentratie van 1 μg / μL in nuclease-vrije microinjectiebuffer.
    2. Aliquot in 2 μL en gratis Ze bij -80 ° C.
  2. Single-guide RNA (SgRNA).
    1. Identificeer de gewenste twee-target genomische sequenties (gidsen) met behulp van een computergebruikswerktuig waardoor minimaal potentiële off-target-activiteit 17 mogelijk is .
      1. Voor genknock-out selecteer systematisch twee gidsen die een paar honderd base-pairs (bp) bevinden, in tegengestelde richtingen, en omvat het startcodon van het gen van belang. Voor homologie directe reparatie, selecteer twee overlappende gidsen (indien mogelijk), in tegengestelde richtingen.
        OPMERKING: Bijvoorbeeld, de volgende handleidingen zijn recentelijk succesvol gecojecteerd om de eerste exon van het TPM4.2 gen te verstoren :
        Gids 1: 5 'CGCCATCCAGTTCGCGCTGC 3';
        Gids 2: 5 'CAGAACGATTGAGCTATGGC 3'
    2. Bestel een reeks primers zoals beschreven in Tabel 1 .
    3. Synthese een lineaire DNA-sjabloon.
      1. Verdun px330Ref "> 12 plasmide tot 10 ng / μl in nuclease-vrij water.
      2. Bereid de master mix zoals aangegeven in Tabel 1 . Voeg het polymerase aan het einde toe en hou de meermix op ijs.
      3. Meng en verdeel dit in 8 PCR buizen (19 μL / buis). Voeg 1 μL px330 per buis toe en voer de PCR onder de volgende omstandigheden: 1 min bij 98 ° C; 40 cycli van 98 ° C gedurende 10 s, 64 ° C gedurende 30 s en 72 ° C gedurende 15 s; En een laatste verlenging bij 72 ° C gedurende 5 minuten. Houd bij 4 ° C.
      4. Reinig de PCR-producten met een PCR-zuiveringsset (zie de Tabel van Materialen ), een verdeelstuk en een vacuümbron (voor snellere verwerking). Breng de maximale vacuümsterkte ( dwz 8 mbar) aan.
        1. Voeg 5 volumes (100 μl) bindingsbuffer toe aan 1 volume van het PCR-monster en meng.
        2. Plaats een (voorziene) siliciumdioxide membraan spin kolom in een (voorziene) 2 ml collectibuis voor centrifugering, of op de manifold voor vacuümprocesing. Om DNA te binden, past alle 8 monsters achtereenvolgens toe op de kolom en vacuüm of centrifugeer gedurende 60 s bij 12.000 xg voor elke lading.
        3. Om te wassen, voeg 0,75 ml wasbuffer (buffer PE) toe aan de kolom en vacuüm of centrifuge gedurende 60 s bij 12.000 x g. Centrifugeer de kolom gedurende 60 s bij 12.000 xg om resterende ethanol te elimineren.
        4. Plaats de kolom in een schone 1,5 ml microcentrifugebuis. Om het DNA te elueren, voeg 30 μL nucleasevrij water toe aan het midden van het membraan, laat de kolom gedurende 1 minuut staan ​​en centrifugeer gedurende 60 s bij 12.000 g.
      5. Meet de concentratie met behulp van een spectrofotometer; Typisch zou de concentratie 100 ng / μl of hoger moeten zijn. Controleer of de A260 / A280-verhouding ongeveer 1,8 bedraagt ​​( dat wil zeggen geen contaminatie door eiwitten) en de A260 / A230 verhouding is ten minste 2,0 ( dus geen verontreiniging door organische oplosmiddelen).
    4. In vitro transcriptie met behulp van een T7 RNA synthese kit.
      1. Bereid tHij mengt, zoals aangegeven in tabel 1 , en incubeer gedurende 3 uur bij 37 ° C in een thermocycler. Voeg 28 μL nuclease-vrij water en 2 μl DNase I toe en incubeer gedurende nog eens 15 minuten bij 37 ° C in een thermocycler.
    5. RNA zuivering met behulp van spin kolommen.
      1. Los de poeder in de voorziene spinkolom op in 650 μL nuclease-vrije microinjectiebuffer. Verwijder alle luchtbellen zorgvuldig. Pak de buis en hydrateren gedurende 5 - 15 minuten bij kamertemperatuur.
      2. Verwijder de blauwe dop onderaan en plaats de kolom in een 2 ml buis. Centrifugeer gedurende 2 minuten bij 750 xg en kamertemperatuur. Plaats de kolom in een nieuwe 1,5 ml buis en plaats druppelsgewijs 50 μL van de RNA-oplossing, zonder de kolomwand aan te raken. Spoel de kolom gedurende 2 minuten bij 750 x g.
      3. Meet de RNA-concentratie met behulp van een spectrofotometer (de typische opbrengst van een reactie is 30-50 μg). Controleer of de A260 / A280-verhouding een a isRond 2,0 ( dus geen contaminatie door eiwitten) en de A260 / A230 verhouding is ten minste 2,0 ( dus geen verontreiniging door organische oplosmiddelen). Bewaar de sgRNA's bij -80 ° C tot gebruik.
      4. Bepaal de kwaliteit van het RNA met behulp van de 1% TAE gels die routinematig gebruikt worden voor DNA elektroforese. Run 200-400 ng van het DNA sjabloon en het bijbehorende sgRNA parallel. De RNA-band (≈ 100 bp) moet iets groter zijn dan de DNA-band (zie Figuur 3A ).

3. Donor Template

  1. Commercieel gesynthetiseerde enkelstrengige oligonucleotiden (ssOligos, zie de Tabel van Materialen ) voor puntmutaties bestellen of voor de integratie van kleine sequenties tot 50 bp; Homologie armen zijn typisch 60-90 bp lang.
  2. Voor grotere invoegingen gebruik een donorplasmide als een sjabloon. Genereer een geschikt plasmide met behulp van de klassieke kloneringsmethode of de novo synthese uit aCommerciële bron.
    OPMERKING: Minimaal 800 bp per homologie arm wordt aanbevolen. De grootte van de ruggengraat heeft geen invloed op de efficiëntie van homology direct repair (HDR).

