Le sauvetage et la caractérisation du virus recombinant à partir d'un nouveau clone infectieux du virus Zika du monde

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Ce protocole décrit la récupération du virus Zika infectieux à partir d'un clone d'ADNc infectieux à deux plasmides.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Weger-Lucarelli, J., Duggal, N. K., Brault, A. C., Geiss, B. J., Ebel, G. D. Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone. J. Vis. Exp. (124), e55857, doi:10.3791/55857 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Les clones d'ADNc infectieux permettent une manipulation génétique d'un virus, facilitant ainsi le travail sur les vaccins, la pathogenèse, la replication, la transmission et l'évolution virale. Nous décrivons ici la construction d'un clone infectieux pour le virus Zika (ZIKV), qui provoque actuellement une épidémie explosive dans les Amériques. Pour éviter toute toxicité pour les bactéries qui sont communément observées avec les plasmides dérivés du flavivirus, nous avons généré un système à deux plasmides qui sépare le génome du gène NS1 et est plus stable que les constructions complètes qui ne peuvent pas être récupérées avec succès sans mutations. Après la digestion et la ligature pour rejoindre les deux fragments, l'ARN viral complet peut être généré par une transcription in vitro avec de l'ARN polymérase T7. Après l'électroporation de l'ARN transcrit dans les cellules, le virus a été récupéré qui a montré une cinétique de croissance in vitro similaire et des phénotypes de virulence et d'infection in vivo chez les souris et les moustiques, respectivement.

Introduction

Le virus Zika (ZIKV; Family Flaviviridae : Genre Flavivirus ) est un flavivirus transmis par des moustiques qui est arrivé au Brésil en 2013-14 et a ensuite été associé à une épidémie massive de maladie fébrile qui s'est répandue dans les Amériques 1 . En outre, le ZIKV a été lié à des résultats sévères liés à la maladie, tels que le syndrome de Guillain-Barré chez les adultes et la microcéphalie chez les fœtus et les nouveau-nés 2 . On savait peu à propos de ZIKV avant sa propagation rapide dans l'hémisphère occidental. Cela comprenait un manque d'outils moléculaires, entravant ainsi la recherche mécanique. Les outils moléculaires pour les virus, tels que les clones d'ADNc infectieux, facilitent le développement thérapeutique des vaccins et des antiviraux et permettent l'évaluation des facteurs génétiques viraux liés à la pathogenèse virale différentielle, à la réponse immunitaire et à l'évolution virale.

Les clones infectieux de Flavivirus sont connus pour être très instables dans les bactéries en raison de crLes promoteurs procaryotes yptiques présents dans leurs génomes 3 . Plusieurs approches ont été utilisées pour améliorer ce problème; Y compris l'insertion de répétitions en tandem en amont des séquences virales 4 , la mutation des séquences promoteurs procaryotes putatives 5 , le fractionnement du génome dans de multiples plasmides 6 , des vecteurs numériques à faible copie (y compris les chromosomes artificiels bactériens) 7 , 8 et l'insertion d'introns dans le génome viral 9 . Un système complet sans modifications a été décrit pour ZIKV; Cependant, ce clone semble être atténué dans la culture cellulaire et chez la souris 10 . D'autres groupes ont incorporé des introns dans le génome de ZIKV, permettant une perturbation de séquences instables dans des bactéries qui peuvent être épissées dans des cellules de mammifères in vitro pour la production de virus infectieux 11, 12 . En outre, un système basé sur la PCR intitulé Infectious-Subgenomic-Amplicons a été utilisé avec succès pour sauver le prototype de souche MR766 de ZIKV 13 . L'approche décrite ici ne nécessite pas de séquences étrangères, mais perturbe le génome dans la région d'une forte instabilité en utilisant de multiples plasmides, qui ont déjà été utilisés avec succès avec la fièvre jaune 6 , la dengue 14 , 15 et le virus du Nil occidental 16 . En outre, l'addition de la séquence de ribozyme de l'hépatite D au niveau de la terminaison génomique virale facilite la création d'une fin authentique 3 'sans avoir besoin d'ajouter un site de linéarisation. En outre, les deux plasmides sont construits dans un vecteur à nombre de copies faible (pACYC177, ~ 15 copies par cellule) pour atténuer toute toxicité résiduelle 17 . Le virus récupéré affiche un profil de croissance comparable àVirus parental dans les courbes de croissance in vitro dans 8 lignées cellulaires comprenant une variété de types de cellules dérivées à la fois de mammifères et d'insectes et a présenté des profils pathogènes identiques chez la souris et les taux d'infection, de diffusion et de transmission chez les moustiques 18 .

