Ein Protokoll für mehrfache Gen-Knockout in Maus-Dünndarm-Organoiden mit einem CRISPR-Concatemer

Bioengineering
 

ERRATUM NOTICE

Summary

Dieses Protokoll beschreibt die Schritte zum Klonieren von mehreren einzelnen Leitungs-RNAs in einen Leitfaden-RNA-Concatemer-Vektor, der von besonderem Nutzen bei der Herstellung von Multi-Gen-Knockouts unter Verwendung der CRISPR / Cas9-Technologie ist. Die Erzeugung von Doppelknockouts in Darmorganoiden wird als mögliche Anwendung dieser Methode gezeigt.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Merenda, A., Andersson-Rolf, A., Mustata, R. C., Li, T., Kim, H., Koo, B. K. A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer. J. Vis. Exp. (125), e55916, doi:10.3791/55916 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

CRISPR / Cas9-Technologie hat die Machbarkeit und Geschwindigkeit von Verlust-von-Funktions-Studien, die für das Verständnis der Genfunktion wesentlich sind, erheblich verbessert. In höheren Eukaryonten können paralogische Gene einen potentiellen Phänotyp maskieren, indem sie den Verlust eines Gens kompensieren und so die Informationen einschränken, die aus genetischen Studien gewonnen werden können, die sich auf einzelne Gen-Knockouts stützen. Wir haben eine neuartige, schnelle Klonierungsmethode für Guide RNA (gRNA) Concatemer entwickelt, um Multi-Gen-Knockouts nach einer einzigen Transformationsrunde in Maus-Dünndarm-Organoiden zu erzeugen. Unsere Strategie ermöglicht die Concatemerisierung von bis zu vier einzelnen gRNAs in einen einzigen Vektor durch die Durchführung einer einzigen Golden Gate Shuffling Reaktion mit geglühten gRNA Oligos und einem vordefinierten retroviralen Vektor. Dies ermöglicht entweder das gleichzeitige Knockout von bis zu vier verschiedenen Genen oder eine erhöhte Knockout-Effizienz nach dem Targeting eines Gens durch mehrere gRNAs. In diesem Protokoll zeigen wir im DetailWie man effizient mehrere gRNAs in den retroviralen CRISPR-Concatemer-Vektor kloniert und wie man eine hocheffiziente Elektroporation in intestinalen Organoiden erreicht. Als Beispiel zeigen wir, dass das gleichzeitige Knockout von zwei Paaren von Genen, die für negative Regulatoren des Wnt-Signalwegs (Axin1 / 2 und Rnf43 / Znrf3) kodieren, Darmorganoide resistent gegen den Rückzug der wichtigsten Wachstumsfaktoren macht.

Introduction

Der Reverse Genetics Ansatz ist eine weit verbreitete Methode zur Untersuchung der Funktion eines Gens. Insbesondere spielen Funktionsstörungen, bei denen die Störung eines Gens phänotypische Veränderungen verursacht, eine Schlüsselrolle beim Aufbau unseres Verständnisses für biologische Prozesse. Die CRISPR / Cas9-Methode stellt den jüngsten Fortschritt in der Genomtechnik dar und hat die derzeitige Praxis der Genetik in Zellen und Organismen revolutioniert. Cas9 ist eine RNA-geführte Endonuklease, die an eine spezifische DNA-Sequenz, die komplementär zur gRNA ist, bindet und einen Doppelstrangbruch (DSB) erzeugt. Dieser DSB rekrutiert DNA-Reparaturmaschinen, die in Abwesenheit einer DNA-Matrize für homologe Rekombination den geschnittenen DNA-Strang durch fehleranfällige nicht-homologe Endverknüpfung wieder ligieren, was zu Insertionen oder Deletionen von Nukleotid (en) führen kann, Verursacht Frameshift Mutationen 1 .

Die große Leichtigkeit und Vielseitigkeit der CRISPR / Cas9 ApprOach hat es zu einem äußerst attraktiven Werkzeug für Genom-Scockout-Bildschirme gemacht, die darauf abzielen, unbekannte Genfunktionen 2 , 3 zu entschlüsseln. Dennoch sind einzelne Gen-Knockout-Ansätze von begrenzter Nutzung, wenn mehrere Paralogs mit redundanten Funktionen existieren. Somit könnte ein einzelnes Gen Ablatieren nicht ausreicht , um die Funktion dieses Gens möglicher Ausgleich durch Paraloge zu wenig oder keine phänotypische Veränderung führt gegeben 4 zu bestimmen. Es ist daher wichtig, Paralogs parallel zu schlagen, indem man mehrere gRNA-Vektoren liefert, die auf die verschiedenen paralogen Gene abzielen, um den Einfluss der genetischen Kompensation zu überwinden.

Um die Verwendung von CRISPR / Cas9 auf paraloges Gen-Knockout zu erweitern, haben wir vor kurzem eine schnelle, einstufige Klonierungsmethode entwickelt, um bis zu vier vorgeglühte gRNAs in einen einzigen retroviralen Vektor 5 zu klonieren. Das Rückgrat namens CRISPR-concatemer basiertAuf einem MSCV-retroviralen Plasmid, das repetitive gRNA-Expressionskassetten enthält. Jede Kassette enthält zwei invertierten Erkennungsstellen der Typ IIS - Restriktionsenzym BbsI, das irreversibel von einem geglühten gRNA oligo mit passenden Überhänge unter Verwendung eines Shuffling Golden Gate - Reaktion in einem einzigen Röhrchen 6 ersetzt werden können. Diese Klonierungsmethode besteht aus sich wiederholenden Zyklen der Verdauung und Ligation, die die gleichzeitige Assemblierung mehrerer DNA-Fragmente ermöglichen, indem sie die von Bbs I erzeugten verschiedenen Überhangsequenzen ausnutzen . Die Einzigartigkeit dieses Enzyms ist beispielsweise die Fähigkeit, asymmetrische Schnitte außerhalb seiner Erkennung durchzuführen Sequenz; Daher kann jede Kassette eine andere Sequenz mit kundenspezifischen Überhängen haben, die die Bbs- I- Kernstelle flankieren und auf diese Weise jede gRNA in einer bestimmten Position und Orientierung des Concatemer-Vektors kloniert werden kann.