4. Spuitmengsel

  1. Verdun het Cas9 mRNA tot 50 ng / μL en de sgRNA's tot 12,5 ng / μl (25 ng / μl in totaal) onder gebruikmaking van nuclease-vrije microinjectiebuffer voor gen-knock-out experimenten. Voeg de donorsjabloon (ssOligo of plasmide) toe bij een concentratie van 200 ng / μL voor experimenten met genoomredigering op basis van homologie directe reparatie.
    OPMERKING: Verdunningsvolumes kunnen gemakkelijk worden bepaald met behulp van online gereedschappen, zoals een resuspensieregelaar 18 .
  2. Houd elke portie op ijs tijdens de microinjectiesessie en wis daarna af (doe de injectiemengsel niet opnieuw bevriezen).

5. Scrotale Vasectomie

OPMERKING: Twee soorten vasectomie worden vaak uitgevoerd in muizen: buik- en scrotale buikspieren. Het laatsteIs minder invasieve en is eerder beschreven 15 .

  1. Autoclaaf alle chirurgische instrumenten in roestvrij staal.
  2. Bepaal het gewicht van de muis met behulp van een weegschaal en verdov de mannen door intraperitoneale (ip) injectie met injecteerbare verdoving (ketamine 100 mg / kg, xylazine 10 mg / kg).
  3. Controleer het verlies van de klinkreflex van de teen en als de muis zacht is, plaats het op de bovenkant van een verwarmingsblok.
  4. Desinfecteer de huid rond de testes met afwisselende doekjes van een actueel antiseptisch middel zoals chlorhexidine en 70% ethanol.
  5. Duw de testes in de scrotal sac en maak een huid incisie met een scalpel.
  6. Visualiseer de testis, cauda epididymis en vas deferens.
  7. Grijp de vaatdeferens met pincet, houd deze vast en scherp aan elke kant van de tang om 3 mm van de vaatdeferens te verwijderen.
  8. Voer dezelfde procedure uit op de tweede testis.
  9. Sluit de huidinsnijdingen met wondklemmen en controleer deMuis nauwgezet tot volledig herstel.

6. Superovulatie (Oocytes Donors) en Time-paring (Pseudo-zwangere Vrouwen)

OPMERKING: De techniek om een ​​geschikt aantal bevruchte oocyten te genereren en geploegde pleegvrouwen voor reimplantatie te hebben is elders 15 beschreven.

  1. Spuit 10 vrouwelijke ip met 5 IE van de zwangere merens serumgonadotropine (PMSG, in 100 μl) omstreeks 12 uur op dag 1.
  2. Spuit de vrouwelijke ip met 5 IE van menselijke chorionische gonadotropine (hCG in 100 μl) 46-48 uur later (omstreeks 11 uur op dag 3).
  3. Zet de vrouwtjes onmiddellijk met eengezins mannen overnacht.

7. Pronucleaire (willekeurige integratie) en cytoplasmatische (Gene-targeting) injecties

  1. Vang de superovultaire muizen door cervicale ontwrichting, ontbloot de buik en toegang tot de eierstokken en oviducten, zoals eerder beschreven 15 . Dissect de oVellen en oogsten van de cumulus-oocyt-complexen (COC's) onder een stereomicorscoop 15 . Plaats ze in een druppel kalium simplex optimalisatie medium aangevuld met aminozuren (KSOMaa) volgens de traditionele methode 15 .
  2. Reinig de oocyten door ongeveer 1 μl hyaluronidase (10 mg / ml) toe te voegen aan de druppel KSOMaa-medium met behulp van een aspirator mondstuk en plaats de schotel in een 37 ° C / 5% CO2 incubator gedurende 30 s tot 1 min.
  3. Was de oocyten met 4 verse druppels KSOMaa-medium door het mondstuk van de aspirator te gebruiken en over te brengen naar een laatste druppel KSOMaa-medium dat overgaat met minerale olie (ongeveer 2 ml). Plaats de schotel in de 37 ° C / 5% CO 2 incubator totdat de oocyten klaar zijn voor injectie.
  4. Pronucleaire injectie (willekeurige integratie).
    1. Visualiseer de eieren onder de stereoscopische microscoop en overzetten ongeveer 50 eieren naar de injectiekamer (a droP van M2 medium bedekt met minerale olie) met behulp van het aspirator mondstuk.
    2. Breng de injectiekamer over naar de omgekeerde microscoop en injecteer de bevruchte oocyten (twee zichtbare pronuclei) met een paar picoliters van de injectiemix, gericht op een pronucleus (elk van de pronuclei kan worden gericht). Visualiseer een succesvolle injectie door de zwelling van de pronucleus in acht te nemen.
  5. Cytoplasmische injectie (gen targeting).
    1. Zet ongeveer 50 eieren over op een druppel KSOMaa die 5 μg / ml Cytochalasin B bevat met behulp van het mondstuk en incubeer gedurende 5 minuten in de 37 ° C / 5% CO 2 -cubator.
    2. Breng de eieren naar de injectiekamer met behulp van het mondstuk.
    3. Spuit enkele picoliters van de injectiemengsel in de cytoplasma bij zeer lage druk (50-100 hPa), met behulp van de compensatiedruk van de geautomatiseerde microinjector waar mogelijk.
    4. Vervolgens na injectie de oocyten terug in een druppel KSOMaa (met behulp van het mondstuk) en houd ze in de 37 ° C / 5% CO 2 incubator, totdat deze geladen is voor reimplantatie in het oviduct van pseudo-zwangere vrouwtjes.