Dans ce document, nous détaillons un protocole décrivant comment développer les plasmides de clones infectieux, générer de l'ARN viral complet (le génome viral) in vitro et récupérer le virus infectieux dans la culture cellulaire. Tout d'abord, nous décrivons la propagation de plasmides dans des bactéries ou une amplification sans bactéries à l'aide de l'amplification du cercle circulant (RCA). Ensuite, nous montrons comment les deux plasmides sont digérés puis ensuite ligaturés ensemble pour générer des virus complets. Enfin, nous décrivons la production de l'ARN transcrit et son électroporation subséquente dans les cellules Vero, suivi du titrage du virus récupéré ( Figure 1 ). L'approche décrite est rapide, ce qui permetR récupération des stocks de virus infectieux en 1-2 semaines.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Transformer et récupérer des plasmides de clones infectieux

  1. Transformez les deux plasmides (séparément) en utilisant un protocole de transformation commercial ( p. Ex . NEB 5 Minute Transformation Protocol) avec quelques modifications. Les deux plasmides contiennent un gène codant pour la résistance à l'ampicilline, utilisent donc l'ampicilline ou la carbénicilline pour la sélection. La carbénicilline est préférée, car elle est plus stable.
    1. Enlevez les cellules (voir la table des matériaux) à partir de un congélateur -80 ° C et dégonflez sur de la glace pendant 5 à 10 minutes. Préchauffer le lysogénie de bouillon (LB) (contenant 10 g / L de NaCl et 25 μg / mL de carbénicilline, appelées LB-carb) et le bouillon avec la répression des catabolites (SOC (sans antibiotiques) - à venir avec les cellules) à 37 ° C.
    2. Ajouter entre 100 pg-10 ng dans 1 μL d'ADN plasmidique à un tube contenant 50 μL de cellules compétentes; Mélanger doucement en faisant glisser le tube.
    3. Incuber les tubes sur de la glace pendant 5 min.
    4. Tubes de choc thermique à 42 ° C pendant 30 sDans un bain-marie. Retourner à la glace pendant 2 minutes immédiatement après un choc thermique.
    5. Pipeter 950 μL de température ambiante dans chaque tube et mélanger par pipettage. Étaler 100 μL du mélange bactérien sur une plaque de LB-carb et incuber pendant une nuit à 37 ° C (environ 12-14 h).
  2. Retirer les plaques de l'incubateur à 37 ° C après 12-14 heures d'incubation. Placez les plaques dans un tiroir sombre à température ambiante pour permettre aux colonies de continuer à croître (environ 8-9 h).
  3. En utilisant 5 mL de bouillon Terrific (TB, contenant 25 μg / mL de carbénicilline, appelé TB-carb), développez 5-10 petites colonies pour chaque plasmide pendant une nuit à 30 ° C dans un agitateur bactérien (environ 14-16 h).
    NOTE: Les petites colonies sont un indicateur que le plasmide est intact; Les colonies contenant des plasmides contenant des deletions, des réarrangements ou des mutations (appelées ici événements d'instabilité) se développeront plus rapidement et seront donc plus importantes. Par conséquent, on devrait essayer de choisir les plus petites colonies sur la plaque, en particulier nonT sélectionner les plus grandes colonies présentes. Certaines colonies de taille moyenne peuvent également être sélectionnées pour l'exhaustivité. La température inférieure utilisée réduit la probabilité que les cellules dépassent (OD 600 supérieure à 0,6-0,8). Comme la plupart des chercheurs effectuent une croissance du jour au lendemain, cela permet un plus grand contrôle et une réduction des chances de surcroît.
  4. Vérifier les cultures liquides pour la turbidité (environ OD 600 de 0,6-0,8). Placez tous les tubes turbides à 4 ° C et permettez à d'autres tubes de devenir turbides en augmentant pendant plus longtemps.
    REMARQUE: Ne pas cultiver des bactéries à des valeurs de OD 600 supérieures à celles recommandées, car des événements d'instabilité plasmidique peuvent survenir.
  5. Extraire l'ADN du plasmide à partir de bactéries avec un kit de miniprep de plasmide commercial (voir la table des matériaux). Eluire dans 15 μL de tampon d'élution préchauffé (à 70 ° C dans un bloc chauffant). Laisser le tampon d'élution incuber sur la colonne pendant 5 min avant la centrifugation.
    REMARQUE: conserver au moins 1 mL de cette culture initiale à 4 ° C pourUtilisation ultérieure dans l'étape suivante.
  6. Digérer 10 μL des plasmides récupérés pour évaluer si les événements d'instabilité du plasmide ont eu lieu pendant la culture.
    REMARQUE: Digest p1 avec SalI / NheI et p2 avec BamHI / HindIII à 37 ° C pendant 1 h. Confirmer la présence des bandes correctes après la digestion ( Figure 2a ) par électrophorèse sur gel et passer à l'étape 2. Si vous préparez l'ADN du plasmide par amplification du cercle roulant (RCA), réservez une partie de l'éluat miniprep pour servir de modèle.

