Redning og karakterisering af rekombinant virus fra en ny verden Zika Virus infektiøs klon

Immunology and Infection

Your institution must subscribe to JoVE's Immunology and Infection section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Denne protokol beskriver genopretningen af ​​infektiøs Zika-virus fra en to-plasmid-infektiøs cDNA-klon.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Weger-Lucarelli, J., Duggal, N. K., Brault, A. C., Geiss, B. J., Ebel, G. D. Rescue and Characterization of Recombinant Virus from a New World Zika Virus Infectious Clone. J. Vis. Exp. (124), e55857, doi:10.3791/55857 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Infektiøse cDNA kloner tillader genetisk manipulation af en virus, hvilket letter arbejdet med vacciner, patogenese, replikation, transmission og viral evolution. Her beskriver vi opførelsen af ​​en infektiøs klon for Zika virus (ZIKV), der i øjeblikket forårsager et eksplosivt udbrud i Amerika. For at forhindre toksicitet for bakterier, der almindeligvis observeres med flavivirus-afledte plasmider, genererede vi et to-plasmidsystem, som adskiller genomet ved NS1-genet og er mere stabilt end konstruktioner i fuld længde, som ikke kunne genoprettes uden mutationer. Efter fordøjelse og ligering for at slutte sig til de to fragmenter, kan viral RNA i fuld længde genereres ved in vitro transkription med T7 RNA polymerase. Efter elektroporation af transkriberet RNA i celler blev virus udvundet, der udviser lignende in vitro vækstkinetik og in vivo virulens- og infektionsfænotyper hos henholdsvis mus og myg.

Introduction

Zika virus (ZIKV; Family Flaviviridae : Genus Flavivirus ) er et mygebårne flavivirus, der ankom til Brasilien i 2013-14 og blev efterfølgende forbundet med et massivt udbrud af feber sygdom, der spredte sig i hele Amerika 1 . Derudover har ZIKV været forbundet med alvorlige sygdomsresultater, såsom Guillain-Barré-syndrom hos voksne og mikrocefalier hos fostre og nyfødte 2 . Lidt var kendt om ZIKV før dets hurtige spredning i den vestlige halvkugle. Dette indbefattede mangel på molekylære værktøjer, hvilket forhindrer mekanistisk forskning. Molekylære værktøjer til virus, såsom infektiøse cDNA kloner, lette vaccine og antiviral terapeutisk udvikling og tillade vurdering af virale genetiske faktorer relateret til differentiel viral patogenese, immunrespons og viral evolution.

Flavivirus infektiøse kloner er kendt for at være yderst ustabile i bakterier på grund af crYptiske prokaryote promotorer til stede i deres genomer 3 . Flere fremgangsmåder er blevet brugt til at lette dette problem; Herunder indsættelse af tandem-gentagelser opstrøms for virussekvenser 4 , mutation af formodede prokaryote promotorsekvenser 5 , splittelse af genomet i multiple plasmider 6 , lavkopi-talvektorer (herunder bakterielle kunstige kromosomer) 7 , 8 og indsættelse af introner i virusgenomet 9 . Et fuldlængdesystem uden ændringer er blevet beskrevet for ZIKV; Denne klon syntes imidlertid at være dæmpet i cellekultur og hos mus 10 . Andre grupper har konstrueret introner i ZIKV-genomet, hvilket tillader afbrydelse af ustabile sekvenser i bakterier, som kan splejses ud i mammale celler in vitro til fremstilling af infektiøs virus 11, 12 . Derudover er et PCR-baseret system med titlen Infektiøs-Subgenomic-Amplicons blevet anvendt med succes til at redde prototypen MR766-stammen af ​​ZIKV 13 . Den fremgangsmåde, der beskrives her, kræver ingen fremmede sekvenser, men forstyrrer snarere genomet i området med høj ustabilitet ved anvendelse af flere plasmider, som tidligere er blevet anvendt succesfuldt med gul feber 6 , dengue 14 , 15 og West Nile vira 16 . Desuden letter tilsætningen af ​​hepatitis D-ribozym-sekvensen ved den virale genomiske termini oprettelsen af ​​en autentisk 3'-ende uden behovet for tilsætning af et lineariseringssted. Derudover konstrueres begge plasmider i en vektor med lav kopiantal (pACYC177, ~ 15 kopier pr. Celle) for at afbøde eventuel resterende toksicitet 17 . Den genvundne virus viser en vækstprofil, der kan sammenlignes medForældrevirus i in vitro vækstkurver i 8 cellelinier omfattende en række celletyper afledt fra både pattedyr og insekter og har udvist identiske patogene profiler i mus og infektion, spredning og transmissionshastigheder i myg 18 .