8. Reimplantatie

  1. Autoclaaf alle chirurgische instrumenten in roestvrij staal.
  2. Bepaal het gewicht van de muis met behulp van de weegschaal en verdov de vrouwen door intraperitoneale (ip) injectie met injecteerbare verdoving (ketamine 100 mg / kg, xylazine 10 mg / kg).
  3. Controleer het verlies van de klinkreflex van de teen en als de muis zacht is, plaats het op de bovenkant van een verwarmingsblok.
  4. Knip een groot gedeelte van de vacht om de dorsale middenlijn van de vrouwelijke muis.
  5. Desinfecteer de blootgestelde huid met wisselende doekjes van een actueel antiseptisch middel zoals chlorhexidine en 70% ethanol.
  6. Ontdek het voortplantingsstelsel volgens traditionele methode 15 . Maak een 1 cm lange huidinsnijding evenwijdig aan de dorsale middenlijn, snij de spier en pak de vetkussen wiDoe een tang en trek de ovary voorzichtig uit totdat de bevestigde ovulaat en de baarmoeder duidelijk zichtbaar zijn.
  7. Bevestig het vetpaneel met een schroefklem. Visualiseer het oviduct onder de stereoscopische microscoop en maak gebruik van een paar microsensjes een snede in de wand van het oviduct enkele millimeter stroomopwaarts van de ampulla.
  8. Onder de stereoscopische microscoop laadt u 25 microinjecteerde eieren in de glazen capillaire die verbonden is met het mondstuk (de inwendige diameter van de capillaire moet ongeveer 120 μm breed zijn). Introduceer de glazen capillaire in het oviduct en verdrijf totdat een luchtbelletje in de ampulla zichtbaar is.
  9. Verwijder de glazen capillaire voorzichtig en plaats het voortplantingsstelsel terug in de buik. Soteer de incisie met 3-0 niet-absorbeerbare chirurgische hechtingen, sluit dan met wondklemmen. Monitor de muis nauwlettend tot volledig herstel.

9. Genotyping Strategies / Sequencing

OPMERKING: Isoleer de genomicDNA uit 2 mm staart of oorbiopsies, in overeenstemming met de relevante dieretische regelgeving.

  1. Snelle genomische DNA-extractie (willekeurige integratie).
    1. Licht de weefselmonsters (~ 2 mm) bij 95 ° C gedurende 1 uur in 100 μl alkalisch lysisreagens (25 mM natriumhydroxide en 0,2 mM EDTA, pH = 12).
    2. Voeg 100 μL neutraliserend reagens (40 mM Tris-HCl, pH = 5) toe.
    3. Centrifugeer gedurende 5 minuten bij 12.000 g en 4 ° C.
  2. Hoge kwaliteit genomische DNA-extractie (gen targeting).
    1. Voeg 500 μl staartbuffer (50 mM Tris, pH = 8; 100 mM EDTA, pH = 8; 100 mM NaCl; 1% SDS; 0,5 mg / ml protease K, vers toegevoegd).
    2. Incubeer overnacht bij 55 ° C.
    3. Meng gedurende 5 minuten door inverteren (niet vortex).
    4. Voeg 250 μL verzadigd NaCl (6 M) toe en meng gedurende 5 minuten door inverteren (niet vortex).
    5. Spin 5-10 minuten bij 12.000 xg en 4 ° C en giet het supernatant in een nieuwe buis. Voeg 500 μl isopropanol toe en meng gedurende 5 minuten door inverteren (niet vortex).
    6. Spin gedurende 10 minuten bij 12.000 xg en kamertemperatuur.
    7. Dek de supernatant (de pellet is onzichtbaar en stokt aan de buis).
    8. Was met 1 ml 70% ethanol.
    9. Spin 5-10 minuten bij 12.000 xg en kamertemperatuur. Verwijder de supernatant met zorg, want de witte pellet is niet meer kleverig en kan verloren gaan.
    10. De lucht droog dit voor ~ 1 uur.
    11. Voeg 400 μl TE-buffer (10 mM Tris en 1 mM EDTA, pH = 8) toe.
    12. Los het DNA op 55-60 ° C gedurende 2 uur op.
  3. Primer ontwerp.
    1. Ontwerp primers minimaal 20 bp lang met behulp van een computergereedschap 19 .
      OPMERKING: Voor willekeurige integratie moeten de primers hybridiseren met het transgeen, waardoor een duidelijk fragment van 200-800 bp wordt genereerd. Voor gen targeting, ontwerp de primers, zodat ze hybridiseren met het genomische DNA, waardoor een aparte f wordt genereerdStel een paar honderd bp om de snijplaatsen. Voor grote inserties kunnen de primers op het transgen zitten, maar bevestiging van de gerichte integratie moet vervolgens worden uitgevoerd met behulp van primerwandeling of een soortgelijke techniek.
  4. PCR genotypering.
    1. Voor elke genomische modificatie, ontwerp een nieuw PCR protocol en test het empirisch. Overweeg de lengte van het gegenereerde fragment en de smeltemperatuur (Tm) van elk paar primers.
  5. Sequencing.
    1. Voor gen targeting, stuur PCR producten naar een Sanger sequencing service provider.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Hieronder worden de werkstromen voor microinjectie in het geval van willekeurige integratie en CRISPR-gemedieerde gen targeting beschreven ( Figuur 1 ).

Figuur 1
Figuur 1: Typische werkstroom voor de generatie van genetisch gemodificeerde muizen. Voor willekeurige integratie wordt het gezuiverde transgeen geïnjecteerd in het pronucleus van bevruchte oocyten voor oviductoverdracht in geploegde pleegvrouwen. Analyse van de nakomelingen wordt uitgevoerd door PCR na een snelle genomische DNA-extractie. Voor CRISPR gen targeting worden sgRNA's gesynthetiseerd onder toepassing van de hier beschreven methode die niet kloneren, en twee geleiders worden gecombineerd (samen met Cas9 mRNA) in het cytoplasma van bevruchte oocyten. Deze strategie wordt gebruikt voor de daaropvolgende PCR-gebaseerde analyse van de nakomelingen, die zeer gezuiverd g vereistEnomisch DNA. Klik hier om een ​​grotere versie van deze figuur te bekijken.