Als Nachweis des Prinzips haben wir die Verwendung dieser Strategie inMaus-Darm-Organoide durch gleichzeitige Unterbrechung gleichzeitig zwei Paare paraloger Negativregulatoren des Wnt-Weges durch eine Elektroporationsebene 5 .

In den vergangenen Jahren haben viele andere Gruppen ähnliche Strategien entwickelt, die auf mehreren gRNA-Expressionsvektoren basieren, die unter Verwendung von Golden Gate-Shuffling 7 konstruiert wurden, um ein Multi-Gen-Knockout in verschiedenen Modellsystemen wie den menschlichen Zelllinien 8 , 9 , Zebrafisch 10 und Escherichia coli zu erreichen 11 In ihren Protokollen werden gRNAs zuerst in einzelne Zwischenvektoren kloniert und dann zu einem Endprodukt zusammengebaut. Im Gegensatz dazu ist der Hauptvorteil unserer CRISPR-Concatemer-Strategie die Bequemlichkeit eines einzelnen Bbs I Shuffling, Klonierungsschritt. Wie andere gRNA-Concatemer, ermöglicht unsere Methode entweder die gleichzeitige Knockout von bis zu vierVerschiedene Gene oder erhöhte CRISPR-Knockout-Effizienz nach dem Targeting von ein oder zwei Genen mit mehreren gRNAs ( Abbildung 1 ).

In diesem Protokoll beschreiben wir im Einzelnen jeden Schritt in der Generierung von CRISPR-Concatemer-Vektoren, vom gRNA-Design bis zur Golden Gate-Reaktion und zur Bestätigung eines erfolgreichen Klonens. Wir liefern auch ein hocheffizientes Protokoll für die Transfektion von CRISPR-Concatemern in Maus-Dünndarm-Organoide durch Elektroporation und nachfolgende Wachstumsfaktor-Entzugsversuche.

Protocol

1. gRNA Design für den CRISPR-concatemer Vector

Hinweis: Ziel dieses Abschnitts ist es, zu erläutern, wie man sich für die beste Targeting-Strategie entscheidet und wie man gRNAs mit spezifischen Überhängen für den CRISPR-Concatemer-Vektor entwirft.

  1. Design gRNAs gegen die Gene von Interesse mit einem CRISPR gRNA Design-Tool der Wahl. Siehe die Tabelle der Materialien für ein Beispiel.
    HINWEIS: Beim Targeting auf ein Paar paraloger Gene, obwohl es möglich ist, eine gRNA pro Gen zu entwerfen, empfiehlt es sich, zwei GRNAs pro Gen zu entwerfen, um die Chancen auf ein doppeltes Knockout zu erhöhen ( Abbildung 1 ).
  2. Vergewissern Sie sich, dass die gRNAs nicht die Bbs I-Erkennungsstelle enthalten, indem Sie ein Restriktions-Mapping-Tool verwenden (siehe die Tabelle der Materialien für ein Beispiel).
  3. Fügen Sie spezifische CRISPR-Concatemer-Vektorüberstände zu jedem Oligo hinzu, wie in Tabelle 1 gezeigt .
"Fo: keep-together.within-page =" 1 "fo: keep-with-next.within-page =" immer "> Kassette 1 Kassette 2 Kassette 3 Kassette 4 Sequenz (5'-3 ') CACCGG [gRNA1] GT ACCGG [gRNA2] G CCGG [gRNA3] ACACCGG [gRNA4] GTT Sequenz (5'-3 ') TAAAAC [RC-gRNA1] CC AAAAC [RC-gRNA2] C AAAC [RC-gRNA3] CTAAAAC [RC-gRNA4] CCG

Tabelle 1: Überhänge für jede Kassette des CRISPR-Concatemers Vector.