Heri beskriver vi en protokol, der beskriver, hvordan man dyrker de infektiøse klonplasmider, genererer viral RNA (viral genomet) i fuld længde, in vitro og genvinder infektiøs virus i cellekultur. For det første beskriver vi udbredelsen af ​​plasmider i bakterier eller bakteriefri amplifikation ved anvendelse af rullende cirkelforstærkning (RCA). Dernæst viser vi, hvordan de to plasmider fordøjes og derefter ligeres sammen for at generere virus i fuld længde. Endelig beskriver vi produktionen af ​​transkriberet RNA og dets efterfølgende elektroporation i Vero-celler efterfulgt af titrering af genvundet virus ( Figur 1 ). Den beskrevne fremgangsmåde er hurtig, hvilket tillader foR opsving af infektiøse virusbestande i 1-2 uger.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Transformation og gendannelse af infektiøse klonplasmider

  1. Transform begge plasmider (separat) ved hjælp af en kommerciel transformationsprotokol ( f.eks . NEB 5 minutters transformationsprotokol) med nogle ændringer. Begge plasmider indeholder et gen, som koder for ampicillinresistens, derfor anvend ampicillin eller carbenicillin til udvælgelse. Carbenicillin foretrækkes, da det er mere stabilt.
    1. Fjern celler (se materialetabel) fra -80 ° C fryser og optø på is i 5-10 minutter. Prewarm lysogeny bouillon (LB) (indeholdende 10 g / l NaCl og 25 μg / ml carbenicillin, kaldet LB-carb) plader og bouillon med katabolitundertrykkelse (SOC (uden antibiotika) - kommer med cellerne) ved 37 ° C.
    2. Tilsæt mellem 100 pg-10 ng i 1 μl plasmid-DNA til et rør indeholdende 50 μl kompetente celler; Bland forsigtigt ved at flippe røret.
    3. Inkubér rør på is i 5 minutter.
    4. Varmechokrør ved 42 ° C i 30 sI et vandbad. Tilbage til is i 2 minutter umiddelbart efter varmechok.
    5. Pipetter 950 μL stuetemperatur SOC i hvert rør og bland ved pipettering. Spred 100 μl bakterieblandingen på en LB-carb-plade og inkuber natten over ved 37 ° C (ca. 12-14 timer).
  2. Fjern plader fra 37 ° C inkubator efter 12-14 h inkubation. Placer plader i en mørk skuffe ved stuetemperatur for at give kolonierne mulighed for at fortsætte med at vokse (ca. 8-9 timer).
  3. Ved anvendelse af 5 ml Terrific bouillon (TB, der indeholder 25 μg / ml carbenicillin, kaldet TB-carb) vokser 5-10 små kolonier for hvert plasmid natten over ved 30 ° C i en bakteriel ryster (ca. 14-16 timer).
    BEMÆRK: Små kolonier er en indikator for, at plasmidet er intakt; Kolonier med plasmider indeholdende deletioner, omlejringer eller mutationer (heri kaldet ustabilitetshændelser) vil vokse hurtigere og således være større. Derfor bør man forsøge at vælge de mindste kolonier på pladen, specifikt nejT vælge de største kolonier til stede. Nogle mellemstore kolonier kan også vælges for fuldstændighed. Den lavere temperatur, der anvendes, reducerer sandsynligheden for, at cellerne vil vokse (OD 600 større end 0,6-0,8). Da de fleste forskere udfører over natten vækst, giver det mulighed for mere kontrol og reduceret chance for overgroning.
  4. Kontroller væskekulturer for turbiditet (ca. OD 600 på 0,6-0,8). Anbring eventuelle uklare rør ved 4 ° C og lad andre rør blive grumle ved at vokse i længere tid.
    BEMÆRK: Udvikl ikke bakterier til OD 600- værdier, der er større end anbefalet, da der kan opstå plasmidstabilitetshændelser.
  5. Ekstraher plasmid DNA fra bakterier med et kommercielt plasmid miniprep kit (Se Materialebord). Elueres i 15 μl forvarmet (til 70 ° C i en varmeblok) elueringsbuffer. Lad elueringsbufferen inkuberes på søjlen i 5 minutter før centrifugering.
    BEMÆRK: Bevar mindst 1 ml af denne starterkultur ved 4 ° C forYderligere brug i næste trin.
  6. Fordel 10 μL de udvundne plasmider for at vurdere, om plasmidstabilitetshændelser forekom under dyrkning.
    BEMÆRK: Fordøj p1 med SalI / NheI og p2 med BamHI / HindIII ved 37 ° C i 1 time. Bekræft tilstedeværelsen af ​​de korrekte bånd efter fordøjelsen ( figur 2a ) ved gelelektroforese og fortsæt til trin 2. Hvis du fremstiller plasmid-DNA ved hjælp af rullende cirkelamplifikation (RCA), skal du reservere nogle af miniprepeluatet for at fungere som en skabelon.