2. Préparation d'un ADN plasmidique suffisant pour la ligature

NOTE: La ligature et l'électroporation subséquente nécessitent une quantité suffisante d'ADN plasmidique qui doit être généré soit par le maxiprep soit par l'ARC. Alors que le maxiprep est l'approche traditionnellement utilisée, RCA offre l'avantage de ne pas nécessiter de bactéries, éliminant ainsi le potentiel de toxicité induite par un plasmide chez les bactéries pouvant entraîner des événements d'instabilité.

  1. Pour chaque plasmide qui a démontré le modèle correct de digestion de l'enzyme de restriction dans la section précédente, ajouter 500 μL de culture de démarrage à 1 L de Carb (25 μg / mL de bouillon de carbine) et agiter pendant une nuit à 30 ° C (environ 14-16 h , Environ OD 600 de 0,6-0,8).
    REMARQUE: Ne permettez pas à la culture de croître sur cette valeur OD 600 . Cela entraînera potentiellement des événements d'instabilité dans les plasmides.
  2. Récolte les bactéries et effectuez les maxipreps selon le protocole du fabricant (voir la table des matériaux).
  • À l'aide du miniprep enregistré de l'étape 1.6, procédez comme suit pour la procédure RCA.
    1. Transférer 1 μl d'ADN plasmidique dans un tube contenant 50 μL de tampon échantillon.
    2. Désinfecter à chaud l'échantillon à 95 ° C pendant 3 min, puis incuber à 4 ° C jusqu'à ce qu'il soit prêt à l'emploi.
    3. Préparer l'amplification commercialePrémélange (voir la table des matériaux ). Mélanger 50 μL de tampon de réaction avec 2 μL de mélange enzymatique dans un ensemble de tubes sur de la glace.
      REMARQUE: le prémélange d'amplification doit être conservé sur glace jusqu'à ce qu'il soit prêt à l'emploi. Il est conseillé de préparer un mélange maître en combinant suffisamment de réactifs pour le nombre requis de réactions d'amplification. Tout prémélange inutilisé doit être éliminé.
    4. Transférer 50 μL de prémélange d'amplification préparé à l'échantillon dénaturé.
    5. Incuber les tubes de réaction à 30 ° C pendant 18 h.
    6. Incuber les tubes à 65 ° C pendant 10 minutes pour inactiver l'ADN polymérase ø29.
    7. Conservez les tubes de réaction à 4 ° C ou -20 ° C jusqu'à ce qu'ils soient prêts à l'emploi.
      NOTE: À ce stade, l'ADN plasmidique préparé via les deux méthodes doit être quantifié (en utilisant l'absorbance à 260 nm) et le génome ZIKV doit être Sanger séquentiellement entièrement pour confirmer qu'aucun événement d'instabilité (délits et réarrangements) n'a eu lieu lors de la préparation.
  • Nom de l'initiateur Séquence (5 '- 3')
    ZIKV PRVABC59 1Pour. AGTTGTTGATCTGTGTGAATCAGAC
    ZIKV Conserved 632For. GCCCATATGCTGGATGAGG
    ZIKV Conserved 692Rev. GGTTCCGTACACAACCCAAGTTG
    ZIKV Conserved 1313Rev. CTCCCTTTGCCAAAAAGTCCACA
    ZIKV Conserved 1201For. CCAACACAAGGTGAAGCCTAC
    ZIKV Conserved 1663For. GCAGACACCGGAACTCCACACT
    ZIKV Conserved 2008For. CAGATGGCGGTGGACATGC
    ZIKV Conserved 2350Rev. GTGAGAACCAGGACATTCCTCC
    ZIKV Conserved 2605For. TACAAGTACCATCCTGACTCCC
    ZIKV Conserved 3499Rev. GCCTTATCTCCATTCCATACCA
    ZIKV Conserved 3961Rev. TTGCCAACCAGGCCAAAG
    ZIKV Conserved 4132For. CATTTGTCATGGCCCTGG
    ZIKV Conserved 4561Rev. CTATTGGGTTCATGCCACAGAT
    ZIKV Conserved 4665For. GACCACAGATGGAGTGTACAGAGT
    ZIKV Conserved 5189Rev. AAGACAGTTAGCTGCTTCTTCTTCAG
    ZIKV Conserved 5219For. GAGAGTTCTTCCTGAAATAGTCCGTGA
    ZIKV Conserved 6086Rev. CTTGCTTCAAGCCAGTGTGC
    ZIKV Conserved 6119For. GCCTCATAGCCTCGCTCTATCG
    ZIKV Conserved 6721Rev. CCATTCCAAAGCCCATCTTCCC
    ZIKV Conserved 6769For. CCAGCCAGAATTGCATGTGTCC
    ZIKV Conserved 7209Rev. ATCATTAGCAGCGGGACTCCAA
    ZIKV Conservé 7343Pour. GTTGTGGATGGAATAGTGGT
    ZIKV Conserved 8243For. TGCCCATACACCAGCACTATGA
    ZIKV PRVABC59 8893Rev. TGCATTGCTACGAACCTTGTTG
    ZIKV conservé 9133Pour. AGCCCTTGGATTCTTGAACGAGGA
    ZIKV PRVABC59 9673Rev. AACGCAATCATCTCCACTGACT
    ZIKV Conserved 9686For. GATGATAGGTTTGCACATGCC
    ZIKV Conserved 10321Rev. GTCCATGTACTTTTCTTCATCACCTAT
    ZIKV Conserved 10455For. CAGGAGAAGCTGGGAAACC
    ZIKV Conserved 10621Rev. CAGATTGAAGGGTGGGGAAGGTC