Hoewel de microinjectie van oocyten en de reimplantatie van deze geïnjecteerde eieren de twee belangrijkste beperkende stappen zijn die technische vaardigheden en training vereisen, is de kwaliteit van de injectiemengsel van het grootste belang om genetisch gemodificeerde muizen succesvol te genereren. De kwaliteit van de transgenzuivering ( Figuur 2A ) en de sgRNAs-synthese ( Figuur 3A ) moeten systematisch worden beoordeeld op analytische agarosegels. Potentiële verontreinigingen van de mix moeten ook gecontroleerd worden bij het meten van de concentraties met een spectrofotometer, aangezien de verschillende absorptiewaarden rechtstreeks afhangen van de zuiverheid van de oplossing (zie stappen 1.2.3, 2.2.3.5 en 2.2.5.3).

Figuur 2B ) en voor gen targeting ( Figuur 3B ). De DNA-extractieprotocollen zijn ook verschillend afhankelijk van het type experimenten; Daaropvolgende PCR's zijn gebaseerd op primers die respectievelijk op het transgen respectievelijk op het genomische DNA hybridiseren. De hier gepresenteerde strategieën maken het mogelijk makkelijk te oplossen en te stroomlijnen van elke stap die nodig is om genetisch gemodificeerde muizen te produceren.

Hoewel het kwantitatieve resultaat van een microinjectiesessie varieert afhankelijk van de ervaring van de experimentator, zodra elke stap van het protocol is geoptimaliseerd, zou het percentage getransformeerde transgenische puppen typisch 10-25% bereiken voor willekeurige integratieRantsoen, zoals geïllustreerd in figuur 2B (4 oprichters uit 15 pups geboren = 26,6%). Deze iets "lage" efficiëntie staat in contrast met het betrouwbare vermogen van de CRISPR componenten om het muisgenoom te bewerken. Inderdaad, het aantal genereerde generaals is in het algemeen hoger bij gebruik van CRISPR voor gen targeting en varieert van 25-100% (zie figuur 3B ; 3 oprichters uit 13 pups = 23%). Het is niet ongewoon om een ​​volledige nakomeling te verkrijgen die succesvol homozygoot is wanneer ze worden bewerkt met CRISPR.

Figuur 2
Figuur 2: Kwaliteitscontrole en genotypingstrategie voor de succesvolle productie van transgene muizen voor overexpressie. ( A ) Het plasmide wordt gedurende 1 uur gedigereerd met PvuI en NotI. Volledige spijsvertering en juiste maten ( dwz transgen = 7,338 bp, ruggengraat = 1.440+ 896 bp) worden gecontroleerd op een analytische gel (1). De extractie van verscheidene spijsverteringsproducten uit de preparatieve gel (2) genereert een verhoogde concentratie van het transgeen. Langdurige blootstelling aan UV moet worden vermeden, en het gebruik van een blauw licht in plaats van een UV-transilluminator wordt aanbevolen. (B) Genotypingstrategie (1): De primers zouden op het transgen moeten zitten en moeten ontworpen worden om een ​​fragment van 200 - 800 bp te genereren. Wanneer genotypering wordt uitgevoerd (2), wordt het aanbevolen een positieve controle in te voeren ( dat wil zeggen de injectiemix die wordt gebruikt voor microinjectie) en een negatieve controle ( dwz genomisch DNA van een WT-muis). Klik hier om een ​​grotere versie van deze figuur te bekijken.

Figuur 3
Figuur 3: Quality Control en Genotyping StraTegy voor de succesvolle productie van gen-gerichte (KO) muizen. ( A ) De kwaliteit van de sgRNA's geproduceerd door in vitro transcriptie wordt beoordeeld door de DNA-sjabloon en het gegenereerde RNA parallel voor elke gids te runnen. De grootte van het RNA is iets groter dan het DNA. Mocht de kwaliteit bevredigend zijn ( dwz geen smoorbanden), dan worden de concentraties gemeten. ( B ) (1) Ontwerp van de twee geleiders (tegenovergestelde richtingen) omvattend het Startcodon in Exon 1. De primers worden geselecteerd om te hybridiseren met het genomische DNA buiten het gebied, dat uiteindelijk door de twee geleiders wordt uitgesneden. Deze strategie laat typisch de directe identificatie van heterozygote (# 5 en 9) en homozygote (# 3) KO-founders met behulp van PCR (2) toe. PCR producten van homozygote dieren tonen geen WT band. Klik hier om een ​​grotere versie van deze figuur te bekijken.

Reactie Components Volume Notitie Synthese van lineaire DNA-sjabloon
(2,5) Nuclease vrij water 97,2 μl 5x HF buffer 36 μl MgCl2 9 μl 10 mM dNTPs 9 μl 10 μM fwd primer 9 μl 5'TTAATACGACTCACTATAGN 20
gttttagagctagaaatagcaagttaaaata
Aggctagtc 3 ' 10 μM rev primer 9 μl 5 'AAAAGCACCGACTCGGTGCC 3' PrOof-lezen polymerase 1,8 μl IVT met behulp van een T7 RNA synthese kit
(2.6) Nuclease vrij water X μL Maak maximaal 20 μL totaal volume NTP buffer mix 10 μl Sjabloon DNA ≈ 300 ng T7 RNA polymerase 2 μl

Tabel 1: Samenstelling van de verschillende meestermixen die in deze studie gebruikt worden. Synthese van het lineaire DNA-sjabloon: De T7-promotor minimale sequentie (TTAATACGACTCACTATAG) is stroomopwaarts van de 20-bp-sequentie (gids; N20 geïdentificeerd met behulp van het CRISPR ontwerphulpmiddel) en een sequentie complementair aan de expressievector (gttttagagctagaaatagcaagttaaaataaggctagtc). In vitroTranscriptie (IVT): Afhankelijk van de concentratie van de DNA-sjabloon moet het uiteindelijke volume worden aangepast aan 20 μl met nuclease-vrij water.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Kritieke stappen binnen het protocol