2. Klonen von gRNAs in den CRISPR-Concatemer Vector

  1. Phosphorylierung und Glühen von Oligos
    HINWEIS: Dieser Schritt veranschaulicht, wie tO anneale obere und untere Stränge für jedes gRNA-Oligo und wie man ihre Enden in einer einzigen Reaktion phosphoryliert.
    1. Bereiten Sie die Reaktionsmischung für die Phosphorylierung von Oligos vor und glühende obere und untere Stränge auf Eis, nach den nachfolgenden Anweisungen.
      HINWEIS: Alle Oligos können in eine Reaktion gepoolt werden; Zum Beispiel, im Falle eines 4-gRNA-Concatemer-Vektors, Pool zusammen 8 Oligos.
    2. Für 3 Concatemer verwenden Sie 3,0 μl gRNA Top Strang (1,0 μl aus jeder gRNA, 10 μM, 1 μL / gRNA), 3,0 μl gRNA Bodenstrang (1,0 μl von jeder gRNA, 10 μM, 1 μL / gRNA), 2,0 μL T4 DNA-Ligasepuffer (10x), 1,0 & mgr; l T4 PNK und füge H 2 O bis zu einem Gesamtvolumen von 20,0 & mgr; l hinzu.
    3. Mischen Sie gut durch Pipettieren und führen Sie diese in einem Thermocycler mit den folgenden Einstellungen: 37 ° C für 30 min, 95 ° C für 5 min, Rampe bis 25 ° C bei 0,3 ° C / min, halten bei 4 ° C.
  2. Bbs I shuffling Reaktion
    ANMERKUNG: In diesem Abschnitt werden die vorgeglühten gRNA-Oligos in die entsprechende Position des Concatemer-Vektors in einem Schritt durch abwechselnde Zyklen der Verdauung und Ligation eingebaut.
    1. Verdünnen Sie die Reaktionsmischung 1: 100 in DNase / RNase-freiem Wasser, um 3 und 4 gRNA-concatemer-Vektoren zu erzeugen.
      HINWEIS: Beim Klonen von 2 gRNA-Concatemern wird dieser Schritt nicht benötigt.
    2. Montiere die Bbs I shuffling Reaktion auf Eis, nach den Anweisungen unten. Füge eine Negativkontrolle ein, die nur den Vektor enthält.
    3. Verwenden Sie 100 ng CRISPR-Concatemer-Vektor, 10,0 & mgr; l Oligo-Gemisch, 1,0 & mgr; l BSA-haltiger Restriktionsenzympuffer (10 & times ;), 1,0 & mgr ; l DTT (10 mM), 1,0 & mgr ; l ATP (10 mM), 1,0 & mgr ; l Bbs I, 1,0 & mgr ; l T7-Ligase und H 2 O bis zu einem Gesamtvolumen von 20,0 & mgr; l auf.
    4. Mischen Sie gut durch Pipettieren und führen Sie diese in einem Thermocycler mit den folgenden Einstellungen: Führen Sie 50 Zyklen für das Klonen von 3 und 4 gRNA-concatemers und halten bei 37 ° C für 15 min, dann 4 ° C für immer.
  3. Exonukleasebehandlung
    HINWEIS: Dieser Schritt ist sehr empfehlenswert, da er die Effizienz des Klonens erhöht, indem irgendwelche Spuren linearisierter DNA entfernt werden.
    1. Behandeln Sie die Bbs I-Shuffling-Reaktion mit einer DNA-Exonuklease (siehe Tabelle der Materialien ) wie folgt.
    2. Nehmen Sie 11,0 μl Ligationsmischung aus dem vorherigen Schritt (2.2.3), fügen Sie 1,5 μl Exonukleasepuffer (10x), 1,5 μl ATP (10 mM), 1,0 μl DNA Exonuklease hinzu und bringen Sie das Gesamtvolumen auf 15,0 μl mit Wasser. Inkubieren bei 37 ° C für 30 min, gefolgt von 70 ° C für 30 min.
      HINWEIS: Dieser Schritt entfernt jegliche restliche linearisierte DNA in der Mischung und erhöht so die Klonierungseffizienz.
    3. 2 μl des Reaktionsgemisches zur Umwandlung in chemisch konkurrierenZelt E. coli Bakterien durch Hitzeschock 12 .
      HINWEIS: Alternativ kann die Reaktion bis zu einer Woche bei -20 ° C gelagert werden.
  4. Beschränkung der Verdauung
    ANMERKUNG: Ziel dieses Schrittes ist es, durch den Beschränkungsaufschluss den Erfolg des Klonierungsverfahrens zu beurteilen.
    1. Um das Vorhandensein von gRNA-Inserts im CRISPR-Concatemer-Vektor zu bestätigen, wählt man 4 - 8 Bakterienkolonien mit einer Impfschleife, wobei jeder Klon in 4 ml LB-Medium über Nacht bei 37 ° C in einem Orbitalschüttler wächst. Extrahieren Sie die DNA mit einem Plasmid-Miniprep-Kit gemäß den Anweisungen des Herstellers (siehe Tabelle der Materialien ).
    2. Digest ~ 200 ng DNA mit 10 U EcoR I + 5 U Bgl II in einer 10 μL Reaktion durch Inkubieren bei 37 ° C für 3 h in einem Bakterieninkubator. Füge eine separate Reaktionsmischung mit dem entsprechenden Originalvektor als Positivkontrolle für Größenvergleich ein.
      HINWEIS: ThiS wird bestätigen, ob alle Concatemer anwesend sind, da diese beiden Restriktionsenzyme ganze Concatemer ausgleichen werden. Dies sind die erwarteten Größen für jeden Concatemer: 2 gRNA-Concatemer (800 bp), 3 gRNA-Concatemer (1,2 kbp) und 4 gRNA-Concatemer (1,6 kbp).
    3. Führen Sie Verdauungsreaktionen auf einem 1% Agarosegel bei 90 V für ca. 20 min aus.
    4. Visualisieren Sie das Gel mit einem UV-Transilluminator. Identifizieren Sie die Klone mit der richtigen Einfügegröße, indem Sie sicherstellen, dass ihr Bandmuster mit dem eines der ursprünglichen Vektoren übereinstimmt und dass jedes Fragment die erwartete Größe hat, indem es eine DNA-Leiter verwendet.
    5. Die ausgewählten Klone mit 5 U Bbs I bei 37 ° C für 3 h in einem Bakterieninkubator verdauen. Füge eine separate Reaktionsmischung mit dem entsprechenden Originalvektor als Kontrolle ein.
      HINWEIS: Dieser zusätzliche Verdauungsschritt ist zu bestätigen, dass gRNAs in die richtige Position kloniert wurden und folglich alle Bbs I Erkennungsstellen verloren gegangen sind.
    6. Führen Sie Verdauungsreaktionen ausEin 1% Agarosegel bei 90 V für ca. 20 min. Betrachten Sie als richtig nur die Vektoren, die nicht von Bbs I geschnitten werden, da sie nur gRNAs enthalten.
  5. Vektorsequenzierung
    HINWEIS: Ziel dieses Schrittes ist es, das Vorhandensein von gRNA-Sequenzen in jenen Vektoren zu bestätigen, die durch Restriktionsverdauungsanalyse als korrekt identifiziert wurden.
    1. Bestätigen Sie positive Concatemer-Vektoren durch Sanger-Sequenzierung 13 mit den folgenden Primern:
      Vorwärts: TCAAGCCCTTTGTACACCCTAAG (zur Überprüfung der ersten gRNA-Kassette)
      Linker1_Forward: GACTACAAGGACGACGATGACAA (zur Überprüfung der zweiten gRNA-Kassette)
      Linker2_Reverse: GGCGTAGTCGGGCACGTCGTAGGGGT (zur Überprüfung der zweiten gRNA-Kassette)
      Linker2_Forward: ACCCCTACGACGTGCCCGACTACGCC (zur Überprüfung der dritten gRNA-Kassette)
      Linker3_Reverse: TCCTCCTCTGAGATCAGCTTCTGCAT (zur Überprüfung der dritten gRNA-Kassette)
      Reverse: AGGTGGCGCGAAGGGGCCACCAAAG (zur Überprüfung der letzten gRNAKassette)
    2. Überprüfen Sie die Anwesenheit aller gRNA, indem Sie ihre Sequenzen in der Sequenzierung auslesen.