    Tableau 1: Amorces pour le séquençage des clones d'ADNc. Les plasmides peuvent être séquencés entièrement avec les amorces répertoriées. Tampons marqués comme indiqués "conservés"Cate qu'ils sont susceptibles de séquencer / amplifier tous les génotypes de ZIKV. Les tampons étiquetés comme "PRVABC59" sont spécifiques à cette souche, mais peuvent également fonctionner pour d'autres souches génotypiques asiatiques et éventuellement d'autres génotypes.

    3. Préparation de l'ARN transcrite in vitro

    1. Mettre en place une réaction de digestion de l'ADN préparé par le maxiprep ou l'ARC.
      1. Pour la digestion par p1, mélanger 10 μL de 10x de tampon de réaction, 3 μl d'ApaLI, 3 μL de BamHI-HF, 3 μL de RSAP ou CIP et 3,3 μg d'ADN p1. Ajouter ddH 2 O à 100 μL.
      2. Pour la digestion par p2, mélanger 10 μL de 10x de tampon de réaction, 3 μl d'ApaLI, 3 μL d'EcoRI-HF et 13,3 μg d'ADN de p2. Ajouter ddH 2 O à 100 μL.
      3. Incuber à 37 ° C pendant 1-2 h.
      4. Purifier à l'aide d'un gel commercial et d'un kit de nettoyage par PCR (voir la table Matériaux). Eluire dans 30 μL de tampon d'élution préchauffé à 70 ° C dans un bloc de chauffage (incuber leColonne pendant 5 minutes avant la filature).
        REMARQUE: Gardez 1 μL pour fonctionner sur un gel plus tard.
    2. Préparer la réaction de ligature.
      1. Combiner 10 μL de tampon de réaction de ligature d'ADN T4 10x, 3 μL d'ADN ligase T4 (400 U / μL), 29 μL de p1 purifié et 29 μL de p2 purifié. Ajouter ddH 2 O à 100 μL.
      2. Incuber à température ambiante pendant 2 h ou 16 ° C pendant la nuit.
      3. Purifier à l'aide d'un gel commercial et d'un kit de nettoyage par PCR (voir la table Matériaux). Eluire dans 10 μL de tampon d'élution préchauffé à 70 ° C dans un bloc de chauffage (incuber la colonne pendant 5 minutes avant le filage).
        REMARQUE: Gardez 1 μL pour fonctionner sur un gel plus tard.
    3. Exécuter des plasmides non digérés, des plasmides digérés et une ligature sur un gel d'agarose. Le produit de ligature devrait avoir une bande de poids moléculaire plus élevée (environ 11 kb) que le plasmide digéré seul, ce qui indique que la ligature a réussi ( figure 2b ).
    4. Mettre en place une réaction de transcription in vitro T7.
      1. Mélanger 10 μL de mélange ARCA / NTP 2x, 2 μl de mélange T7 ARN polymérase et 8 μL de réaction de ligature purifiée pour un volume final de 20 μL.
        REMARQUE: L'ARCA inclus dans le mélange est un cap analog qui est exclusivement incorporé dans l'orientation correcte. Les analogues de capuchons standard peuvent entraîner seulement ~ 50% des transcriptions ayant un capuchon dans l'orientation correcte.
      2. Incuber pendant 4 h à 37 ° C.
      3. Mesurer la concentration d'ARN par un spectrophotomètre UV. En option, exécutez un gel d'agarose dénaturant pour confirmer la longueur du transcrit de l'ARN.