2. Fremstilling af tilstrækkeligt plasmid DNA til ligning

BEMÆRK: Ligering og efterfølgende elektroporation kræver en tilstrækkelig mængde plasmid-DNA, som skal genereres via enten maxiprep eller RCA. Mens maxiprep er den traditionelt anvendte tilgang, giver RCA fordelen af ​​ikke at kræve bakterier, hvorved potentialet for plasmidinduceret toksicitet i bakterier fjernes, hvilket kan medføre ustabilitetshændelser.

  1. For hvert plasmid, der viste det korrekte restriktionsenzymfordøjelsesmønster i det foregående afsnit, tilsættes 500 μl starterkultur til 1 liter TB-Carb (25 μg / ml carbenicillin) bouillon og omrystes natten over ved 30 ° C (ca. 14-16 h , Omtrent OD 600 på 0,6-0,8).
    BEMÆRK: Lad ikke kulturen vokse over denne OD 600- værdi. Dette vil potentielt resultere i ustabilitetshændelser inden for plasmiderne.
  2. Høst bakterierne og udfør maxipreps pr. Producentens protokol (Se Materialebord).
  • Brug den gemte miniprep fra trin 1.6, udfør følgende for RCA-proceduren.
    1. Overfør 1 μl plasmid-DNA til et rør indeholdende 50 μl prøvebuffer.
    2. Opvarm prøven ved 95 ° C i 3 minutter, og inkuber derefter ved 4 ° C indtil klar til brug.
    3. Forbered den kommercielle amplifikationForblanding (se materialetabel ). Kombiner 50 μl reaktionsbuffer med 2 μl enzymblanding i et rør på is.
      BEMÆRK: Forstærkning forblandingen skal opbevares på is, indtil den er klar til brug. Det er hensigtsmæssigt at fremstille en masterblanding ved at kombinere tilstrækkelige reagenser til det nødvendige antal amplificeringsreaktioner. Enhver ubrugt premix skal kasseres.
    4. Overfør 50 μl fremstillet amplifikationsforblanding til den denaturerede prøve.
    5. Inkuber reaktionsrørene ved 30 ° C i 18 timer.
    6. Inkuber rørene ved 65 ° C i 10 minutter for at inaktivere ø29 DNA-polymerasen.
    7. Opbevar reaktionsrørene ved 4 ° C eller -20 ° C indtil de er klar til brug.
      BEMÆRK: På dette tidspunkt bør plasmid DNA fremstillet ved begge metoder kvantificeres (ved anvendelse af absorbans ved 260 nm), og ZIKV-genomet bør være Sanger-sekventeret fuldstændigt for at bekræfte, at der ikke opstod ustabilitetshændelser (deletioner og omlejringer) under forberedelsen.
  • Primer Navn Sekvens (5 '- 3')
    ZIKV PRVABC59 1For. AGTTGTTGATCTGTGTGAATCAGAC
    ZIKV konserveret 632For. GCCCTATGCTGGATGAGG
    ZIKV konserveret 692Rev. GGTTCCGTACACAACCCAAGTTG
    ZIKV konserveret 1313Rev. CTCCCTTTGCCAAAAAGTCCACA
    ZIKV konserverede 1201For. CCAACACAAGGTGAAGCCTAC
    ZIKV konserveret 1663For. GCAGACACCGGAACTCCACACT
    ZIKV konserverede 2008For. CAGATGGCGGTGGACATGC
    ZIKV konserveret 2350Rev. GTGAGAACCAGGACATTCCTCC
    ZIKV konserveret 2605For. TACAAGTACCATCCTGACTCCC
    ZIKV konserveret 3499Rev. GCCTTATCTCCATTCCATACCA
    ZIKV konserveret 3961Rev. TTGCCAACCAGGCCAAAG
    ZIKV konserveret 4132For. CATTTGTCATGGCCCTGG
    ZIKV konserveret 4561Rev. CTATTGGGTTCATGCCACAGAT
    ZIKV konserveret 4665For. GACCACAGATGGAGTGTACAGAGT
    ZIKV konserveret 5189Rev. AAGACAGTTAGCTGCTTCTTCTTCAG
    ZIKV konserveret 5219For. GAGAGTTCTTCCTGAAATAGTCCGTGA
    ZIKV konserveret 6086Rev. CTTGCTTCAAGCCAGTGTGC
    ZIKV konserveret 6119For. GCCTCATAGCCTCGCTCTATCG
    ZIKV konserveret 6721Rev. CCATTCCAAAGCCCATCTTCCC
    ZIKV konserveret 6769For. CCAGCCAGAATTGCATGTGTCC
    ZIKV konserveret 7209Rev. ATCATTAGCAGCGGGACTCCAA
    ZIKV konserveret 7343For. GTTGTGGATGGAATAGTGGT
    ZIKV konserveret 8243For. TGCCCATACACCAGCACTATGA
    ZIKV PRVABC59 8893Rev. TGCATTGCTACGAACCTTGTTG
    ZIKV konserverede 9133For. AGCCCTTGGATTCTTGAACGAGGA
    ZIKV PRVABC59 9673Rev. AACGCAATCATCTCCACTGACT
    ZIKV konserverede 9686For. GATGATAGGTTTGCACATGCC
    ZIKV konserveret 10321Rev. GTCCATGTACTTTTCTTCATCACCTAT
    ZIKV konserveret 10455For. CAGGAGAAGCTGGGAAACC
    ZIKV konserveret 10621Rev. CAGATTGAAGGGTGGGGAAGGTC