3. Transfektion von Darm-Organoiden durch Elektroporation

HINWEIS: Bitte beachten Sie, dass dieses Verfahren auf dem von Fujii et al . Im Jahr 2015, mit Anpassung für Maus kleine Darm Organoid Kulturen 14 .

  1. Vor-Elektroporation
    HINWEIS: In diesem Abschnitt wird beschrieben, wie die Maus-Darm-Organoide vor der Elektroporation vorbereitet werden, indem alle Antibiotika und konditionierten Medien aus ihrem Kulturmedium entfernt werden. Dies verhindert mögliche toxische Effekte während der Elektroporation.
    1. Am Tag 0 des Transfektionsverfahrens teilen sich Organoide im Verhältnis 1: 2 auf.
      ANMERKUNG: Darmorganoidkulturen können durch Durchführung der Kryptionsisolation nach vorher festgelegten Protokollen gewonnen werden 15 . Bitte beziehen Sie sich auf
    2. Beim Aufteilen von Organoiden zur Elektroporation wird mindestens 6 Vertiefungen einer 48-Well-Platte pro Transfektion geerntet.
    3. Samen der Organoide in 20 μL-Basenmatrix tropfen und wachsen in WENR + Nic-Medium (Wnt + EGF + Noggin + R-Spondin + Nicotinamid) bei 37 ° C, 5% CO 2 in einem befeuchteten Inkubator (wie zuvor beschrieben 15 ) .
  2. Am Tag 2 wechselt das Medium durch Ersetzen von WENR + Nic mit 250 μl EN (EGF + Noggin) + CHIR99021 (Glycogen-Synthase-Kinase-3-Inhibitor) + Y-27632 (ROCK-Inhibitor) ohne Antibiotika (siehe Tabelle 2 ).
    HINWEIS: In allen Schritten beträgt die Menge an Medium, die zu jeder Vertiefung einer 48-Well-Platte gegeben wird, 250 & mgr; l.
  3. Am Tag 3 wechseln Sie das Organoidmedium nach EN + CHIR99021 + Y-27632 + 1,25% v / v Dimethylsulfoxid (DMSO) ohne Antibiotika.
  • Vorbereitung der Zellen
    HINWEIS:Hier beschreiben wir, wie man Organoide in kleine Zellcluster durch mechanische und chemische Dissoziation zerbricht. Diese Schritte sind entscheidend für den Erfolg des Verfahrens.
    1. Am Tag 4 stören Sie die Kellermatrixkuppeln mit einer 1 mL Pipettenspitze und übertragen Organoide in ein 1,5 mL Röhrchen. Pool-Inhalt von vier Wells einer 48-Well-Platte in eine Tube.
    2. Mechanische Bruch-Organoide in kleine Fragmente durch Pipettieren auf und ab mit einer P200-Pipette etwa 200-mal. Zentrifugieren bei Raumtemperatur, 5 min bei 600 x g.
    3. Entfernen Sie das Medium und resuspendieren Sie das Pellet in 1 ml einer rekombinanten Protease der Zellkulturqualität (siehe Tabelle der Materialien). Inkubieren bei 37 ° C für maximal 5 min und dann einen 50 μl Tropfen Probe unter einem invertierten Lichtmikroskop mit einem 4x Objektiv überprüfen.
      HINWEIS: Cluster von 10 - 15 Zellen sind wünschenswert, da dies das Zellüberleben nach der Elektroporation erhöht.
    4. Übertragen Sie die Zellsuspension auf eine niedrigbindende 15 mL Röhre und halt dieDissoziation durch Zugabe von 9 ml Basalmedium ohne Antibiotika (siehe Tabelle 2 ). Bei Raumtemperatur zentrifugieren, 5 min bei 600 xg, dann den Überstand verwerfen und das Pellet in 1 ml reduziertem Serummedium resuspendieren (siehe Tabelle der Materialien ).
    5. Zählen Sie die Anzahl der Zellen mit einer Bürker-Kammer und verwenden Sie mindestens 1 x 10 5 Zellen pro Elektroporationsreaktion. 9 ml reduziertes Serummedium in das 15 ml Röhrchen geben und bei Raumtemperatur, 3 min bei 400 x g zentrifugieren.
  • Elektroporation
    HINWEIS: In den folgenden Abschnitten finden Sie Anleitungen zur Durchführung der Elektroporation und zur Wiederherstellung von Organoiden.
    1. Entfernen Sie den gesamten Überstand und resuspendieren Sie das Pellet in einer Elektroporationslösung (siehe Tabelle der Materialien ). Fügen Sie eine Gesamtmenge von 10 μg DNA zu der Zellsuspension hinzu und fügen Sie die Elektroporationslösung zu einem Endvolumen von 100 & mgr; l hinzu und halten Sie die Zell-DNEine Mischung auf Eis. Verwenden Sie CRISPR-concatamer-Vektoren in Kombination mit einem Cas9-Expressionsplasmid ( zB Addgene # 41815) im Verhältnis 1: 1.
      HINWEIS: Das Gesamtvolumen der hinzugefügten DNA sollte kleiner oder gleich 10% des gesamten Reaktionsvolumens sein.
    2. Eine separate Transfektionsmischung, die ein GFP-Plasmid enthält, einschließt, um die Transfektionseffizienz ( z. B. pCMV-GFP, Addgene # 11153 oder irgendein generisches GFP-exprimierendes Plasmid) zu bewerten.
    3. Fügen Sie die Zell-DNA-Mischung der Elektroporations-Küvette hinzu und legen Sie sie in die Elektroporatorkammer. Messen Sie die Impedanz, indem Sie die entsprechende Taste am Elektroporator drücken und sicherstellen, dass es 0,030-0.055 Ω ist. Führen Sie die Elektroporation gemäß den in Tabelle 3 angegebenen Einstellungen durch.
      HINWEIS: Wenn der Impedanzwert außerhalb des zulässigen Bereichs liegt, stellen Sie das Lösungsvolumen in der Küvette ein.
    4. Fügen Sie 400 μl Elektroporation Puffer + Y-27632 in die Küvette und übertragen Sie dann alle auf ein 1,5 mL Röhrchen. IncubaTe bei Raumtemperatur für 30 min, um die Zellen zu erholen und anschließend bei Raumtemperatur für 3 min bei 400 x g zu drehen.
    5. Den Überstand entfernen und das Pellet in 20 μl / Vertiefung der Basalmatrix resuspendieren. Saat etwa 1 x 10 4 bis 1 x 10 5 Zellen pro Vertiefung in einer 48-Well-Platte und füge EN + CHIR99021 + Y-27632 + 1,25% v / v DMSO-Medium hinzu. Inkubieren bei 37 ° C.
    6. Am Tag 5 wechseln Sie das Medium in EN + CHIR99021 + Y-27632 und überprüfen die Transfektionseffizienz durch Beobachtung der GFP-Expression ( Abbildung 2 ). Organoide bei 37 ° C aufbewahren und EN + CHIR99021 + Y-27632 mittel nach 2 Tagen auffrischen.
    7. Am Tag 9 wechseln Sie das Medium auf WENR + Nic + Y-27632 und inkubieren bei 37 ° C.
      ANMERKUNG: Y-27632 kann nach 7-10 Tagen (am Tag 16-19) entfernt werden.
  • Poring Puls Übertragungspuls
    Stromspannung 175V 20V
    Pulslänge 5 ms 50msec
    Pulsintervall 50msec 50msec
    Anzahl der Impulse 2 5
    Zerfallsrate 10% 40%
    Polarität + +/-