    4. Rescue of Infectious Virus par Electroporation

    1. Jours avant l'électroporation, préparer 1 flacon T182 de cellules Vero (entre T150 et T182 est acceptable, cultivé en DMEM + 10% de sérum bovin fœtal (FBS)) par construction à récupérer. Inclure 1 T182 comme un contrôle de transfection simulée. CeLls devrait être utilisé à une confluence de 70 à 80%.
    2. Lorsque les cellules sont prêtes, placez 12 mL / réaction de DMEM + 15% de FBS + 10 mM d'HEPES dans un bain d'eau chauffé à 37 ° C.
    3. Détachez les cellules par trypsinisation avec un protocole standard et récupérez les cellules dans des milieux avec 10% de FBS pour inactiver la trypsine; Centrifuger les cellules à 150 xg pendant 5 min à 4 ° C.
    4. Cellules de lavage dans 1x solution salée tamponnée au phosphate (PBS), culottes à 150 xg pendant 5 min à 4 ° C. Répétez cette étape deux fois pour un total de trois lavages.
    5. Remettre en suspension les cellules dans 200 μL de RPMI 1640 + HEPES 10 mM (stérile) par nombre d'échantillons. Transférer 200 μL de suspension cellulaire dans un tube stérile. Les cellules doivent être de ~ 0,5 x 10 7 cellules / ml.
    6. Ajouter 20 μL d'eau (contrôle négatif simulmé) ou 20 μL d'ARN (de préférence 5-10 μg) produits à l'étape 3.4 à chaque ensemble de cellules. Mélanger doucement en faisant basculer le tube et transférer le contenu du tube dans une cuvette d'électroporation à intervalle de 2 mm.
    7. Mettre un électrOpérateur à 170 V LV, oméga (résistance) à 0 et 950 μF (environ 625 V / cm et 20 ms pour les autres machines). Réglez la résistance au réglage le plus bas possible, soit 0 ou ∞ si disponible.
    8. Pulser une fois et ajouter immédiatement 600 μL de DMEM + 15% FBS + 10 mM HEPES qui a été chauffé à l'étape 4.2. Rincez à l'intérieur de la cuvette à fond pour enlever toutes les cellules. Ajouter des cellules dans un flacon de culture tissulaire T75 contenant 10 ml de milieux préchauffés. Retirez les supports supplémentaires de la cuvette en utilisant le compte-gouttes inclus avec la cuvette. Veillez à maintenir la stérilité.
    9. Flacon à spirale pour mélanger les milieux et les cellules et placer dans un incubateur à 37 ° C.
    10. Vérifiez le lendemain pour la viabilité cellulaire, et faites-le tous les jours jusqu'à ce que 50 à 75% de la mort soit observée. La mort cellulaire est observée en comparant à la maîtrise du contrôle électroporé.
      REMARQUE: l'effet cytopathique ZIKV (CPE) est assez prononcé dans les cellules Vero, ce qui entraîne des cellules arrondies qui se détachent et flottent dans le milieu de culture. Nous avonsA observé une gamme de 8 à 10 jours comme étant idéale pour la récolte.
    11. Récolter le surnageant dans un tube conique et centrifuger pour éliminer les débris cellulaires à> 3 000 xg pendant 10 min à 4 ° C.
    12. Retirer le surnageant clarifié sur un nouveau tube et compléter avec une concentration finale de 20% de FBS (à partir de 100% de stock). De plus, ajoutez de l'HEPES stérile à une concentration finale de 10 mM en tant qu'agent tampon pour préserver l'infectiosité du virus tout en étant congelé (à partir d'un stock stérile de 1 M).
    13. Mélanger le virus par vortexage et aliquote dans des flacons à vis. Conservez à -80 ° C pour une utilisation ultérieure.