    Tabel 1: Primerer til sekventering af cDNA kloner. Plasmider kan sekventeres fuldstændigt med de angivne primere. Primers mærket som "konserveret" indiCate at de sandsynligvis er i stand til at sekvensere / forstærke alle genotyper af ZIKV. Primers mærket "PRVABC59" er specifikke for denne stamme, men kan også fungere for andre asiatiske genotypestammer og muligvis andre genotyper.

    3. Fremstilling af in vitro- transkriberet RNA

    1. Opsæt fordøjelsesreaktion af enten maxiprep eller RCA-præpareret DNA.
      1. Til pl-fordøjelse blandes 10 μl 10x reaktionsbuffer, 3 μl ApaLI, 3 μl BamHI-HF, 3 μl rSAP eller CIP og 3,3 μg p1 DNA. Tilsæt ddH20 til 100 μl.
      2. Til p2-fordøjelse blandes 10 μl 10x reaktionsbuffer, 3 μl ApaLI, 3 μl EcoRI-HF og 13,3 μg p2-DNA. Tilsæt ddH20 til 100 μl.
      3. Inkuber ved 37 ° C i 1-2 timer.
      4. Rens med brug af et kommercielt gel- og PCR-oprydningssæt (Se Materialebord). Eluer i 30 μl elueringspuffer forvarmet til 70 ° C i en varmeblok (inkuber denKolonne i 5 minutter før spinding).
        BEMÆRK: Opbevar 1 μL for at køre på en gel senere.
    2. Forbered ligeringsreaktion.
      1. Kombiner 10 μl 10x T4 DNA ligerings reaktionsbuffer, 3 μl T4 DNA ligase (400 U / μl), 29 μl renset p1 og 29 μl renset p2. Tilsæt ddH20 til 100 μl.
      2. Inkubér ved stuetemperatur i 2 timer eller 16 ° C natten over.
      3. Rens med brug af et kommercielt gel- og PCR-oprydningssæt (Se Materialebord). Eluer i 10 μl elueringspuffer forvarmet til 70 ° C i en varmeblok (inkubatkolonne i 5 minutter før spinding).
        BEMÆRK: Opbevar 1 μL for at køre på en gel senere.
    3. Kør ufordøjede plasmider, fordøjede plasmider og ligering på en agarosegel. Ligeringsproduktet skulle have et bånd med højere molekylvægt (ca. 11 kb) end enten fordøjet plasmid alene, hvilket indikerer ligeringen var vellykket ( figur 2b ).
    4. Opsæt T7 in vitro transkriptionsreaktion.
      1. Kombiner 10 μl 2x ARCA / NTP-blanding, 2 μl T7-RNA-polymerasemix og 8 μl renset ligeringsreaktion for et slutvolumen på 20 μl.
        BEMÆRK: ARCA inkluderet i mixen er en hue analog, der udelukkende er indarbejdet i den korrekte orientering. Standard cap analoger kan resultere i kun ~ 50% af transkripterne har en hætte i den korrekte orientering.
      2. Inkuber i 4 timer ved 37 ° C.
      3. Mål RNA-koncentration via et UV-spektrofotometer. Kør eventuelt en denaturerende agarosegel for at bekræfte længden af ​​RNA-transkriptet.