    Tabelle 3: Elektroinstallationseinstellungen.

    4. Growth Factor Entzug

    Anmerkung: Hier wird beispielhaft veranschaulicht, wie ein Wachstumsfaktor-Entzugsexperiment beim Ausstoßen von negativen Regulatoren des Wnt-Weges in Darmorganoiden durchgeführt wird.

    1. 10-14 Tage nachR Elektroporation, teilen die Organoide in einem 1: 3-Verhältnis in einer 48-Well-Platte nach den oben genannten Schritten (3.2.1 - 3.2.2) auf.
    2. Das Organoidpellet wird in 20 & mgr; l Basalmembranmatrix resuspendiert und bei 37 ° C für 10 min verfestigen gelassen. Dann werden 250 μl Wachstumsfaktor-beraubtes Medium ( zB EN) überlagert, um zu testen, ob ein Knockout der Zielgene erreicht worden ist 5 .
    3. Teilen Sie die Organoide unter Wachstumsfaktor-benachteiligten Bedingungen für ein Minimum von 2 - 3 Passagen, um einen Unterschied im Überleben zwischen Wildtyp Wildtyp (WT) Kontrollorganoiden und mutanten Organoiden 5 , 15 zu sehen .
      HINWEIS: Wildtyp-Organoide sollten nicht in der Lage sein, in Wachstumsfaktor-beraubtes Medium über zwei Passagen zu überleben, während mutierte Linien in der Lage sein werden zu wachsen.

    Representative Results

    Um das Vorhandensein der korrekten Anzahl von gRNA-Inserts in dem Concatemer-Vektor zu bestätigen, wird die Restriktionsverdauung mit Enzymen ( EcoR I + BglII ) durchgeführt, die alle gRNA-exprimierenden Kassetten flankieren (jede Kassettengröße beträgt ~ 400 bp, Fig. 1 ). Zum Beispiel beträgt bei der Erzeugung eines 4-gRNA-Concatemer-Vektors die erwartete Größe der unteren Bande im Agarosegel etwa 1,6 Kbp; Jede Bande, die niedriger als diese ist, zeigt an, dass nicht alle der 4 gRNA-Kassetten in den Vektor eingefügt werden ( Abbildung 2A ). Darüber hinaus wird immer empfohlen, zu überprüfen, dass alle Bbs I Erkennungsstellen verloren gehen und das Enzym den Vektor nicht schneidet ( Abbildung 2B ).

    Sobald die Konstrukte bestätigt worden sind, können sie an die Mäuse-Darm-Organoide durch Elektroporation geliefert werden, um optima zu erreichenL Ebenen der Transfektionseffizienz (bis zu 70%), wie die GFP-Kontrolle zeigt ( Abbildung 3 ).

    Um die Effizienz dieser Strategie funktionell zu testen, wurden intestinale Organoide, die mit Cas9 und Concatemer-Vektoren gegen Axin1 / 2 und Rnf43 / Znrf3 transfiziert wurden, in EN (R-Spondin-Entzug) und EN + IWP2 (R-Spondin und Wnt-Entzug, IWP2) kultiviert : Porcupininhibitor, 2,5 μM) Medium für mindestens 3 Passagen ( Abbildung 4 ). Während untransfizierte WT-Organoide unter beiden Bedingungen starben, überlebten Axin1 / 2-Knockout-Organoide in beiden aufgrund der nachgeschalteten Aktivierung des Wnt-Weges; Darüber hinaus überleben Rnf43 / Znrf3-mutierte Organoide in Abwesenheit von R-Spondin, können aber nicht in Gegenwart von IWP2 überleben, was eine Verarmung des Wnt verursacht, das den Weg aktiviert. Zusammengenommen zeigen diese Beobachtungen, dass ein Knockout dieser Paare von Paralogs durch die Erzeugung von t möglich istEr erwartete Organoid-Phänotyp. Details zu diesen Ergebnissen wurden in der Entwicklungsbiologie 5 veröffentlicht .

    Abbildung 1
    Abbildung 1: Schematische Darstellung des CRISPR-Concatemers mit 4 Kassetten. Scheme des 4-gRNA-Concatemer-Vektors mit jeder 400 bp-Kassette, die einen U6-Promotor enthält, zwei invertierte wiederholte BbsI- Stellen (auch als BB bezeichnet) und gRNA-Gerüst in dieser Reihenfolge. Während der Shuffling-Reaktion werden Bbs- I-Stellen durch gRNA-Fragmente mit passenden Überhängen ersetzt und folglich verloren. Bindungsstellen der Sequenzierungsprimer zur Überprüfung der korrekten Insertion von gRNA-Oligos sind durch die blauen Pfeile dargestellt. Fwd = Vorwärtsprimer, Rev = Rückwärtsprimer, Link 1/2/3 = Linkerregionen 1/2/3. Bitte CLecke hier, um eine größere Version dieser Figur zu sehen.