    5. Titrage du virus récupéré

    1. Graine le nombre approprié de plaques de 6 ou 12 puits de cellules Vero la veille du titrage.
    2. Retirez le virus du congélateur et faites des dilutions série 10 dans DMEM + 2% de FBS dans des tubes ou des plaques à 96 puits.
      REMARQUE: Le titre attendu des clones récupérés est compris entre 1 x 10 6 et 5 x 10 7 PFU / mL.
    3. Ajouter 200 oR 400 μL de chaque dilution en double dans un puits d'une plaque de 12 ou 6 puits, respectivement.
    4. Placer les plaques dans un incubateur à 37 ° C et de la roche toutes les 15 min, pour un total de ~ 1-1,5 h période d'adsorption.
    5. Enlevez l'inoculum viral et ajoutez 1 ml de tampon de 12 mM (12 po) ou de 2 ml (6 puits) de DMAP-Tragacanth à chaque puits.
      NOTE: Il est possible d'utiliser de l'agarose, de l'agar, de la méthylcellulose ou d'autres milieux de recouvrement ici.
    6. Incuber les cellules dans un incubateur à 37 ° C pendant 5 jours. Le temps de formation appropriée de la plaque varie en fonction de la superposition utilisée.
    7. Pour réparer les cellules, retirer les plaques de l'incubateur et décoller doucement dans un désinfectant.
    8. Ajoutez suffisamment de 20% d'éthanol / 0,1% de violette de cristal (CV) à chaque puits pour couvrir et tourbillonner pour mélanger.
      REMARQUE: De nombreux autres fixateurs existent et peuvent être utilisés ici. De plus, si vous utilisez un agarose ou une superposition d'agar, une deuxième couche de recouvrement peut être utilisée avec un rouge neutre pour visualiser les plaques sans fixation. 20% d'éthanol s'est avéré êtreEfficace dans l'inactivation de virus enveloppés dans des études antérieures; N'utilisez pas ce montant pour les virus non enveloppés car ils ne seront pas inactivés 19 .
    9. Incuber les plaques pendant 30 à 60 minutes à température ambiante (dans un coffret de biosécurité de classe II); Jeter le CV (selon les réglementations locales) et les plaques de lavage avec de l'eau du robinet.
    10. Laisser sécher les plaques et les plaques de dénombrement manuelles.
      REMARQUE: la référence 20 peut être utilisée comme référence supplémentaire pour effectuer des essais en plaque.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    Le protocole décrit ici permet la récupération du virus infectieux dérivé du clone Zika. La manipulation du système de clones infectieux à deux plasmides est simple lorsqu'ils sont exécutés avec précaution, par rapport aux versions intégrales très instables (données non représentées). Après la digestion et la ligature des deux pièces distinctes, l'ARN coiffé est produit en utilisant une transcription in vitro avec une polymerase T7 qui est ensuite électroporée dans des cellules Vero ( figure 1 ). La séquence de plasmide correcte peut être surveillée en utilisant la digestion par restriction en tant que proxy après miniprep ( Figure 2a ) et par séquençage de Sanger après une production d'ADN à grande échelle avec RCA ou maxiprep. Après la confirmation des clones par séquençage, la récupération du virus infectieux nécessite uniquement la digestion, la ligature, la transcription in vitro et finalement l'électroporation. Ces étapes peuvent être effectuées en une journée. Courbe correcteLa séparation et la ligature peuvent être surveillées par électrophorèse sur gel d'agarose ( Figure 2b ), permettant le dépannage, si nécessaire.

    Comme le montre la figure 3 , le virus dérivé des clones infectieux se réplique à des niveaux similaires à ceux de l'isolant parental in vitro dans plusieurs lignées cellulaires, ce qui suggère que le virus récupéré provenant de l'ADNc se réplique de manière similaire à l'isolât primaire. En outre, aucune différence significative n'a été observée entre le virus infectieux dérivé du clone et l'isolat parental dans les taux de survie chez la souris ou les taux d'infection, de diffusion et de transmission chez les moustiques Aedes aegypti ( Figure 4 ).

    Figure 1
    Figure 1: Flux de travail de ZIKV à partir d'un clone d'ADNc à deux plasmides.Le génome de la souche ZIKV PRVABC59 a été clone dans deux éléments séparés dans un squelette de plasmide pACYC177. Les deux plasmides ont ensuite été digérés et ligaturés avec de l'ADN ligase T4. L'ARN infectieux cuit a ensuite été produit via une transcription in vitro suivie d'une électroporation dans des cellules Vero. (Figure adaptée de la référence 21 ). Cliquez ici pour voir une version plus grande de ce chiffre.