    4. Redning af smitsom virus ved elektroporation

    1. Dage forud for elektroporation fremstilles 1 T182-kolbe af Vero-celler (mellem T150 og T182 er acceptabel, dyrket i DMEM + 10% føtalt bovint serum (FBS)) pr. Konstruktion, der skal udvindes. Inkluder 1 T182 som en stødtransfektionskontrol. CeLls bør anvendes ved 70-80% konfluens.
    2. Når cellerne er klare, anbringes 12 ml / reaktion af DMEM + 15% FBS + 10 mM HEPES i et vandbad opvarmet til 37 ° C.
    3. Fjern cellerne ved trypsinisering med en standardprotokol og genindvind cellerne i medier med 10% FBS for at inaktivere trypsin; Centrifugere celler ved 150 xg i 5 minutter ved 4 ° C.
    4. Vask celler i 1x phosphatbufret saltopløsning (PBS), pelleteringsceller ved 150 xg i 5 minutter ved 4 ° C. Gentag dette trin to gange for i alt tre vasker.
    5. Resuspender cellerne i 200 μl RPMI 1640 + 10 mM HEPES (steril) pr. Antal prøver. Overfør 200 μl cellesuspension til et sterilt rør. Celler bør være ~ 0,5 x 107 celler / ml.
    6. Tilsæt 20 μl vand (mock neg. Kontrol) eller 20 μL RNA (fortrinsvis 5-10 μg) produceret i trin 3.4 til hvert sæt celler. Bland forsigtigt ved at pege på røret og overføre rørets indhold til en 2 mm hul elektroporationskuvette.
    7. Indstil en elektrOporator til 170 V LV, omega (modstand) ved 0 og 950 μF (ca. 625 V / cm og 20 ms tidskonstant for andre maskiner). Indstil modstand mod den laveste tilgængelige indstilling, enten 0 eller ∞ hvis det er ledigt.
    8. Pulsen tilsættes øjeblikkeligt 600 μl DMEM +15% FBS + 10 mM HEPES, som blev opvarmet i trin 4.2. Skyl inde i kyvetten grundigt for at fjerne alle celler. Tilsæt celler til en T75 vævskulturkolbe indeholdende 10 ml forvarmet medium. Fjern yderligere medier fra kuvetten ved at bruge den dropper, der følger med kuvetten. Pas på at opretholde sterilitet.
    9. Vaskekolbe for at blande medier og celler og placere i 37 ° C inkubator.
    10. Tjek den næste dag for celle levedygtighed, og gør det hver dag indtil 50-75% celledød er observeret. Celledød observeres ved at sammenligne med den mock elektroporerede kontrol.
      BEMÆRK: ZIKV-cytopatisk effekt (CPE) er ret udtalt i Vero-celler, hvilket resulterer i afrundede celler, der løsner og flyder i dyrkningsmediet. Vi harObserveret en rækkevidde på 8-10 dage som ideel til høst.
    11. Høst supernatant i et konisk rør og centrifuge for at fjerne cellulære affald ved> 3000 xg i 10 minutter ved 4 ° C.
    12. Fjern klaret supernatant til et nyt rør og suppler med en slutkoncentration på 20% FBS (fra 100% lager). Derudover tilsættes sterile HEPES i en slutkoncentration på 10 mM som et buffermiddel for at bevare virusinfektivitet under frosning (fra en 1 M steril bestand).
    13. Bland virus ved vortexing og alikvot i skruehætteglas. Opbevares ved -80 ° C til senere brug.

    5. Titrering af genvundet virus

    1. Se det passende antal 6- eller 12-brøndsplader af Vero-celler dagen før titrering.
    2. Fjern virus fra fryseren og lav serielle 10-gange fortyndinger i DMEM + 2% FBS i rør eller 96-brønds plader.
      BEMÆRK: Den forventede titer fra genvundne kloner er mellem 1 x 106 og 5 x 107 PFU / ml.
    3. Tilføj 200 oR 400 μl af hver fortynding i to eksemplarer til en brønd på henholdsvis en 12- eller 6-brønds plade.
    4. Placer plader i 37 ° C inkubator og rock hver 15 min, i alt ~ 1-1,5 h adsorptionsperiode.
    5. Fjern viral inokulum og tilsæt 1 ml (12 brønd) eller 2 ml (6 brønd) DMEM-Tragacanth overlay til hver brønd.
      BEMÆRK: Det er muligt at bruge agarose, agar, methylcellulose eller andre overlay medier her.
    6. Inkubér celler i 37 ° C inkubator i 5 dage. Tiden for korrekt plackdannelse varierer afhængigt af det anvendte overlag.
    7. For at rette celler skal du fjerne plader fra inkubator og dekantere overlejringen forsigtigt i desinfektionsmiddel.
    8. Tilsæt tilstrækkeligt 20% ethanol / 0,1% krystalviolet (CV) til hver brønd for at dække og hvirvle for at blande.
      BEMÆRK: Der findes mange andre fixativer og kan bruges her. Hvis en agarose eller agaroverlejring anvendes, kan en anden overlejring også bruges sammen med neutral rød til at visualisere plaques uden fiksering. 20% ethanol har vist sig at væreEffektiv til inaktivering af omsluttede vira i tidligere undersøgelser; Brug ikke dette beløb til ikke-indkapslede vira, da de ikke vil blive inaktiveret 19 .
    9. Inkuber plader i 30-60 minutter ved stuetemperatur (i et klasse II biosikkerhedsskabe); Kassér CV (pr. Lokale bestemmelser) og vaskeplader med ledningsvand.
    10. Lad pladerne tørre, og tæller manuelt manuelt.
      BEMÆRK: Reference 20 kan bruges som en yderligere reference til udførelse af plaqueanalyser.

    Subscription Required. Please recommend JoVE to your librarian.

    Representative Results

    Protokollen beskrevet her muliggør genvinding af infektiøs klonafledt Zika-virus. Manipulering af det to-plasmid-infektiøse klonsystem er ligetil, når det udføres forsigtigt i sammenligning med versioner af fuld længde, der er stærkt ustabile (data ikke vist). Efter fordøjelse og ligering af de to adskilte stykker fremstilles afkortet RNA ved anvendelse af in vitro- transkription med T7-polymerase, som derefter elektroporeres i Vero-celler ( figur 1 ). Korrekt plasmidsekvens kan overvåges under anvendelse af restriktionsfordøjelse som proxy efter miniprep ( Figur 2a ) og via Sanger-sekventering efter storskala DNA-produktion med RCA eller maxiprep. Efter bekræftelse af klonerne ved sekventering kræver genvinding af infektiøs virus kun fordøjelse, ligering, in vitro transkription og endelig elektroporation. Disse trin kan udføres på en dag. Korrekt digeStion og ligering kan overvåges ved agarosegelelektroforese ( figur 2b ), hvilket muliggør fejlfinding, hvis det er nødvendigt.

    Som vist i figur 3 replikerer infektiøs klonafledt virus til lignende niveauer som forældremolekylet in vitro i adskillige cellelinier, hvilket tyder på, at den genvundne virus fra cDNA'et replikerer på samme måde som primærisolatet. Der blev heller ikke observeret signifikante forskelle mellem det infektiøse klonafledte virus og det forældres isolat i overlevelseshastigheder hos mus eller infektionshastigheder, spredning og transmission i Aedes aegypti- myg ( figur 4 ).

    figur 1
    Figur 1: Workflow af ZIKV-redning fra en to-plasmid cDNA klon.Genomet af ZIKV-stamme PRVABC59 blev klonet i to-separate stykker i en pACYC177-plasmid-rygrad. De to plasmider blev derefter fordøjet og ligeret med T4 DNA ligase. Capped-infectious RNA blev derefter produceret via in vitro transkription efterfulgt af elektroporation i Vero celler. (Figur tilpasset fra reference 21 ). Klik her for at se en større version af denne figur.

    Figur 2
    Figur 2: Gelelektroforese til overvågning af fordøjelse og ligering af cDNA-klon. ( A ) Initial restriktionsfordøjelse af miniprep-afledte plasmider for at vurdere genetisk stabilitet. ( B ) Eksempler på fordøjelses- og ligeringsprodukter under udvinding af infektiøs virus fra to-plasmidklonsystemet. Href = "http://ecsource.jove.com/files/ftp_upload/55857/55857fig2large.jpg" target = "_ blank"> Venligst klik her for at se en større version af denne figur.

    Figur 3
    Figur 3: In vitro vækstkinetik af klonafledt virus. Vækstkinetik af vildtype PRVABC59 og infektiøs klonafledt virus på humant (SH-SY5Y, Jar og NTERA2 cI.D1), myg (C6 / 36, Aag2) og ikke-humant primat (Vero) cellelinier blev vurderet ved plaque assay. N = 3 Fejlstænger repræsenterer standardafvigelse fra middelværdien. (Figur tilpasset fra reference 21 ). Klik her for at se en større version af denne figur.

    55857fig4.jpg "/>
    Figur 4: In vivo karakterisering af klonafledt virus i mus og myg. ( A ) 4 uger gamle interferon alpha, beta og gamma receptor knockout, AG129, mus blev intraperitonealt podet med 1000 PFU af PRVABC59 eller den infektiøse klonafledte virus og overvåges over tid for overlevelse (n = 11). Aedes aegypti myg blev givet et infektiøst blodmælk indeholdende ZIKV og dissekeret 14 dage senere. ( B ) Plaque assays blev brugt til at vurdere myggenlegemer (infektion), ben (spredning) eller spytkødssekretioner (transmission) for infektiøs virus. Priser præsenteres som procenten af ​​de samlede myg, der blev testet (Figur tilpasset fra reference 21 ). Klik her for at se en større version af denne figur.

    Subscription Required. Please recommend JoVE to your librarian.

    Disclosures

    Forfatterne har intet at afsløre.

    Acknowledgments

    Forfatterne vil gerne takke Kristen Bullard-Feibelman, Milena Veselinovic og Claudia Rückert for deres hjælp til at karakterisere den klonafledte virus. Dette arbejde blev delvist støttet af tilskud fra National Institute of Allergy and Infectious Diseases, NIH under tilskud AI114675 (BJG) og AI067380 (GDE).

    Materials

    Name Company Catalog Number Comments
    NEB Stable CompetentE. coli New England BioLabs C3040H
    Carbenicillin, Disodium Salt various
    Zyppy Plasmid Miniprep Kit Zymo Research D4036
    ZymoPURE Plasmid Maxiprep Kit Zymo Research D4202
    SalI-HF New England BioLabs R3138S 20,000 units/ml
    NheI-HF New England BioLabs R3131S 20,000 units/ml
    ApaLI New England BioLabs R0507S 10,000 units/ml
    EcoRI-HF New England BioLabs R3101S 20,000 units/ml
    BamHI-HF New England BioLabs R3136S 20,000 units/ml
    HindIII-HF New England BioLabs R3104S 20,000 units/ml
    illustra TempliPhi 100 Amplification Kit GE Healthcare Life Sciences 25640010
    NucleoSpin Gel and PCR Clean-up Macherey-Nagel 740609.5
    Shrimp Alkaline Phosphatase (rSAP) New England BioLabs M0371S 1,000 units/ml
    Alkaline Phosphatase, Calf Intestinal (CIP) New England BioLabs M0290S 10,000 units/ml
    T4 DNA Ligase New England BioLabs M0202S 400,000units/mL
    HiScribe T7 ARCA mRNA Kit New England BioLabs E2065S
    Vero cells ATCC CCL-81
    ECM 630 High Throughput Electroporation System BTX 45-0423 Other machines are acceptable.
    LB Broth with agar (Miller) Sigma L3147 Can be homemade as well.
    Terrific Broth Sigma T0918 Can be homemade as well.
    Petri Dish Celltreat 229693
    Culture Tubes VWR International 60818-576
    T75 flasks Celltreat 229340
    T182 flasks Celltreat 229350
    1x PBS Corning 21-040-CV
    RPMI 1640 with L-glutamine Corning 10-040-CV
    DMEM with L-glutamine and 4.5 g/L glucose Corning 10-017-CV
    Fetal Bovine Serum (FBS) Atlas Biologicals FP-0500-A
    Tragacanth Powder MP Bio MP 104792
    Crystal Violet Amresco 0528-1006
    Ethanol Denatured VWR International BDH1156-1LP
    6 well plate Celltreat 229106
    12 well plate Celltreat 229111
    Sequencing Oligos IDT see table 1
    Qubit 3.0 ThermoFisher Qubit 3.0 other methods are acceptable.
    Qubit dsDNA BR Assay Kit ThermoFisher Q32850 other methods are acceptable.
    Qubit RNA HS Assay Kit ThermoFisher Q32852 other methods are acceptable.
    Class II Biosafety Cabinet Varies N/A This is necessary for live-virus work.

    DOWNLOAD MATERIALS LIST

    References

    1. Kindhauser, M. K., Allen, T., Frank, V., Santhana, R. S., Dye, C. Zika: the origin and spread of a mosquito-borne virus. Bull World Health Organ. 94, (9), 675C-686C (2016).
    2. Oehler, E., et al. Zika virus infection complicated by Guillain-Barre syndrome--case report, French Polynesia, December 2013. Euro Surveill. 19, (9), (2014).
    3. Li, D., Aaskov, J., Lott, W. B. Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome. PLoS One. 6, (3), e18197 (2011).
    4. Pu, S. Y., et al. A novel approach to propagate flavivirus infectious cDNA clones in bacteria by introducing tandem repeat sequences upstream of virus genome. J Gen Virol. 95, (Pt 7), 1493-1503 (2014).
    5. Pu, S. Y., et al. Successful propagation of flavivirus infectious cDNAs by a novel method to reduce the cryptic bacterial promoter activity of virus genomes. J Virol. 85, (6), 2927-2941 (2011).
    6. Rice, C. M., Grakoui, A., Galler, R., Chambers, T. J. Transcription of infectious yellow fever RNA from full-length cDNA templates produced by in vitro ligation. New Biol. 1, (3), 285-296 (1989).
    7. Yun, S. I., Kim, S. Y., Rice, C. M., Lee, Y. M. Development and application of a reverse genetics system for Japanese encephalitis virus. J Virol. 77, (11), 6450-6465 (2003).
    8. Gualano, R. C., Pryor, M. J., Cauchi, M. R., Wright, P. J., Davidson, A. D. Identification of a major determinant of mouse neurovirulence of dengue virus type 2 using stably cloned genomic-length cDNA. J Gen Virol. 79, (Pt 3), 437-446 (1998).
    9. Johansen, I. E. Intron insertion facilitates amplification of cloned virus cDNA in Escherichia coli while biological activity is reestablished after transcription in vivo. Proc Natl Acad Sci U S A. 93, (22), 12400-12405 (1996).
    10. Shan, C., et al. An Infectious cDNA Clone of Zika Virus to Study Viral Virulence, Mosquito Transmission, and Antiviral Inhibitors. Cell Host Microbe. 19, (6), 891-900 (2016).
    11. Schwarz, M. C., et al. Rescue of the 1947 Zika Virus Prototype Strain with a Cytomegalovirus Promoter-Driven cDNA Clone. mSphere. 1, (5), (2016).
    12. Tsetsarkin, K. A., et al. A Full-Length Infectious cDNA Clone of Zika Virus from the 2015 Epidemic in Brazil as a Genetic Platform for Studies of Virus-Host Interactions and Vaccine Development. MBio. 7, (4), (2016).
    13. Gadea, G., et al. A robust method for the rapid generation of recombinant Zika virus expressing the GFP reporter gene. Virology. 497, 157-162 (2016).
    14. Kapoor, M., Zhang, L., Mohan, P. M., Padmanabhan, R. Synthesis and characterization of an infectious dengue virus type-2 RNA genome (New Guinea C strain). Gene. 162, (2), 175-180 (1995).
    15. Messer, W. B., et al. Development and characterization of a reverse genetic system for studying dengue virus serotype 3 strain variation and neutralization. PLoS Negl Trop Dis. 6, (2), e1486 (2012).
    16. Kinney, R. M., et al. Avian virulence and thermostable replication of the North American strain of West Nile virus. J Gen Virol. 87, (Pt 12), 3611-3622 (2006).
    17. Chang, A. C., Cohen, S. N. Construction and characterization of amplifiable multicopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J Bacteriol. 134, (3), 1141-1156 (1978).
    18. Weger-Lucarelli, J., et al. Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone. J Virol. 91, (1), (2017).
    19. Roberts, P. L., Lloyd, D. Virus inactivation by protein denaturants used in affinity chromatography. Biologicals. 35, (4), 343-347 (2007).
    20. Baer, A., Kehn-Hall, K. Viral concentration determination through plaque assays: using traditional and novel overlay systems. J Vis Exp. (93), e52065 (2014).
    21. Weger-Lucarelli, J., et al. Development and Characterization of Recombinant Virus Generated from a New World Zika Virus Infectious Clone. J Virol. (2016).
    22. Grubaugh, N. D., et al. Genetic Drift during Systemic Arbovirus Infection of Mosquito Vectors Leads to Decreased Relative Fitness during Host Switching. Cell Host Microbe. 19, (4), 481-492 (2016).

    Comments

    0 Comments


      Post a Question / Comment / Request

      You must be signed in to post a comment. Please or create an account.

      Usage Statistics