    Figur 2
    Abbildung 2: Repräsentative Verdauungsmuster von Concatemer-Vektoren. ( A ) Doppelter Verdau von 3 und 4 gRNA-Concatemer-Vektoren mit EcoR I und Bgl II. Das korrekte Verdauungsmuster ist durch ein grünes Zecken markiert, während Vektoren mit nur 1 oder 2 gRNA-Insertionen durch ein rotes Kreuz markiert sind. Spur 1 zeigt die Verdauung eines 4-gRNA-Concatemer-Eltern-Vektors, der als Positivkontrolle verwendet wird (gekennzeichnet durch "+"); Ähnlich zeigt Spur 5 die Verdauung eines 3-gRNA-Concatemer-Eltern-Vektors, markiert mit "+". ( B ) Verdauung mit Bbs I, die die richtige Größe der unverdauten Concatemer-Vektoren zeigt (angezeigt durch die grünen Zecken). Die Verdauung eines gRNA-haltigen Concatemer-Vektors, der Bbs I-Stellen verloren hat, wird als Positivkontrolle und verwendetD ist mit "+" markiert. Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

    Abbildung 3
    Abbildung 3: Repräsentatives Bild von erfolgreich elektroporierten Darm-Organoiden. Die Transfektion eines GFP-Plasmids ist entscheidend für die Bewertung der Transfektionseffizienz. Etwa 24 h nach der Elektroporation sind bereits Organoide mit einer kleinen Anzahl von Zellen sichtbar, und wenn das Elektroporationsverfahren erfolgreich war, zeigen bis zu 70% grüne Fluoreszenz. BF = helles Feld, GFP = grünes fluoreszierendes Protein. Maßstab = 2.000 μm Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.


    Abbildung 4: Repräsentative Bilder von Mutanten-Darm-Organoiden. Knockout der negativen Regulatoren des Wnt-Pfades Axin1 und Rnf43, zusammen mit ihren Paralogen, macht die Darmorganoide resistent gegen Wachstumsfaktorentzug. Insbesondere können Axin1 / 2-Knockout-Organoide (Axin1 / 2 KO) in Abwesenheit von R-Spondin (EN: EGF + Noggin) und Wnt (EN + IWP2: EN + Porcupin-Inhibitor) wachsen, während Rnf43 / Znrf3-mutierte Organoide (R & Z KO) kann nur in Abwesenheit von R-Spondin (EN) überleben. Im Gegensatz dazu können WT-Organoide nur im Kontrollkulturzustand WENR + Nic (Wnt + EGF + Noggin + R-Spondin + Nicotinamid) überleben. Maßstäbe = 1.000 μm Bitte klicken Sie hier, um eine größere Version dieser Figur zu sehen.

    Basalmedium Bemerkungen
    Bei 4 ° C für 4 Wochen aufbewahren
    Zellkulturmedium 500 mL Siehe Tabelle der Materialien
    L-Glutamin 100x 5 ml
    Puffermittel 1 M 5 ml Siehe Tabelle der Materialien
    Penicillin Streptomycin 100x 5 ml
    WENR + Nic (Wnt + EGF + Noggin + R-Spondin + Nicotinamid)
    Bei 4 ° C für 2 Wochen aufbewahren
    Basalmedium Bis zu 50 mL
    Neuronale Zellserum-freie Ergänzung (50x) 1 mL Siehe Tabelle von MaTerials
    Neuronale Zellserumfreie Ergänzung (100x) 500 & mgr; l Siehe Tabelle der Materialien
    N-Acetylcystein (500 mM) 125 & mgr; l
    Maus-EGF (100 & mgr; g / ml) 25 & mgr; l
    Maus Noggin (100 & mgr; g / ml) 50 & mgr; l
    R-Spondin konditioniertes Medium 5 ml
    Wnt3a konditioniertes Medium 25 ml
    Nicotinamid (1 M) 250 & mgr; l
    EN + CHIR + Y-27632 (EGF + Noggin + CHIR + Y-27632)
    Bei 4 ° C für 2 Wochen aufbewahren
    Basalmedium ohne Penicillin Streptomycin Bis zu 20 mL
    Neuronale Zellserum-freie Ergänzung (50x) 400 & mgr; l Siehe Tabelle der Materialien
    Neuronale Zellserumfreie Ergänzung (100x) 200 & mgr; l Siehe Tabelle der Materialien
    N-Acetylcystein (500 mM) 50 & mgr; l
    Maus-EGF (100 & mgr; g / ml) 10 & mgr; l
    Maus Noggin (100 & mgr; g / ml) 20 & mgr; l
    Y-27632 (10 & mgr; M) 20 & mgr; l
    CHIR99021 (8 & mgr; M) 10 & mgr; l
    DE (EGF + Noggin)
    Bei 4 ° C für 4 Wochen aufbewahren
    Basalmedium Bis zu 50 mL
    Neuronale Zellserum-freie Ergänzung (50x) Siehe Tabelle der Materialien
    Neuronale Zellserumfreie Ergänzung (100x) 500 & mgr; l Siehe Tabelle der Materialien
    N-Acetylcystein (500 mM) 125 & mgr; l
    Maus-EGF (100 & mgr; g / ml) 25 & mgr; l
    Maus Noggin (100 & mgr; g / ml) 50 & mgr; l

    Tabelle 2: Organoid-Medienzusammensetzung.

    Discussion

    In diesem Protokoll geben wir alle notwendigen Schritte zur Generierung von CRISPR-Concatemern und zur Anwendung von CRISPR-Concatemern in Maus-Darm-Organoiden an, um gleichzeitig mehrere Gene zu klopfen. Wie bereits erwähnt, hat diese Strategie mehrere Vorteile, wie z. B. Geschwindigkeit, hohe Effizienz und Wirtschaftlichkeit.

    Um das ganze Verfahren erfolgreich durchführen zu können, gibt es einige kritische Aspekte zu berücksichtigen. Zunächst ist es notwendig, dass alle gRNA-Oligos richtig geglüht und phosphoryliert werden, da sie das Ausgangsmaterial für die Bbs- I-Klonierungsreaktion darstellen, die an sich sehr effizient ist. Zweitens, bei der Elektroorganisation von Organoiden, je mehr Zellen pro Zustand, desto höher die maximal mögliche Transfektionseffizienz. Darüber hinaus ist es auch wichtig, dass nach Zelldissoziation kleine Zellcluster über einzelne Zellen vorherrschen.

    Trotzdem ist es möglich, auf technisches Problem zu stoßenLems beim Versuch, entweder das Klonen oder die Transfektion zum ersten Mal; Im Falle von Problemen während der gRNA-Klonierung wird empfohlen, die gRNA-Oligo-Sequenz zu verdoppeln und, falls zutreffend, zusätzliche Bakterienkolonien für die Beschränkungsverdauung zu wählen. Wenn die Transfektionseffizienz und die Lebensfähigkeit der Zellen nach der Elektroporation niedrig sind, ist es ratsam, das Protokoll unter Verwendung mehrerer Zellen pro Zustand zu wiederholen und die Zeit der Zelldissoziation auf 3 min zu reduzieren.

    Obwohl die Erzeugung von CRISPR-Concatemern relativ billig und einfach ist, ist die Durchführung von größeren genetischen Bildschirmen in Organoiden nicht, da die Skala durch die mit der Organoidkultur verbundenen Kosten und durch ihre arbeitsintensive Natur begrenzt ist. Es ist erwähnenswert, in diesem Fall, dass die CRISPR-Concatemer-Methode auch mit Zelllinien, wie HEK293 und Maus embryonalen Stammzellen kompatibel ist.

    Unabhängig von der zellulären System, ein weiterer möglicher Nachteil dieser sTrategie kann bei der gleichzeitigen Knockout von drei oder vier verschiedenen Genen angetroffen werden. Zum Beispiel hat jede gRNA eine andere Targeting-Effizienz und die Änderungen des Schlagens aller Gene gleichzeitig können relativ niedrig sein; Aus diesem Grund ist es ratsam, das Concatemer-System zu verwenden, um mehr als eine gRNA gegen das gleiche Gen zu leiten.

    Alternative Strategien, die ähnlich auf Golden Gate-Shuffling basieren, wurden im Laufe der Jahre vorgeschlagen, um Multiplex-gRNA-Vektoren 7 , 8 zu erzeugen. Allerdings ist es in unserer Methode möglich, mehrere gRNAs in einem einzigen retroviralen Vektor in einer einzigen Klonierungsrunde direkt zu versammeln, was es für die Erzeugung von gRNA-Bibliotheken geeignet macht, um Paralogen zu zielen.

    Unser CRISPR-Concatemer ist in der MSCV retroviralen Vektor-Backbone gebaut. Somit kann ein gRNA-Concatemer-haltiges Retrovirus verwendet werden, um stabile Zelllinien zu erzeugen, die überexpulierenRess gRNAs In Kombination mit einem Cas9-induzierbaren System kann man mit unserem System induzierbare Paralogue-Knockouts durchführen.

    Zusammenfassend beschreiben wir hier, wie man in einem Schritt bis zu vier verschiedene gRNAs in denselben Vektor kloniert und wie man diese Strategie auf die Organoidkultur mit einer hohen Transfektionseffizienz anwendet. Darüber hinaus stellen wir nützliche Vorschläge zur Maximierung der Erfolgschancen während des gesamten Verfahrens zur Verfügung.

    Disclosures

    Die Autoren haben nichts zu offenbaren. Die Autoren haben keinen Interessenkonflikt gemeldet.

    Acknowledgments

    Wir danken Christopher Hindley für die kritische Lektüre des Manuskripts. AM wird von Wntsapp (Marie Curie ITN), AA-R unterstützt. Wird vom Medical Research Council (MRC) und BK.K. Und RM werden von einem Sir Henry Dale Fellowship aus dem Wellcome Trust und der Royal Society [101241 / Z / 13 / Z] unterstützt und erhalten Unterstützung durch einen Kernstipendium vom Wellcome Trust und MRC zum Wellcome Trust - MRC Cambridge Stem Cell Institute .

    Materials

    Name Company Catalog Number Comments
    Optimized CRISPR Design Tool Feng Zhang group CRISPR gRNA design tool; http://crispr.mit.edu/
    Webcutter 2.0 restriction mapping tool; http://rna.lundberg.gu.se/cutter2/
    T4 PNK (Polynucleotide Kinase) New England Biolabs M0201L
    T4 DNA ligase buffer New England Biolabs M0202S
    T7 DNA Ligase New England Biolabs M0318L
    DTT (dithiothreitol) Promega P1171
    ATP (adenosine triphosphate) New England Biolabs P0756S
    FastDigest BbsI (BpiI) Thermo Fisher FD1014
    Tango buffer (BSA-containing restriction enzyme buffer) Thermo Fisher BY5
    BglII New England Biolabs R0144
    EcoRI New England Biolabs R0101
    Plasmid-safe exonuclease Cambio E3101K
    Thermal cycler Applied biosystems 4359659
    10G competent E. coli bacteria Cambridge Bioscience 60108-1
    Plasmid mini kit Qiagen 12125
    Table top microcentrifuge Eppendorf UY-02580-01
    Inoculating loops Microspec PLS5
    Bacteria incubator Sanyo MIR-262
    Luria-Bertani broth (LB) Sigma-Aldrich L3522
    Agarose Sigma-Aldrich A4718
    Agarose gel electrophoresis apparatus Bioneer A-7020
    Advanced DMEM/F12(cell culture medium) Invitrogen 12634-034
    Glutamax (L-Glutamine) 100x Invitrogen 35050-068
    HEPES 1 M (buffering agent) Invitrogen 15630-056
    Penicillin-streptomycin 100x Invitrogen 15140-122
    B27 supplement (Neuronal cell serum-free supplement) 50x Invitrogen 17504-044
    N2 supplement (Neuronal cell serum-free supplement) 100x Invitrogen 17502-048
    n-Acetylcysteine 500 mM Sigma-Aldrich A9165-5G
    Mouse EGF 500 µg/mL Invitrogen Biosource PMG8043
    Mouse Noggin 100 µg/mL Peprotech 250-38
    Nicotinamide 1 M Sigma N0636
    R-Spondin conditioned medium n.a. n.a. Produced in house from HEK293 cells, for details see Sato and Clevers 2013
    Wnt conditioned medium n.a. n.a. Produced in house from HEK293 cells, for details see Sato and Clevers 2013
    Y-27632 10 µM Sigma-Aldrich Y0503-1MG
    Standard BD Matrigel matrix BD Biosciences 356231
    48-well Plate Greiner Bio One 677980
    CHIR99021 Sigma-Aldrich A3734-1MG
    IWP-2 Cell Guidance Systems SM39-10
    TrypLE (recombinant protease) Invitrogen 12605-010
    Opti-MEM (reduced serum medium ) Life technologies 51985-034
    Electroporation Cuvettes 2 mm gap NepaGene EC-002S
    Low binding 15 mL tubes Sigma-Aldrich CLS430791
    Bürker’s chamber Sigma-Aldrich BR719520-1EA
    NEPA21 Super Electroporator NepaGene contact supplier
    Protein LoBind tubes low binding Thermo Fisher 10708704
    BTXpress electroporation buffer Harvard Apparatus 45-0805
    DMSO (Dimethyl sulfoxide) AppliChem A3672

    DOWNLOAD MATERIALS LIST

    References

    1. Mali, P., et al. RNA-Guided Human Genome Engineering via Cas9. Science. 339, (6121), 823-826 (2013).
    2. Koike-Yusa, H., Li, Y., Tan, E. -P., Velasco-Herrera, M. D. C., Yusa, K. Genome-wide recessive genetic screening in mammalian cells with a lentiviral CRISPR-guide RNA library. Nat Biotech. 32, (3), 267-273 (2014).
    3. Bassett, A. R., Kong, L., Liu, J. L. A Genome-Wide CRISPR Library for High-Throughput Genetic Screening in Drosophila Cells. J Genet Genomics. 42, (6), 301-309 (2015).
    4. Diss, G., Ascencio, D., DeLuna, A., Landry, C. R. Molecular mechanisms of paralogous compensation and the robustness of cellular networks. J Exp Zool B Mol Dev Evol. 322, (7), 488-499 (2014).
    5. Andersson-Rolf, A., Merenda, A., Mustata, R. C., Li, T., Dietmann, S., Koo, B. -K. Simultaneous paralogue knockout using a CRISPR-concatemer in mouse small intestinal organoids. Dev Biol. 420, (2), 1-7 (2016).
    6. Ran, F. A., Hsu, P. P. D., Wright, J., Agarwala, V., Scott, D., Zhang, F. Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 8, (11), 2281-2308 (2013).
    7. Engler, C., Gruetzner, R., Kandzia, R., Marillonnet, S. Golden gate shuffling: A one-pot DNA shuffling method based on type IIs restriction enzymes. PLoS ONE. 4, (5), (2009).
    8. Sakuma, T., Nishikawa, A., Kume, S., Chayama, K., Yamamoto, T. Multiplex genome engineering in human cells using all-in-one CRISPR/Cas9 vector system. Sci Rep. 4, (5), 5400 (2014).
    9. Kabadi, A. M., Ousterout, D. G., Hilton, I. B., Gersbach, C. A. Multiplex CRISPR/Cas9-based genome engineering from a single lentiviral vector. Nucleic Acids Res. 42, (19), 1-11 (2014).
    10. Yin, L., et al. Multiplex Conditional Mutagenesis Using Transgenic Expression of Cas9 and sgRNAs. Genetics. 200, (2), 431-441 (2015).
    11. Cress, B. F., Toparlak, O. D., et al. CRISPathBrick: Modular Combinatorial Assembly of Type II-A CRISPR Arrays for dCas9-Mediated Multiplex Transcriptional Repression in E. coli. ACS Synth Biol. 4, (9), 987-1000 (2015).
    12. Froger, A., Hall, J. E. Transformation of plasmid DNA into E. coli using the heat shock method. J Vis Exp. (6), e253 (2007).
    13. Zimmermann, J., Voss, H., Schwager, C., Stegemann, J., Ansorge, W. Automated Sanger dideoxy sequencing reaction protocol. FEBS Letters. 233, (2), 432-436 (1988).
    14. Fujii, M., Matano, M., Nanki, K., Sato, T. Efficient genetic engineering of human intestinal organoids using electroporation. Nat. Protoc. 10, (10), 1474-1485 (2015).
    15. Andersson-Rolf, A., Fink, J., Mustata, R. C., Koo, B. -K. A video protocol of retroviral infection in primary intestinal organoid culture. J Vis Exp. (90), e51765 (2014).

    Erratum

    Formal Correction: Erratum: A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer
    Posted by JoVE Editors on 01/02/2018. Citeable Link.

    An erratum was issued for: A Protocol for Multiple Gene Knockout in Mouse Small Intestinal Organoids Using a CRISPR-concatemer. There was a typo in step 3.3 of the Protocol.

    Step 3.3 was corrected from:

    Add the cell-DNA mixture to the electroporation cuvette and place it in the electroporator chamber. Measure the impedance by pushing the appropriate button on the electroporator and ensure that it is 0.030-0.055 Ω

    to:

    Add the cell-DNA mixture to the electroporation cuvette and place it in the electroporator chamber. Measure the impedance by pushing the appropriate button on the electroporator and ensure that it is 0.030-0.055 kΩ

    Comments

    0 Comments


      Post a Question / Comment / Request

      You must be signed in to post a comment. Please or create an account.

      Usage Statistics