De opkomst van genetisch gemodificeerde muizen is technisch uitdagend. Het hier gepresenteerde protocol is echter een geoptimaliseerde en vereenvoudigde methode waarmee men de techniek in recordtijd kan beheersen en oplossen. Er zijn twee stappen nodig om de techniek succesvol af te ronden. Ten eerste kan de synthese van lineaire DNA templates (voor de synthese van sgRNAs) worden bereikt zonder magnesiumchloride (MgCl2). Het wordt echter sterk aanbevolen om MgCl 2 systematisch toe te voegen aan de master mix omdat de gedeeltelijke hybridisatie van de voorwaartse primer vaak voorkomt bij afwezigheid van MgCl 2 . Daarnaast is het kritiek dat de geteste genoomsequentie niet aanwezig is in een deel van het donorsjabloon (in het geval van gerichte integratie), anders snijdt het Cas9 nuclease het voorkomen van het optreden van HDR.

wijzigingenEn probleemoplossing

Hoewel dit protocol voor het genereren van genetisch gemodificeerde muizen is geoptimaliseerd en gestroomlijnd door de jaren heen, zijn er enkele overwegingen die betrekking hebben op de opbrengst van goede kwaliteit oocyten voor microinjectie en de plugging van pleegvrouwen. De keuze van de achtergrondstam is kritisch ten aanzien van het aantal levende pups die voortvloeien uit een microinjectiesessie. C57BL / 6 is de meest gebruikte achtergrond voor muismodellen van ziekten. Het is echter ook een van de minder efficiënte achtergronden in termen van weerstand tegen microinjectie 20 . Bovendien is de leeftijd van de vrouw ook kritisch om een ​​groot aantal oocyten te geven; Het wordt aanbevolen om muizen van 5 tot 8 weken te voorkomen, ongeacht de achtergrond, aangezien dit de minst gunstige periode van respons op hormonale stimulatie is 21 . In onze ervaring leveren 3 tot 4 weken oude C57BL / 6 muizen betrouwbaar 20-30 eieren per vrouw. Het is belangrijk omMerk op dat een nieuwe techniek (aangeduid als ultra-superovulatie) tot 100 eieren per vrouw heeft geproduceerd en onlangs is gebruikt om oocyten voor microinjectie 22 te genereren. Echter, het gebruik van ultra-superovulatie voor microinjectie wordt in het algemeen belemmerd door de behoefte aan kunstmatige bevruchting ( in vitro bevruchting) zo'n groot aantal eieren.

Om geploegde pleegvrouwen die geschikt zijn voor reimplantatie te verkrijgen, worden vrouwelijke muizen gepaard met vasectomized mannen (de achtergrond van deze muizen is niet kritisch). Om het aantal toegestane ontvangers te vergroten, kan een zorgvuldig onderzoek naar het stadium van estrus en de selectie van geschikte vrouwtjes worden uitgevoerd 23 . Synchronisatie van de vrouwtjescycli kan ook worden geïnduceerd door de vrouwtjes twee dagen voor de paring aan de gewektomiseerde mannen bloot te stellen (het zogenaamde "whitten effect") 24 .

Beperkingen van de techniek

Zeer kleine genomische veranderingen, zoals puntmutaties, zijn relatief gemakkelijk te genereren, maar ze zijn moeilijk te identificeren. Wanneer genotypering wordt uitgevoerd, worden de PCR-producten rechtstreeks door Sanger-sequencing gereguleerd. De directe microinjectie van CRISPR-componenten in muis-oocyten genereert echter vaak mozaïekdieren omdat de Cas9 gedurende een geruime tijd actief blijft en verschillende genomische modificaties kunnen optreden na de eerste verdeling van de oocyt. Dit confounding-effect bemoeilijkt de identificatie van discrete mutaties tussen verschillende allelen, en de volgende generatie sequencing (NGS) kan helpen bij uitdagende readouts. Gevoelige technieken, zoals tetra-primerARMS-PCR, 25 kan ook helpen bij het genotyperen van de kolonie na de identificatie van de oprichters door sequencing.

Omgekeerd blijft het opnemen van grote stukjes DNA op een gerichte manier nog steeds uitdagend. Hoe groter het exogene DNA, hoe minder de efficiëntie van HDR. Bijgevolg worden nieuwe strategieën, zoals het gebruik van lange ssOligos-donoren (in plaats van plasmiden) 26 of HDR-onafhankelijke gerichte integratie 27 , momenteel ontwikkeld.

Betekenis van het protocol

Dit protocol bevat belangrijke vooruitgang, omdat de vier hoofdstappen ( dat wil zeggen de voorbereiding van de transgen- of CRISPR-componenten, microinjectie, reimplantatie en genotypering) zijn geoptimaliseerd, getest en gevalideerd in ons laboratorium.

De willekeurige integratie van transgenen wordt wijd gebruikt voor overexpressiestudies om twee hoofdredenen. Ten eerste, om te vermijdenId de potentiële 'positie-effect', de doelgerichte integratie van een transgeen met behulp van CRISPR in "veilige haven" loci, zoals de Rosa26 28 en de Col1a 29 loci, blijft berucht uitdagend, aangezien de efficiëntie van HDR laag is. Strategieën om dit probleem te verhelpen zijn aanstaande 26 , 27 , maar willekeurige integratie is tot nu toe efficiënter gebleken. Daarnaast is de generatie van meerdere transgene lijnen die hetzelfde transgene overexpresseren met verschillende expressieniveaus van belang in studies waarbij behandelingsstrategieën worden toegepast om een ​​fenotype 30 om te keren. Plasmidgebaseerde transgenen worden gegenereerd door middel van klonen, met behulp van ad hoc restrictie-enzymen om essentiële fragmenten te assembleren voor de expressie van een eiwit van belang. In het algemeen wordt een transgeen gemaakt van tenminste drie elementen: een geschikte promotor (soms worden extra versterkersgebieden toegevoegd); De coderingSequentie (cDNA), met of zonder intronische gebieden; En een PolyA-staart om mRNA-expressie 31 te stabiliseren.