    Figure 2
    Figure 2: électrophorèse sur gel pour surveiller la digestion et la ligature du clone d'ADNc. ( A ) Digestion par restriction initiale des plasmides dérivés de miniprep pour évaluer la stabilité génétique. ( B ) Des exemples de produits de digestion et de ligature lors de la récupération du virus infectieux à partir du système de clones à deux plasmides. Href = "http://ecsource.jove.com/files/ftp_upload/55857/55857fig2large.jpg" target = "_ blank"> Cliquez ici pour voir une version plus grande de cette figure.

    figure 3
    Figure 3: Cinétique de croissance in vitro du virus dérivé du clone. La cinétique de croissance de PRVABC59 de type sauvage et le virus dérivé de clones infectieux sur les lignées cellulaires humaines (SH-SY5Y, Jar et NTERA2 cI.D1), les moustiques (C6 / 36, Aag2) et les primates non humains (Vero) ont été évalués par dosage en plaque. N = 3 Les barres d'erreur représentent l'écart type par rapport à la moyenne. (Figure adaptée de la référence 21 ). Cliquez ici pour voir une version plus grande de ce chiffre.

    55857fig4.jpg "/>
    Figure 4: Caractérisation in vivo du virus dérivé du clone chez la souris et les moustiques. ( A ) Des souris âgées de 4 semaines, mâle et femelle interféron alpha, bêta et récepteur gamma, AG129, des souris ont été inoculées par voie intraperitoneale avec 1 000 PFU de PRVABC59 ou le virus infectieux dérivé de clone et surveillées au fil du temps pour la survie (n = 11). Les moustiques d' Aedes aegypti ont reçu une graisse infectieuse contenant du ZIKV et disséqués 14 jours plus tard. ( B ) Les tests de plaques ont été utilisés pour évaluer les moustiques (infection), les jambes (dissémination) ou les sécrétions salivaires (transmission) pour le virus infectieux. Les taux sont présentés en pourcentage du total des moustiques testés (figure adaptée de la référence 21 ). Cliquez ici pour voir une version plus grande de ce chiffre.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    Les auteurs n'ont rien à dévoiler.

    Acknowledgments

    Les auteurs souhaitent remercier Kristen Bullard-Feibelman, Milena Veselinovic et Claudia Rückert pour leur aide dans la caractérisation du virus dérivé du clone. Ce travail a été soutenu en partie par des subventions de l'Institut national d'allergie et de maladies infectieuses, NIH sous les subventions AI114675 (BJG) et AI067380 (GDE).

    Materials

    Name Company Catalog Number Comments
    NEB Stable CompetentE. coli New England BioLabs C3040H
    Carbenicillin, Disodium Salt various
    Zyppy Plasmid Miniprep Kit Zymo Research D4036
    ZymoPURE Plasmid Maxiprep Kit Zymo Research D4202
    SalI-HF New England BioLabs R3138S 20,000 units/ml
    NheI-HF New England BioLabs R3131S 20,000 units/ml
    ApaLI New England BioLabs R0507S 10,000 units/ml
    EcoRI-HF New England BioLabs R3101S 20,000 units/ml
    BamHI-HF New England BioLabs R3136S 20,000 units/ml
    HindIII-HF New England BioLabs R3104S 20,000 units/ml
    illustra TempliPhi 100 Amplification Kit GE Healthcare Life Sciences 25640010
    NucleoSpin Gel and PCR Clean-up Macherey-Nagel 740609.5
    Shrimp Alkaline Phosphatase (rSAP) New England BioLabs M0371S 1,000 units/ml
    Alkaline Phosphatase, Calf Intestinal (CIP) New England BioLabs M0290S 10,000 units/ml
    T4 DNA Ligase New England BioLabs M0202S 400,000units/mL
    HiScribe T7 ARCA mRNA Kit New England BioLabs E2065S
    Vero cells ATCC CCL-81
    ECM 630 High Throughput Electroporation System BTX 45-0423 Other machines are acceptable.
    LB Broth with agar (Miller) Sigma L3147 Can be homemade as well.
    Terrific Broth Sigma T0918 Can be homemade as well.
    Petri Dish Celltreat 229693
    Culture Tubes VWR International 60818-576
    T75 flasks Celltreat 229340
    T182 flasks Celltreat 229350
    1x PBS Corning 21-040-CV
    RPMI 1640 with L-glutamine Corning 10-040-CV
    DMEM with L-glutamine and 4.5 g/L glucose Corning 10-017-CV
    Fetal Bovine Serum (FBS) Atlas Biologicals FP-0500-A
    Tragacanth Powder MP Bio MP 104792
    Crystal Violet Amresco 0528-1006
    Ethanol Denatured VWR International BDH1156-1LP
    6 well plate Celltreat 229106
    12 well plate Celltreat 229111
    Sequencing Oligos IDT see table 1
    Qubit 3.0 ThermoFisher Qubit 3.0 other methods are acceptable.
    Qubit dsDNA BR Assay Kit ThermoFisher Q32850 other methods are acceptable.
    Qubit RNA HS Assay Kit ThermoFisher Q32852 other methods are acceptable.
    Class II Biosafety Cabinet Varies N/A This is necessary for live-virus work.

    DOWNLOAD MATERIALS LIST

    References

    1. Kindhauser, M. K., Allen, T., Frank, V., Santhana, R. S., Dye, C. Zika: the origin and spread of a mosquito-borne virus. Bull World Health Organ. 94, (9), 675C-686C (2016).
    2. Oehler, E., et al. Zika virus infection complicated by Guillain-Barre syndrome--case report, French Polynesia, December 2013. Euro Surveill. 19, (9), (2014).
    3. Li, D., Aaskov, J., Lott, W. B. Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome. PLoS One. 6, (3), e18197 (2011).
    4. Pu, S. Y., et al. A novel approach to propagate flavivirus infectious cDNA clones in bacteria by introducing tandem repeat sequences upstream of virus genome. J Gen Virol. 95, (Pt 7), 1493-1503 (2014).
    5. Pu, S. Y., et al. Successful propagation of flavivirus infectious cDNAs by a novel method to reduce the cryptic bacterial promoter activity of virus genomes. J Virol. 85, (6), 2927-2941 (2011).
    6. Rice, C. M., Grakoui, A., Galler, R., Chambers, T. J. Transcription of infectious yellow fever RNA from full-length cDNA templates produced by in vitro ligation. New Biol. 1, (3), 285-296 (1989).
    7. Yun, S. I., Kim, S. Y., Rice, C. M., Lee, Y. M. Development and application of a reverse genetics system for Japanese encephalitis virus. J Virol. 77, (11), 6450-6465 (2003).
    8. Gualano, R. C., Pryor, M. J., Cauchi, M. R., Wright, P. J., Davidson, A. D. Identification of a major determinant of mouse neurovirulence of dengue virus type 2 using stably cloned genomic-length cDNA. J Gen Virol. 79, (Pt 3), 437-446 (1998).
    9. Johansen, I. E. Intron insertion facilitates amplification of cloned virus cDNA in Escherichia coli while biological activity is reestablished after transcription in vivo. Proc Natl Acad Sci U S A. 93, (22), 12400-12405 (1996).
    10. Shan, C., et al. An Infectious cDNA Clone of Zika Virus to Study Viral Virulence, Mosquito Transmission, and Antiviral Inhibitors. Cell Host Microbe. 19, (6), 891-900 (2016).
    11. Schwarz, M. C., et al. Rescue of the 1947 Zika Virus Prototype Strain with a Cytomegalovirus Promoter-Driven cDNA Clone. mSphere. 1, (5), (2016).
    12. Tsetsarkin, K. A., et al. A Full-Length Infectious cDNA Clone of Zika Virus from the 2015 Epidemic in Brazil as a Genetic Platform for Studies of Virus-Host Interactions and Vaccine Development. MBio. 7, (4), (2016).
    13. Gadea, G., et al. A robust method for the rapid generation of recombinant Zika virus expressing the GFP reporter gene. Virology. 497, 157-162 (2016).
    14. Kapoor, M., Zhang, L., Mohan, P. M., Padmanabhan, R. Synthesis and characterization of an infectious dengue virus type-2 RNA genome (New Guinea C strain). Gene. 162, (2), 175-180 (1995).
    15. Messer, W. B., et al. Development and characterization of a reverse genetic system for studying dengue virus serotype 3 strain variation and neutralization. PLoS Negl Trop Dis. 6, (2), e1486 (2012).
    16. Kinney, R. M., et al. Avian virulence and thermostable replication of the North American strain of West Nile virus. J Gen Virol. 87, (Pt 12), 3611-3622 (2006).
    17. Chang, A. C., Cohen, S. N. Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J Bacteriol. 134, (3), 1141-1156 (1978).
    18. Weger-Lucarelli, J., et al. Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone. J Virol. 91, (1), (2017).
    19. Roberts, P. L., Lloyd, D. Virus inactivation by protein denaturants used in affinity chromatography. Biologicals. 35, (4), 343-347 (2007).
    20. Baer, A., Kehn-Hall, K. Viral concentration determination through plaque assays: using traditional and novel overlay systems. J Vis Exp. (93), e52065 (2014).
    21. Weger-Lucarelli, J., et al. Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone. J Virol. (2016).
    22. Grubaugh, N. D., et al. Genetic Drift during Systemic Arbovirus Infection of Mosquito Vectors Leads to Decreased Relative Fitness during Host Switching. Cell Host Microbe. 19, (4), 481-492 (2016).

    Comments

    0 Comments


      Post a Question / Comment / Request

      You must be signed in to post a comment. Please or create an account.

      Usage Statistics