Eenmaal gemonteerd wordt het transgeen ingebracht in een plasmide bevattende bacteriële replicatie-elementen en uitgebreid in cultuur na transformatie (typisch warmschok gebaseerd). De zuiveringswerkwijze van de transgenen voor microinjectie is kritisch. Dit werk beschrijft het gebruik van DNA-vlekken van nieuwe generatie (lage toxiciteit) voor het nauwkeuriger visualiseren van het fragment van belang op de gel (in vergelijking met traditioneel kristalviolet) en van een lage mutageenbelichting (vergeleken met ethidiumbromide).

De hierin beschreven niet-kloneringsmethode voor gen targeting is zeer snel en maakt het mogelijk om meerdere sgRNA's in slechts 5-6 uur te syntheseren. Er zijn maar vier stappen nodig: de identificatie van de gerichte sequentie, de synthese van een lineaire DNA-sjabloon die een T7-promotor bevat en de gekozen doelsequentie, de synthese oF het sgRNA door in vitro transcriptie (IVT) en de zuivering van het sgRNA met behulp van spin kolommen.

Op de vroege leeftijd van CRISPR-muisgenoombewerking werd het potentiële off-target effect systematisch beoordeeld, hoewel het zeer beperkt is gebleken in muizenembrooien 32 en kan gemakkelijk worden verdund door middel van een fokschema waarin geselecteerde muizen alleen dragen De gewenste genomische modificatie. On-target-activiteit werd ook systematisch vooraf in vitro beoordeeld, met behulp van verschillende gidsen en de meer actieve (en) 12 geselecteerd. Deze praktijk is nu om meerdere redenen minder gebruikelijk. Ten eerste wordt de on-target-activiteit beoordeeld door gebruik te maken van transfectie van onsterfelijke muiscellijnen (typisch N2a of NIH3T3) met CRISPR-coderende plasmiden. Dit is een andere methode dan de injectie van CRISPR RNA componenten in muis oocyten. Daarom vertalen de in vitro resultaten niet altijd gelijkelijkNaar oocyten. Voorts bleek dat door middel van high-throughput experimenten de meeste geleiders actief zijn 33 . Bijgevolg wordt on-target activiteit niet beoordeeld en tot nu toe is er geen bewijs geweest van een gids die geen activiteit toont in muis-oocyten. Samen met de niet-kloningsmethode om sgRNA's te synthetiseren, die hier wordt gepresenteerd, wordt dit veel eenvoudiger en stroomlijnt de workflow, en meerdere actieve gidsen kunnen naadloos in één dag worden gesynthetiseerd.

CRISPR wordt beschouwd als een "ontwrichtende technologie", dat is een innovatie die de manier waarop technieken worden uitgevoerd verandert. Toen microinjectie werd opgericht, brachten Brinster et al. Toonde aan dat cytoplasmatische transgenese, hoewel haalbaar, meestal ondoeltreffend bleef 7 . Dientengevolge bleef de nucleaire microinjectie de enige gebruikelijke praktijk gedurende bijna 30 jaar, tot de eerste demonstratie van een succesvol CRISPR gen gericht op muizen. Deze studie toonde dat cytoplasmatische microinject Ionen kan een vergelijkbaar of superieur resultaat opleveren in vergelijking met pronucleaire afgifte 12 . Vanzelfsprekend, omdat CRISPR-componenten typisch van RNA zijn gemaakt, is het duidelijk dat het cytoplasma gericht is. Echter, zelfs als het in het cytoplasma wordt geïnjecteerd, kunnen donorsjablonen ook succesvol HDR induceren. Een hoge cytoplasmatische concentratie van templates maakt hun diffusie in de kern mogelijk. Bovendien is het gebruik van piëzo-aangedreven cytoplasmatische microinjectie 16 niet een vereiste. Een korte incubatie van de oocyten met een cytoskeletine-remmer, zoals Cytochalasin B, verhoogt het overleving van de oocyten 34 , 35 , waardoor het voldoende is om cytoplasmatische injecties uit te voeren zonder een piezo-effect aandrijfsysteem. Evenzo vermindert het gebruik van een verbeterd kweekmedium, zoals KSOMaa, de blokkering in het twee-cel stadium en verbetert de ontwikkelingscapaciteiten van de embryo's in vergelijking met M16 mediumXref "> 36.

Eén-cel of twee-cel (bij overnachting) kunnen embryo's overgebracht worden naar het oviduct. De conventionele procedure is vrij invasieve, omdat het nodig is om de bursa te beschermen die de eierstok beschermt. Het is ook technisch uitdagend omdat de glazen capillaire in het infundibulum 15 moet worden ingebracht. De hier gepresenteerde methode is veel makkelijker om te leren, veroorzaakt geen potentiële bloeding en behoudt de integriteit van de eierstok. Het is gebaseerd op werk ontwikkeld aan Kumamoto University 37 .

Genotyping strategieën en sequencing technieken zijn cruciaal om potentiële oprichters te identificeren. Voor willekeurige integratie is de extractie van genomisch DNA gebaseerd op een eenvoudige methode aangepast van Truett et al. 38 . Een dergelijke snelle extractie methode is voldoende om potentiële oprichters te identificeren, aangezien de primers zijn ontworpen om te hybridiseren met het transgeen (vaak integrerenAls meerdere exemplaren). Omgekeerd vereist gen targeting zeer gezuiverd genomisch DNA, omdat het PCR-product het gemodificeerde genomische gebied omvat.

Voor het genen van knockout genereert de traditionele methode voor het injecteren van een enkel sgRNA kleine deleties (indelen) of invoegingen, waardoor het gen van belang 12 uiteindelijk wordt uitgeschakeld. Deze kleine wijzigingen zijn moeilijk te identificeren en vereisen vaak tijdrovende, ligase-onafhankelijke klonen en sequencing om de aard van deze mutaties te bevestigen.

In dit protocol hebben we gebruik gemaakt van CRISPR multiplexing om de systematische co-injectie van twee sgRNA's te ontwikkelen die het startcodon van een gen van belang omvatten. Dit verhoogt niet alleen de kans op een genknock-out, maar ook de uitsnijding van een stuk genoom-DNA met een vooraf gedefinieerde grootte (100-300 bp), waardoor het makkelijk kan worden geïdentificeerd van de oprichters door middel van eenvoudige PCR. Opvallend, pups die de verwachte genomic niet dragenXcision kan nog steeds geanalyseerd worden voor kleine frameshift mutaties, wanneer slechts één sgRNA actief bleek. Evenzo moet in het geval van genbewerking de systematische co-injectie van twee overlappende sgRNA's in tegengestelde richtingen de efficiëntie van HDR verhogen, aangezien de celherstelmechanismen bij voorkeur één van de twee strengen 39 gebruiken.

Toekomstige toepassingen

Het onderhavige protocol maakt gebruik van de nieuwste ontwikkelingen in de muis embryologie en gen targeting 40 om het proces te vereenvoudigen en te stroomlijnen om verschillende geraffineerde muismodellen van menselijke omstandigheden te genereren. Deze modellen spelen een cruciale rol bij het ontwikkelen van ons begrip van pathomekanismen, uiteindelijk bijstand in de ontwikkeling van therapeutische strategieën 2 . De optimalisatie en stroomlijning van de reagentia die nodig zijn voor gen targeting of willekeurige integratie zijn wijd en gemakkelijk toepasselijkLe naar andere zoogdieren, zoals ratten, konijnen, en zelfs grote dieren zoals vee.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

De auteurs verstrekken academische transgenese diensten in muizen via het University of New South Wales Mark Wainwright Analytical Center.

Acknowledgments

De auteurs bedanken het personeel van de dierenfaciliteit (BRC) voor hun lopende ondersteuning. Dit werk werd gefinancierd door de National Health and Medical Research Council en de Australian Research Council.

Materials

Name Company Catalog Number Comments
Micropipette 0.1-2.5 μL Eppendorf 4920000016
Micropipette 2 - 20 μL Eppendorf 4920000040
Micropipette 20 - 200 μL Eppendorf 4920000067
Micropipette 100 - 1,000 μL Eppendorf 4920000083
Molecular weight marker  Bioline BIO-33025 HyperLadder 1 kb
Molecular weight marker  Bioline BIO-33056 HyperLadder 100 bp
Agarose Bioline BIO-41025
EDTA buffer Sigma-Aldrich 93296 10x - Dilute to 1x
Ethidium bromide Thermo Fisher Scientific 15585011
SYBR Safe gel stain Invitrogen S33102
Gel extraction kit Qiagen 28706
PCR purification kit (Qiaquick) Qiagen 28106
Vacuum system (Manifold) Promega A7231
Nuclease-free microinjection buffer  Millipore MR-095-10F
Ultrafree-MC microcentrifuge filter  Millipore UFC30GV00
Cas9 mRNA Sigma-Aldrich CAS9MRNA
CRISPR expressing plasmid (px330) Addgene 42230
Nuclease free water Sigma-Aldrich W4502
Phusion polymerase New England Biolabs M0530L
T7 Quick High Yield RNA kit New England Biolabs E2050S
RNA purification spin columns (NucAway) Thermo Fisher Scientific AM10070
ssOligos Sigma-Aldrich OLIGO STANDARD
Donor plasmid Thermo Fisher Scientific GeneArt
Hyaluronidase Sigma-Aldrich H3884
KSOMaa embryo culture medium Zenith Biotech  ZEKS-100
Mineral oil Zenith Biotech  ZSCO-100
M2 Medium Sigma-Aldrich M7167
Cytochalasin B Sigma-Aldrich C6762
Mouthpiece Sigma-Aldrich A5177
Glass microcapillaries Sutter Instrument BF100-78-10
Proteinase K Applichem A3830.0100
Dumont #5 forceps Fine Science Tools  91150-20
Iris scissors Fine Science Tools  91460-11
Vessel clamp Fine Science Tools  18374-43
Wound clips  Fine Science Tools  12040-01
Clips applier  Fine Science Tools  12018-12
Micro-scissors  Fine Science Tools  15000-03
Cauterizer Fine Science Tools  18000-00
Non-absorbable surgical sutures (Ethilon 3-0) Ethicon 1691H
5% CO2 incubator MG Scientific Galaxy 14S
Spectrophotometer Thermo Fisher Scientific Nanodrop 2000c
Thermocycler Eppendorf 6321 000.515
Electrophoresis set up BioRad 1640300
UV Transilluminator BioRad 1708110EDU
Thermocycler Eppendorf 6334000069
Stereoscopic microscope Olympus SZX7
Inverted microscope Olympus IX71
2x Micromanipulators Eppendorf 5188000.012
Oocytes manipulator Eppendorf 5176000.025
Microinjector (Femtojet) Eppendorf 5247000.013
Mice C57BL/6J strain Australian BioResources C57BL/6JAusb 

DOWNLOAD MATERIALS LIST

References

  1. Ittner, L. M. Dendritic function of tau mediates amyloid-beta toxicity in Alzheimer's disease mouse models. Cell. 142, (3), 387-397 (2010).
  2. Ittner, A. Site-specific phosphorylation of tau inhibits amyloid-beta toxicity in Alzheimer's mice. Science. 354, (6314), 904-908 (2016).
  3. Marantz Henig, R. The Monk in the Garden. Mariner books. (2000).
  4. Jaenisch, R., Mintz, B. Simian virus 40 DNA sequences in DNA of healthy adult mice derived from preimplantation blastocysts injected with viral DNA. Proc Natl Acad Sci U S A. 71, (4), 1250-1254 (1974).
  5. Gordon, J. W., Ruddle, F. H. Integration and stable germ line transmission of genes injected into mouse pronuclei. Science. 214, (4526), 1244-1246 (1981).
  6. Gordon, J. W., Scangos, G. A., Plotkin, D. J., Barbosa, J. A., Ruddle, F. H. Genetic transformation of mouse embryos by microinjection of purified DNA. Proc Natl Acad Sci U S A. 77, (12), 7380-7384 (1980).
  7. Brinster, R. L., Chen, H. Y., Trumbauer, M. E., Yagle, M. K., Palmiter, R. D. Factors affecting the efficiency of introducing foreign DNA into mice by microinjecting eggs. Proc Natl Acad Sci U S A. 82, (13), 4438-4442 (1985).
  8. Capecchi, M. R. Gene targeting in mice: functional analysis of the mammalian genome for the twenty-first century. Nat Rev Genet. 6, (6), 507-512 (2005).
  9. Carbery, I. D. Targeted genome modification in mice using zinc-finger nucleases. Genetics. 186, (2), 451-459 (2010).
  10. Sung, Y. H. Knockout mice created by TALEN-mediated gene targeting. Nat Biotechnol. 31, (1), 23-24 (2013).
  11. Jinek, M. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-821 (2012).
  12. Wang, H. One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-mediated genome engineering. Cell. 153, (4), 910-918 (2013).
  13. Kang, X. Introducing precise genetic modifications into human 3PN embryos by CRISPR/Cas-mediated genome editing. J Assist Reprod Genet. 33, (5), 581-588 (2016).
  14. Liang, P. CRISPR/Cas9-mediated gene editing in human tripronuclear zygotes. Protein Cell. 6, (5), 363-372 (2015).
  15. Ittner, L. M., Götz, J. Pronuclear injection for the production of transgenic mice. Nat Protoc. 2, (5), 1206-1215 (2007).
  16. Yang, H., Wang, H., Jaenisch, R. Generating genetically modified mice using CRISPR/Cas-mediated genome engineering. Nat Protoc. 9, (8), 1956-1968 (2014).
  17. CRISPR DESIGN. Available from: http://crispr.mit.edu (2017).
  18. Integrated DNA Technologies. Resuspension Calculator. Available from: https://sg.idtdna.com/calc/resuspension/ (2017).
  19. BioTools at UMass Medical School. Primer3: WWW primer tool. Available from: http://biotools.umassmed.edu/bioapps/primer3_www.cgi (2017).
  20. Auerbach, A. B. Strain-dependent differences in the efficiency of transgenic mouse production. Transgenic Res. 12, (1), 59-69 (2003).
  21. Merriman, J. A., Jennings, P. C., McLaughlin, E. A., Jones, K. T. Effect of aging on superovulation efficiency, aneuploidy rates, and sister chromatid cohesion in mice aged up to 15 months. Biol Reprod. 86, (2), 49 (2012).
  22. Nakagawa, Y., et al. Ultra-superovulation for the CRISPR-Cas9-mediated production of gene-knockout, single-amino-acid-substituted, and floxed mice. Biol Open. 5, (8), 1142-1148 (2016).
  23. Byers, S. L., Wiles, M. V., Dunn, S. L., Taft, R. A. Mouse estrous cycle identification tool and images. PLoS One. 7, (4), e35538 (2012).
  24. Whitten, W. K. Modification of the oestrous cycle of the mouse by external stimuli associated with the male. J Endocrinol. 13, (4), 399-404 (1956).
  25. Ye, S., Dhillon, S., Ke, X., Collins, A. R., Day, I. N. An efficient procedure for genotyping single nucleotide polymorphisms. Nucleic Acids Res. 29, (17), E88 (2001).
  26. Yoshimi, K., et al. ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in zygotes. Nat Commun. 7, 10431 (2016).
  27. Suzuki, K., et al. In vivo genome editing via CRISPR/Cas9 mediated homology-independent targeted integration. Nature. (2016).
  28. Soriano, P. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat Genet. 21, 70-71 (1999).
  29. Liu, X., et al. A targeted mutation at the known collagenase cleavage site in mouse type I collagen impairs tissue remodeling. J Cell Biol. 130, (1), 227-237 (1995).
  30. Ke, Y. D. Short-term suppression of A315T mutant human TDP-43 expression improves functional deficits in a novel inducible transgenic mouse model of FTLD-TDP and ALS. Acta Neuropathol. 130, (5), 661-678 (2015).
  31. Auerbach, A. B. Production of functional transgenic mice by DNA pronuclear microinjection. Acta Biochim Pol. 51, (1), 9-31 (2004).
  32. Iyer, V., et al. Off-target mutations are rare in Cas9-modified mice. Nat Methods. 12, (6), 479 (2015).
  33. Zhou, Y. High-throughput screening of a CRISPR/Cas9 library for functional genomics in human cells. Nature. 509, (7501), 487-491 (2014).
  34. Brinster, R. L., Chen, H. Y., Trumbauer, M. E., Avarbock, M. R. Translation of globin messenger RNA by the mouse ovum. Nature. 283, (5746), 499-501 (1980).
  35. Pinkert, C. A., Irwin, M. H., Johnson, L. W., Moffatt, R. J. Mitochondria transfer into mouse ova by microinjection. Transgenic Res. 6, (6), 379-383 (1997).
  36. Biggers, J. D., Summers, M. C. Choosing a culture medium: making informed choices. Fertil Steril. 90, (3), 473-483 (2008).
  37. Nakagata, N. Embryo transfer through the wall of the fallopian tube in mice. Jikken Dobutsu. 41, (3), 387-388 (1992).
  38. Truett, G. E. Preparation of PCR-quality mouse genomic DNA with hot sodium hydroxide and tris (HotSHOT). Biotechniques. 29, (1), 52-54 (2000).
  39. Richardson, C. D., Ray, G., DeWitt, M. A., Curie, G. L., Corn, J. E. Enhancing homology-directed genome editing by catalytically active and inactive CRISPR-Cas9 using asymmetric donor DNA. Nat Biotechnol. 34, (3), 339-344 (2016).
  40. Delerue, F., Ittner, L. M. Genome Editing in Mice Using CRISPR/Cas9: Achievements and Prospects. Clon. Transgen. 4, (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics