MRNA Interactome Capture fra Plant Protoplasts

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Her presenterer vi en interaktiv fangstprotokoll anvendt på Arabidopsis thaliana leaf mesophyll protoplaster. Denne metoden baserer seg kritisk på in vivo UV-kryssbinding og muliggjør isolering og identifisering av plante-mRNA-bindende proteiner fra et fysiologisk miljø.

Cite this Article

Copy Citation | Download Citations

Zhang, Z., Boonen, K., Li, M., Geuten, K. mRNA Interactome Capture from Plant Protoplasts. J. Vis. Exp. (125), e56011, doi:10.3791/56011 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

RNA-bindende proteiner (RBP) bestemmer skjebnen til RNA. De deltar i alle RNA-biogenesebaner og bidrar spesielt til post-transkriptionell genregulering (PTGR) av messenger-RNA (mRNA). I de siste årene har en rekke mRNA-bundne proteomer fra gjær og pattedyrcellelinjer blitt isolert med suksess ved bruk av en ny metode kalt "mRNA interaktiv fangst", som muliggjør identifisering av mRNA-bindende proteiner (mRBPs) Direkte fra et fysiologisk miljø. Metoden består av in vivo ultraviolett (UV) tverrbinding, nedtrekking og rensing av messenger ribonukleoproteinkomplekser (mRNPs) ved oligo (dT) perler, og den påfølgende identifikasjon av de tverrbundne proteiner ved massespektrometri (MS). Svært nylig, ved å anvende den samme metoden, har flere plante-mRNA-bundet proteomer blitt rapportert samtidig fra forskjellige Arabidopsis- vevskilder: etiolerte frøplanter, bladvev,Blad mesofyll protoplaster og dyrkede rotceller. Her presenterer vi den optimaliserte mRNA interaktive oppsamlingsmetoden for Arabidopsis thaliana leaf mesophyll protoplaster, en celletype som tjener som et allsidig verktøy for eksperimenter som inkluderer ulike cellulære analyser. Betingelsene for optimal proteinutbytte inkluderer mengden av startvev og varigheten av UV-bestråling. I det mRNA-bundne proteomet som er oppnådd fra et mediumskalaforsøk (10 7 celler), ble RBPer som var kjent for å ha RNA-bindingsevne, funnet å være overrepresentert, og mange nye RBP ble identifisert. Eksperimentet kan skaleres opp (10 9 celler), og den optimaliserte metoden kan brukes på andre plantecelletyper og arter for å isolere, katalogisere og sammenligne mRNA-bundet proteomer i planter.

Introduction

Eukaryoter bruker flere RNA biogenese regulatoriske veier for å opprettholde cellulære biologiske prosesser. Blant de kjente typene RNA er mRNA meget variert og bærer kodingskapasiteten til proteiner og deres isoformer 1. PTGR-banen styrer skjebnen til pre-mRNAs 2 , 3 . RBP fra forskjellige genfamilier styrer reguleringen av RNA, og i PTGR styrer bestemte mRBPs mRNA gjennom direkte fysiske interaksjoner, og danner funksjonelle mRNP'er. Derfor er identifisering og karakterisering av mRBP og deres mRNPs avgjørende for å forstå reguleringen av cellulær mRNA-metabolisme 2. I de siste tre tiårene har ulike in vitro- metoder - inkludert RNA-elektroforetisk mobilitetsforskyvning (REMSA) -analyser, systematisk utvikling av ligander ved eksponensielle anrikningsanalyser (SELEX) basert på bibliotek-avledede konstruksjoner, RNA Bind-n-Seq (RBNS), radioaktivt merket eller kvantitativtFluorescens-RNA-bindingsanalyser, røntgenkrystallografi og NMR-spektroskopi 4 , 5 , 6 , 7 , 8 , 9 - har blitt anvendt mye på studier av RBP, hovedsakelig fra pattedyrceller. Resultatene av disse studiene av pattedyr-RBP kan søges via den RNA-bindende Protein DataBase (RBPDB), som samler de publiserte observasjonene 10 .

Selv om disse in vitro- tilnærmingene er kraftige verktøy, bestemmer de de bundne RNA-motivene fra et gitt RNA-basseng av sekvenser og er derfor begrenset i deres evne til å oppdage nye mål-RNAer. Det samme gjelder for beregningsstrategier for å forutsi genomgående RBP, som er basert på bevaring av proteinsekvens og struktur 15 . For å overvinne dette, har en ny eksperimentell metode haS er etablert som muliggjør identifisering av RNA-motivene som en RBP av interesse interagerer med, samt for bestemmelsen av den nøyaktige bindingsstedet. Denne metoden, kalt "tverrbinding og immunutfelling" (CLIP), består av in vivo UV-kryssbinding etterfulgt av immunutfelling 11 . Tidlige studier har vist at fotoaktivering av DNA- og RNA-nukleotider kan forekomme ved eksitasjon UV-bølgelengder større enn 245 nm. Reaksjonen gjennom tymidin synes å være favorisert (rang i rekkefølge av redusert fotoreaktivitet: dT> dC> rU> rC, dA, dG) 12 . Ved bruk av UV-lys med en bølgelengde på 254 nm (UV-C) ble det observert at kovalente bindinger mellom RNA-nukleotider og proteinrester opprettes når det er bare noen få Ångstrømmer (Å). Fenomenet kalles derfor "nellengde" tverrbinding av RNA og RBP. Dette kan følges av en streng rensingsprosedyre Kostbar med liten bakgrunn 13 , 14 .

En strategi som er komplementær til CLIP, er å kombinere in vivo UV-kryssbinding med proteinidentifikasjon for å beskrive landskapet av RBP. Et antall slike genome-brede mRNA-bundet proteomer er blitt isolert fra gjærceller, embryonale stamceller (ESC'er) og humane cellelinjer ( dvs. HEK293 og HeLa) ved hjelp av denne nye eksperimentelle tilnærming, kalt "mRNA interactome capture" 18 , 19 , 20 , 21 . Metoden består av in vivo UV-kryssbinding etterfulgt av mRNP-rensing og MS-basert proteomikk. Ved å anvende denne strategien har mange nye "måneskinnende" RBP som inneholder ikke-kanoniske RBDer blitt oppdaget, og det har blitt klart at flere proteiner har RNA-bindende kapasiteter enn tidligere antatt"> 15 , 16 , 17. Bruken av denne metoden tillater nye applikasjoner og muligheten til å svare på nye biologiske spørsmål ved undersøkelse av RBP. For eksempel har en nylig studie undersøkt bevaring av det mRNA-bundet proteomet (kjernen RBP Proteom) mellom gjær og humane celler 22 .

Plant RBP har allerede blitt funnet å være involvert i vekst og utvikling ( f.eks . I post-transkripsjonell regulering av blomstringstid, sirkadisk klokke og genuttrykk i mitokondrier og kloroplaster) 24 , 25 , 26 , 27 , 28 , 29 . Videre antas de å utføre funksjoner i de cellulære prosessene som reagerer på abiotiske påkjenninger ( f.eks. Kaldt, tørke, saLinity og abscisic acid (ABA)) 31 , 32 , 33 , 34 . Det er mer enn 200 forutsagte RBP-gener i Arabidopsis thaliana- genomet, basert på RNA-anerkjennelsesmotiv (RRM) og K homologi (KH) domenesekvensmotiv; I ris har omtrent 250 blitt notert 35 , 36 . Det er bemerkelsesverdig at flere forutsagte RBPs synes å være unik for planter (f.eks ingen metazo ortologer til omtrent 50% av forventet Arabidopsis RBPs inneholdende et domene RRM) 35, hvilket antyder at mange kan tjene til nye funksjoner. Funksjonene til de fleste spådde RBP er fortsatt ukarakterisert 23 .

Isoleringen av mRNA-bundet proteomer fra Arabidopsis- etiolerte frøplanter, bladvev, dyrkede rotceller og blad mesofyllprotoplaster ved bruk avMRNA interactome capture er nylig rapportert 38 , 39 . Disse studiene viser det sterke potensialet for systematisk katalogisering av funksjonelle RBP i planter i nær fremtid. Her presenterer vi en protokoll for mRNA interaktiv fangst fra planteprotoplaster ( dvs. celler uten cellevegger). Arabidopsis thaliana leaf mesophyll protoplaster er den viktigste typen av bladcelle. De isolerte protoplastene tillater optimal tilgang av UV-lys til cellene. Denne celletypen kan brukes i analyser som forbigående uttrykker proteiner for funksjonell karakterisering 40 , 41 . Videre har protoplasting blitt anvendt på flere andre plantecelletyper og arter 42 , 43 , 44 ( f.eks. Petersson et al ., 2009; Bargmann og Birnbaum, 2010; og Hong et al ., 2012).

<P class = "jove_content"> Metoden omfatter totalt 11 trinn ( Figur 1A ). Arabidopsis leaf mesophyll protoplaster isoleres først (trinn 1) og blir deretter UV-bestrålet for å danne tverrbundne mRNP'er (trinn 2). Når protoplaster lyseres under denatureringsbetingelser (trinn 3), frigjøres de tverrbundne mRNPene i lys / bindingsbuffer og trekkes ned av oligo-d (T) 25 perler (trinn 4). Etter flere runder med strenge vasker renses mRNPene og analyseres videre. De denaturerte peptider av mRBPs fordøyes av proteinase K før de tverrbundne mRNAene renses og RNA-kvaliteten er verifisert av qRT-PCR (trinn 5 og 6). Etter RNase-behandling og proteinkonsentrasjon (trinn 7) styres proteinkvaliteten ved SDS-polyakrylamidgelelektroforese (SDS-PAGE) og sølvfarging (trinn 8). Forskjellen i proteinbåndsmønstre kan enkelt visualiseres mellom en tverrbundet prøve (CL) og en ikke-tverrbundet prøve (ikke-CL;Den negative kontrollprøven fra protoplaster som ikke er utsatt for UV-bestråling). Identifikasjonen av proteiner oppnås gjennom MS-basert proteomikk. Proteinene fra CL-prøven separeres ved endimensjonal polyakrylamidgelelektroforese (1D-PAGE) for å fjerne mulig bakgrunnsforurensning, "in-gel digereres" til korte peptider ved anvendelse av trypsin og renses (trinn 9). Nano reversfase væskekromatografi koblet til massespektrometri (nano-LC-MS) tillater bestemmelse av mengden av endelige proteiner i det mRNA-bundne proteomet (trinn 10). Til slutt karakteriseres de identifiserte mRBPene og katalogiseres ved hjelp av bioinformatisk analyse (trinn 11).

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. Arabidopsis Leaf Mesophyll Protoplast Isolasjon

MERK: Arabidopsis leaf mesophyll protoplaster er i det vesentlige isolert som beskrevet av Yoo et al ., 2007, med flere modifikasjoner 40 .

  1. Vekst av planter
    1. Soak ca 200 Arabidopsis thaliana Col-0 økotype frø i sterilisert vann i 2 dager ved 4 ° C i mørket for stratifisering.
      MERK: Dette antallet frø er nok for en ikke-CL-prøve og en CL-prøve (se trinn 1.3).
    2. Forbered gryter med en 50% ( v / v ) blanding av jord og vermikulitt og sukk potten med destillert vann i en brett for å våte jorden.
    3. Så og distribuere stratifiserte frø på våt jord. Ikke dekk frøene med ekstra jord fordi Arabidopsis frø trenger lys for spiring.
      MERK: Plantevekstforholdene er en 12 h lys / 12 h mørk syklus ved 23 ° C,Med en lysintensitet på 100 μmol m -2 s -1 , i et vekstrom i 5 uker før blomstringen. 4 uker gamle planter kan også brukes 40 .
      MERK: Alle beskrivne materialer og reagenser fra trinn 1.2.1 til trinn 3.2.3 er for to prøver ( dvs. en ikke-CL-prøve (kontrollprøven som ikke er utsatt for UV-C-bestråling) og en CL-prøve (forskningen Prøve som er utsatt for UV-C bestråling)).
  2. Fremstilling av isotonisk enzymoppløsning
    1. Lag 80 ml primær isotonisk enzymoppløsning (400 mM mannitol, 20 mM KCl og 20 mM MES-buffer (pH 5,7)) og oppvarm oppløsningen umiddelbart i en 60 ° C inkubator i 10 minutter.
    2. Tilsett 1,2 g Cellulase R10 ( w / v 1,5%) og 0,32 g Macerozyme R10 ( w / v 0,4%) pulver til den varme primære isotoniske enzymoppløsningen.
    3. Ta forsiktig enzympulveret i oppløsning ved å bruke forsiktig omrøring. RapOppvarm oppløsningen i en 60 ° C inkubator i 10 minutter til enzymoppløsningen er klar lysebrun.
    4. Avkjøl løsningen på is i 3 minutter og tilsett 800 ul av 1 M CaCl2 og 800 pl 10% (vekt / volum) BSA til løsningen.
    5. Homogeniser løsningen ved pipettering og filtrering gjennom et 0,22 μm filter. Aliquot denne siste isotoniske enzymoppløsningen i to store Petri-tallerkener (150 mm x 20 mm).
  3. Fremstilling av Arabidopsis rosettbladstrimler
    MERK: 150 blader for hver petriskål anbefales for en ikke-CL-prøve eller en CL-prøve.
    1. Velge og kutte en total på 300 fullt utvidede 2. - eller 3. -pair ekte blader (gjennomsnitt: 3 - 4 per rosett) i 0,5- til 1-mm bladstrimler ved hjelp av en ny og skarpt barberblad.
    2. Overfør og senk stripene umiddelbart inn i isotonisk enzymoppløsning.
      MERK: For å unngå kontakt med lys skal du alltid dekke tHan Petri-tallerkener med aluminiumsfolie. Ikke knus bladene. Bekreft at alle strimler er nedsenket i løsningen og ikke flyter på overflaten.
  4. Isolering av Arabidopsis blad mesofyll protoplaster
    1. Plasser aluminiumsfoliedekket petriskål i vakuumtørkere og infiltrer bladstrimlene under vakuum i 30 minutter. Derefter inkuberer Petri-tallerkene i mørket uten å riste ved romtemperatur i 2,5 timer.
    2. Rist forsiktig og kortvarig oppvasken horisontalt for hånd, forsøk å frigjøre protoplaster helt inn i enzymoppløsningen.
  5. Høsting og telling av protoplaster
    1. Filtrer protoplast-suspensjonen gjennom et nylonnettet på 35 til 75 μm. Aliquot filtratet av hver prøve i to 50 ml rundbunnsrør (ca. 20 ml filtrat i hvert rør).
    2. Skyll hver petriskål med 10 ml W5 buffer (154 mM NaCl, 125 mM CaCl
    3. Spinn alle fire rør i 5 minutter ved 100 xg for å pelletere protoplaster. Kast supernatanten og resuspender protoplastpelletsene forsiktig i hvert rør med 10 ml W5-buffer.
      MERK: Når du resuspenderer protoplastpelletsene, snu forsiktig røret opp og ned og forsiktig roter røret for hånd til pelletsene har forsvunnet. Ikke pipett pelleten direkte for å unngå å skade cellene.
    4. Gjenta trinn 1.5.3 en gang og kombinere protoplast-suspensjonen fra to rør av hver prøve i en 50 ml rundbunnsrør. Hold rørene på is.
    5. Telle protoplaster ved hjelp av et hemocytometer.
      MERK: Hver 20 celler innen 25 kuber er lik 2 x 10 5 protoplaster / ml. 150 blader skal gi omtrent 1 x 107 celler.Moduler å ha et like total antall protoplaster i ikke-CL- og CL-prøvene.
    6. Hold protoplastene på is i 30 minutter. Etterpå, roter rørene i 5 minutter ved 100 x g. Kast supernatanten og resuspender protoplastene i hvert rør med 20 ml MMG oppløsning (400 mM mannitol, 15 mM MgCl2, og 4 mM MES-buffer (pH 5,7)).

2. In vivo mRNA-protein kryssbinding ved UV-bestråling

MERK: Hold ikke-CL prøveslangen på is. CL-prøven må straks UV-bestråles.

  1. Overfør protoplastsuspensjonen inneholdende 1 x 10 7 celler fra CL prøverøret til en ny stor-skala petriskål (150 mm x 20 mm) og tilsett 30 ml iskald MMG løsning for å dekke plateoverflaten. Spred cellene i hele MMg-bufferen ved forsiktig pipettering. Plasser Petri-skålen uten toppdekselet i et UV-tverrbindingsapparat.
    MERK: Høyden mellom UV-lampenOg petriskålen er 8 cm.
  2. Bestråle prøven med 254 nm bølgelengde UV-lys og 0,00875 W / cm 2 UV-intensitet i 1 min, 3 min eller 5 min. Etter bestråling, delikutt raskt protoplast-suspensjonen i to nye 50 ml rundbunnsrør. Vask bunnen av parabolen med ytterligere 5 ml iskall MMg-oppløsning for å samle resten av protoplasterne og tilsett denne cellesuspensjonen til disse to rørene.
    MERK: 1 min ble valgt som optimal tilstand. Forklaringen finnes i representativresultatene .

3. Protoplast Lysis under denatureringsbetingelser

  1. Fremstilling av protoplastpellets for lysis
    1. Spinn ikke-CL-prøverøret sammen med de to CL-prøverørene fra trinn 2 ved 100 xg i 5 minutter og kast supernatanten. Plasser røret på protoplastpellet som ikke er i CL, tilbake på isen.
    2. Tilsett 10 ml iskall MMg-løsning til hvert CL-prøverør, allmTyld resuspender pelletsene, og kombiner dem igjen i ett 50 ml rundbundet rør. Spinn røret ved 100 xg i 5 min. Etter fjerning av supernatanten, hold CL-prototypen protoplastpellet på is.
  2. Protoplastlysis og homogeniserende protoplastlysat
    1. Tilsett 9 ml iskald lysis / bindingsbuffer (500 mM LiCl, 0,5% ( w / v ) litiumdodecylsulfat (LiDS), 5 mM ditiotreitol (DTT), 20 mM Tris-HCl (pH 7,5) og 1 mM EDTA (pH 8,0)) til cellepellet av hver prøve. Røyke lysprotokollene grovt ved pipettering opp og ned ca. 20 ganger til suspensjonen er homogent lysegrønn.
    2. Pass protoplastlysatet to ganger gjennom en 50 ml glasssprøyte med en smal nål (0,9 x 25 mm 2 ) for homogenisering. Inkuber lysatet på is i 10 minutter. Frys lysatene i flytende nitrogen og lagre ved -80 ° C i opptil 3 uker.

4. MRNP Pull-down og rensingAv Oligo-d (T) 25 perler

MERK: Alle følgende beskrevne materialer og reagenser, fra trinn 4.1 til trinn 4.4, er kun for en prøve ( dvs. en ikke-CL-prøve eller en CL-prøve). Protoplastlysatet må tilsettes umiddelbart til rørene som inneholder perler etter at perle supernatant lysis / bindingsbufferen er kassert.

  1. Fremstilling av oligo-d (T) 25 magnetiske perler for oligo (dT) -fangst
    1. Tine det frosne protoplastlysatet ved romtemperatur. Når lysatet er helt opptatt, hold lysantrøret på is.
    2. Aliquot 1,8 ml oligo-d (T) 25 magnetiske perler (5 mg / ml) i 6 nye 2 ml mikrosirkulasjonsrør på rundbunn på is. I hvert rør vasker perlesuspensjonen homogent med 600 μl lysis / bindingsbuffer ved kort pipettering opp og ned og forsiktig roterende ved 4 ° C i 2 minutter. Hold perlene på isen.
  2. binding
    1. PlassAlle 6 rør som inneholder perlene i et magnetisk rack ved 4 ° C i 3 minutter, noe som vil resultere i magnetisk fangst av perlene og rydding av suspensjonen.
      MERK: Når rørene er plassert i magnetstativet, vent til perlene er helt tatt, minst 3 min.
    2. Kast supernatanten og umiddelbart aliquot 9 ml protoplastlysat i disse 6 rørene. Bland godt ved pipettering til en homogen brun suspensjon oppstår og inkuber perlene i protoplastlysat ved 4 ° C i 1 time ved å bruke forsiktig rotasjon.
      MERK: En inkubasjonstid fra 30 minutter til 1 time anbefales.
  3. vaske
    1. Plasser rørene tilbake i magnetstativet ved 4 ° C i 3 minutter. Når alle perler er tatt på siden av rørene, samle protoplastlysatet inn i 6 nye 2 ml mikrotrifugerør med rund bunn og lagre dem midlertidig ved 4 ° C. Ikke kast protoplastlysatet umiddelbart; Hold lysatetVed 4 ° C.
    2. Tilsett 1,5 ml iskall vaskebuffer 1 (500 mM LiCl, 0,1% ( w / v ) LiDS, 5 mM DTT, 20 mM Tris-HCl (pH 7,5) og 1 mM EDTA (pH 8,0)) til perlene I hvert rør. Resuspender perlene og bruk forsiktig rotasjon i 1 min. Plasser rørene tilbake i magnetstativet ved 4 ° C i 3 minutter og kast supernatanten. Gjenta dette vaske-trinnet med vaskebufferen en gang.
    3. Gjenta samme fremgangsmåte i dette vaske-trinnet to ganger ved bruk av 1,5 ml iskall vaskebuffer 2 (500 mM LiCl, 5 mM DTT, 20 mM Tris-HCl (pH 7,5) og 1 mM EDTA (pH 8,0)) og en gang ved bruk 1,5 ml iskald lavsaltbuffer (200 mM LiCl, 20 mM Tris-HCl (pH 7,5) og 1 mM EDTA (pH 8,0)).
      MERK: Hvis mRNP-ene er isolert effektivt fra protoplastlysatet, bør det være en "halo" som er synlig rundt perlpellet i CL-prøven under vaske-trinnet med vaskebuffer 2 ( figur 1B ).
  4. eluering
    1. Tilsett 500 μLAv elueringsbuffer (20 mM Tris-HCl (pH 7,5) og 1 mM EDTA (pH 8,0)) til perlene i hvert rør. Resuspender perlene forsiktig og inkuber ved 50 ° C i 3 minutter for å frigjøre poly (A) -talte RNA. Resuspender perlene forsiktig en gang ved pipettering. Plasser rørene tilbake i magnetstativet ved 4 ° C i 5 minutter.
    2. Overfør og kombiner alle elueringsmidler (ca. 3 ml totalt) til et rent, sterilt RNase-fritt, 15 ml konisk bunnrør på is.
      MERK: Kvaliteten og mengden av RNA kan umiddelbart bestemmes ved hjelp av en spektrofotometeranordning.
      MERK: RNA-konsentrasjonen av hver prøve er ca. 10 ng / μl, med et A 260 / A 280- forhold på 1,9. A 260 / A 280- forholdet bør være mellom 1,6 og 2,0 fordi de isolerte poly (A) -talte RNAene vanligvis er større enn 70% rene. Hvis RNA-konsentrasjonen er for lav, øker antallet startprotoplaster til maksimalt 10 9 . PrøverKan fryses i flytende nitrogen og holdes ved 80 ° C for langtidsoppbevaring.
    3. Gjenta trinn 4.2 til trinn 4.4 i ytterligere to runder, og bruk oligo-d (T) 25 perlene for å deplisere de poly (A) -talte RNAene fra protoplastlysatet.
      MERK: Etter tre runder av nedtrekksprosedyr, bør det være totalt 9 ml elueringsmiddel for hver ikke-CL eller CL-prøve. Utfør alt arbeid ved 4 ° C for å unngå nedbrytning av RNA. Følg trinn 4.5 eller trinn 4.6 for å gjenbruk eller regenerere perlene.
  5. Fremstilling av gjenbrukte oligo-d (T) 25 perler
    1. Vask perlene to ganger med 1 ml iskald elueringsbuffer og en gang med 1 ml iskald lysis / bindingsbuffer for å justere salt LiCl-konsentrasjonen tilbake til 500 mM.
    2. Følg trinn 4.1, kast supernatanten, overfør det lagrede protoplastlysatet i hvert rør, og gjenta hele prosedyren fra trinn 4.2 til trinn 4.4 i ytterligere to runder.
  6. 25 perler
    MERK: Perler kan lagres og brukes til et annet eksperiment (maksimal gjenbruk er tre ganger).
    1. Følg trinn 4.4, tilsett 1 ml 0,1 M NaOH til perlene, og inkuber ved å rotere ved romtemperatur i 5 minutter. For hvert rør vaskes to ganger med 1 ml vaskebuffer 1 og tre ganger med 1 x PBS (pH 7,4) som inneholder 0,1% Tween-20 for ekvilibrering. Hold perlene fra hvert rør i 300 μL steril RNase-fri 1x PBS (pH 7,4) som inneholder 0,1% Tween-20 ved 4 ° C for langvarig lagring.
      MERK: Perler brukt til Arabidopsis CL prøver i dette eksperimentet kan bare brukes til samme planteprøver neste gang.

5. Proteinase K Behandling og mRNA rensing

  1. Proteinase K-behandling
    1. Tilsett 8 μl Proteinase K-løsning (2 μg / μl) til 1 ml av elueringsmidlet fra hver prøve for å fordøye de UV-tverrbundne proteiner. BrEllig vortex.
  2. MRNA rensing
    1. Inkuber elueringsmiddelet ved 37 ° C i 1 time. Rens RNA ved hjelp av RNA-rensingssettet for å fjerne resterende forurensninger.
      MERK: Etter rensing er RNAene klare for RNA-kvalitetstesten ved hjelp av qRT-PCR-analysen.
      MERK: Andre sett, som RNA mini-kit og TRIzol-reagens, kan også brukes 14 .

6. qRT-PCR-analyse

  1. Omvendt transkripsjon
    1. Oppnå effektiv syntese av første streng cDNA ved hjelp av revers transkripsjonssystemet, med 1 ug RNA som mal. Fortynn prøven til 5 ng / μL med nukleasefritt vann.
  2. CDNA-kvantifisering ved bruk av qRT-PCR
    1. Forsterk og kvantifiser cDNA ved hjelp av qPCR-masterblandingen og sanntids-PCR-sikleren, med 10 ng cDNA som mal. Bruk følgende PCR-program: 95 ° C i 10 minutter(Trinn 1, en syklus) og 95 ° C i 15 s og 60 ° C i 1 min (trinn 2, 40 sykluser).
      MERK: Referansegenet brukt her var et endogent internkontrollgen, UBQ10 (AT4G05320). QRT-PCR primere for UBQ10 og 18S rRNA ble beskrevet i Li et al ., 2014 og Durut et al ., 2014, henholdsvis 45 , 46 . Primer-sekvenser er oppført i materialetabellen .

7. RNase behandling og mRBP konsentrasjon

  1. RNase behandling
    1. Tilsett ca. 100 U RNase-cocktail inneholdende RNase A og RNase T1 i 8 ml elueringsmiddel. Inkluder en negativ kontrollprøve med RNase-cocktail der elueringsmiddelet er erstattet av nukleasefritt vann. Kortvarig hvirvel og inkuber ved 37 ° C i 1 time.
  2. MRBP konsentrasjon
    1. Etter RNase fordøyelse, konsentrere elueringsmiddelet usinG sentrifugale filterenheter. Endevolumet er 75 ul, med et totalt proteinutbytte på ca. 2 μg av hver prøve etter konsentrasjon. Plasser prøvene ved -80 ° C for langtidsoppbevaring.

8. SDS-PAGE og Silver Staining

  1. SDS-PAGE
    1. Bland 25 μl av den konsentrerte eluenten (CL-prøven) eller kontrollprøven (ikke-CL-prøve) med 15 μl 2x fargestoff. Varm prøven ved 95 ° C i 5 minutter og last den på en SDS-PAGE gel inneholdende 5% stablingsgel og 12% oppløsende gel, inkludert en proteinmarkør.
    2. Kondenserer proteiner ved 60 V i 40 minutter og separeres ved 160 V i ca. 1 time til fargestoffet når slutten av oppløsningsgelen.
  2. Sølvfargingsanalyse
    1. Vask SDS-PAGE gelen to ganger med ultrapure vann i 5 minutter hver gang. Utfør sølvfarvingen av proteiner ved hjelp av et kommersielt sølvfargesett.
      MERK: Proteinbåndene må vises innen 5 minutter. Hvis båndene er synlige utover 5 min med meget lys farge, anbefales det å øke antall startprotoplaster opp til maksimalt 10 9 .

9. Trypsin Fordeling av Proteinbånd og Peptidrensing

  1. Trypsin fordøye
    MERK: Kjør en annen 1D-PAGE-gel ved å ta ytterligere 25 μl konsentrert mRBP-løsning fra hver prøve for mRBP-identifikasjon; Sølvfarget gel kan ikke brukes siden de ikke er kompatible med MS-analyse.
    1. Etter å ha kjørt 1D-PAGE-gelen, fikser du gelen i fikseringsløsning (50% ( volum / volum ) metanol og 10% ( volum / volum eddiksyre) i 1 time. Stain gelen i flekkoppløsning (0,1% ( w / v ) Coomassie Brilliant Blue R-250, 50% ( volum / volum ) metanol og 10% ( volum / volum eddiksyre) i 20 minutter med forsiktig risting. Destillér gelen i løsningen (40% ( volum / volum ) metanol og 10% ( v/ V) eddiksyre) i 1 time. Etter avfelling, hold gelen i 5% ( volum / volum ) eddiksyre.
      MERK: Under destaining kan ny destain løsning erstattes til bakgrunnen er fullstendig ødelagt.
    2. Klipp båndene av interesse ut av gelen. Klipp båndene videre i stykker på ca. 1 mm 3 for den etterfølgende optimale trypsinfordøyning og ekstraksjon av peptider. Hydrat gelbitene med 50 pl 100 mM ammoniumbikarbonat (NH4 HCO3) i 10 minutter. Dekk gelstykkene helt.
      1. Fjern den hydrerende løsningen forsiktig og dehydrere gelbitene med acetonitril (CH 3 CN) i 10 minutter. Fjern forsiktig acetonitril-løsningen.
      2. Gjenta prosessen fra hydrering til dehydrering to ganger. Til slutt fjern acetonitril-løsningen.
        MERK: Gelens kjøretid avhenger av formålet med eksperimentet. En langsiktig tid tillater en god separasjon av proteiner, slik at det fargede spesifikke gelforbudetDs kan klippes ut for videre analyse. Hvis hensikten er å holde proteiner og fjerne forurensninger, er en kortvarig tid tilstrekkelig.
    3. Tilsett 500 μL 6,6 mM DTT-oppløsning og inkuber gelstykkene i 10 minutter. Fjern DTT-løsningen og vask gelstykkene to ganger med 500 μl 95% ( v / v ) acetonitriloppløsning.
      1. Etter vask, fjern acetonitriloppløsningen og inkuber gelbittene med 500 ul 55 mM jodeddiksyre (IAA) -løsning i 10 minutter i mørket.
      2. Etter inkubering, fjern løsningen og vask gelstykkene igjen med 500 μL 95% ( volum / volum ) acetonitriloppløsning. Tørk gelstykkene.
    4. Embed gelbrikkene fullstendig med 25 ul digestionsbuffer (50 mM NH 4 HCO 3 , 5 mM CaCl 2 og 6 ng / μl trypsin) og hold på is i 45 minutter for å la trypsinet gjennomsyre inn i gelen. Inkubér gelbitene over natten ved 37 ° C for en Zymatisk fordøyelse.
  2. Peptidrensing
    1. Tilsett 80 ul 50 mM NH4 HCO3 til gelstykkene i nedbrytningsbuffer og vortex gjentatte ganger for å trekke ut de tryptiske peptider. Samle ekstraktet. Gjenta dette ekstraksjonstrinn to ganger med 80 ul 50% (v / v) CH3CN og 5% (v / v) maursyre (FA).
      MERK: Det totale endelige ekstraktet skal være ca. 240 μl.
    2. Bassenget og konsentrere ekstraktene i ca. 10 μl ved vakuumkonsentrasjon eller lyofilisering og tilsett 25 μl 0,1% ( v / v ) vandig trifluoreddiksyre (TFA) løsning. Avhend prøvene med μ-C18 kolonner, etter produsentens protokoll.
    3. Eluere peptidene med 4 - 10 pl 60% (vekt / vol) CH3CN og 0,1% (v / v) FA. Lyofiliser (frysetørke) peptidene og lagre dem ved -20 ° C til analyse.
Tittel "> 10. Nano-LC-MS

  1. Nano revers-fase væskekromatografi
    MERK: Utfør LC-MS analysen med et massespektrometer som er onlinekoblet med et væskekromatografi instrument. Dette instrumentet skal være utstyrt med en C18-kolonne (2 μm partikkel, 100 Å porestørrelse og 50 μm x 15 cm i dimensjon).
    1. Resuspender de lyofiliserte peptidene i 16 ul av oppløsning (2% (v / v) CH3CN og 0,1% (v / v) FA). Injiser og last 5 μL peptidoppløsning ved en strømningshastighet på 5 μl / min på en C18-forløp (3 μm partikkelstørrelse, 100 Å porestørrelse, nanoviper og 75 μm x 2 cm i dimensjon).
    2. 10.1.2. Separat peptidene ved hjelp av en 95-min gradient med en strømningshastighet på 300 nL / min. Under denne separasjonsgradienten øker mobilfasen B fra 4% til 10%, 10% til 25% og 25% til 45% i henholdsvis 5 min, 50 min og 18 min. Endelig øker mobilfasen B kraftig til 95% på 1 min. EtterHver 95 min-separasjonsgradient anvender et inneboende skyllingstrinn som inneholder en 10-min-gradient fra 4% til 95% i 5 minutter.
      MERK: Mobilfase A er 99,9% H2O og 0,1% (v / v) FA, og mobil fase B 19,92% H 2O, 80% (vekt / vol) CH3CN, og 0,08% (v / v ) FA.
  2. Massespektrometrianalyse
    1. Bruk massespektrometeret i dataavhengig modus med et massespekter fra 400 til 1600 m / z.
    2. Velg opptil ti av de mest intense ionene i MS1 for å generere fragmenteringsspektra. Still oppløsningen til 70.000 full bredde ved halv maksimal (FWHM) for MS1 og 17.000 for MS2, med et mål for automatisk forsterkningskontroll (AGC) på 3.000.000 og 1.000.000 ioner og en maksimal ion injeksjonstid (IT) på 256 og 64 ms for MS1 Og MS2, henholdsvis.
    3. Sett den dynamiske ekskluderingen til 10 s for å unngå gjentatt fragmentering av de mest jevne ionene.
      MERK: Her er ioner med en eller flere enn seks ladninger eXcluded for MS2.
  3. Kvalitativ proteomikk: peptid og proteinidentifikasjon
    1. Analyser fragmenteringsspektra ved hjelp av programvare som Peaks studio programvare 47 , 48 , 49 .
      MERK: Andre programvarepakker er også tilgjengelige for peptididentifikasjon, for eksempel NovoHMM 30 og PepNovo 37 for de novo- sekvensering og SEQUEST 54 og Mascot 55 for databasesøking.
    2. Kombiner spektra med samme masse (<2 ppm forskjell) og retensjonstid (<2 min) og behold bare spektra med en kvalitetsterskel høyere enn 0,65 for å søke i Swiss-Prot-databasen (versjon: desember 2013) for taksonomi som er satt til modell Plante Arabidopsis thaliana . Bruk følgende søkeparametere: En forløpermassetoleranse på 10 ppm ved bruk av månenOisotopisk masse; En fragmentmassetoleranse på 20 mmu; Trypsin som fordøyelsesenzymet, med maksimalt 2 savnede spaltninger; Cysteinkarbamidometylering som den faste modifikasjon; Metioninoksydasjon som variabel modifikasjon; Og maksimalt 3 variable post-translasjonelle modifikasjoner per peptid. Etter identifikasjon, still inn terskelverdiene manuelt for pålitelig peptid- og proteinidentifikasjon slik at en falsk oppdagelsesrate (FDR) <5% er oppnådd.
  4. Kvantitativ proteomikk: Statistisk analyse av massespektrometri data
    1. Bruk LC-MS ( f.eks. Progenesis) for etikettfri kvantitering av proteomics data.
      MERK: MS1 peptid topp områder (eller intensitet) er knyttet til peptidene identifisert av studio-programvaren i henhold til deres masse, med den tolererte feilen med maksimalt 10 ppm.
      MERK: Denne programvaren beregner overflaten av et peptid ved å integrere toppområdene i alle ladestatusene mellom 2 <Sup> + og 8 + . De kvantitative dataene er knyttet til PEAKS-peptididentifikasjonen ved hjelp av et internt skript (massematching med tolerert feil ved maksimalt 10 ppm).
    2. Beregn gjennomsnittlig log2-fold endringer (CL / ikke-CL) for hvert peptid. Samle fold-endringene av de unike peptidene ved protein.
      MERK: I hver gruppe er den endelige fold-endringen av et protein lik den gjennomsnittlige fold-endringen av peptidene.
    3. Beregn p-verdien ved hjelp av Studentens t- test for hver gruppe for å evaluere statistisk signifikans. Bruk R-programvarepakke (versjon 3.3.0) for å korrigere p-verdiene for FDR for alle grupper ved hjelp av Benjamini-Hochberg (BH) -metoden.
    4. Tegn vulkanplanen ved å bruke "kalibrere" -funksjonen (versjon 1.7.2) kompatibel med R-programvarepakken (versjon 3.3.0).
      MERK: Her er de -log10-justerte p-verdiene (-log10 (adj. P-verdi)) en funksjon av de log2-foldige endringene av alle identifiserte proteiner. Proteiner erBehandlet som positive treff i det mRNA-bundne proteomet hvis deres log2-fold-endringer er større enn 2, med eller uten betydning.

11. Katalog over det identifiserte mRNA-bundet Proteome

  1. Klassifiser de identifiserte proteinene fra trinn 10 i tre kategorier basert på elementene "molekylære funksjoner og biologisk prosess" via Gene Ontology (GO) databasen og "familie og domene" via InterPro databasen.
  2. Som kategori I, eller "Ribosomale proteiner", inneholder alle detekterte ribosomale proteiner, definerer proteiner fra kategori II, eller "Main RBPs", som inneholder annoterte proteindomener som interagerer med RNA eller linker til RNA-binding med kjente eller ukjente funksjoner i RNA-biologi .
  3. Ettersom proteiner med kjente eller ukjente funksjoner i RNA-biologi uten annoterte RNA-bindende domener er plassert i kategori III, eller "Kandidat-RBPer", definerer enzymer fra kategori III basert på merknader fra INtEnz database.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Vi observerte en karakteristisk halo som omgir perlepellet i CL-prøven, i vaske trinn 4.3 med vaskebuffer 2 ( figur 1B ). Selv om det ikke er blitt undersøkt, kan dette fenomenet sannsynligvis forklares av forstyrrelsen av tverrbundne mRNP-komplekser med perleaggregering under magnetisk fangst, hvilket forårsaker et mer diffust aggregat å danne. Det indikerer at oligo-d (T) 25 perlefangst var effektiv 14 .

De signifikant høyere UBQ10- referansemRNA-nivåene enn 18S rRNA i både ikke-CL-kontroll og CL-prøver er vist i figur 1C . Dette indikerer at mRNAer anrikeres i elueringsmiddelet på grunn av fangsten ved oligo-d (T) 25 perler, som bare kan binde til poly (A) -tappede mRNAer. Effektiviteten av oligo-d (T) 25 vulstfangst var ytterligere suppOrted ved SDS-PAGE og sølvfarging (trinn 8), som vist i figur 1D etter RNase-behandling og mRBP-konsentrasjon (trinn 7). En forskjell i proteinbåndsmønster mellom ikke-CL-kontroll og CL-prøvebaner kan tydelig observeres, og proteinbåndene som er til stede i ikke-CL-kontrollprøvebanen, kan forklares ved nærvær av RNase. Dette illustrerer sterk anrikning av mRBP i CL-prøven.

Effektiviteten av tverrbinding kan styres ved å variere tidsvarigheten av UV-bestråling. Tilstrekkelig tverrbinding, men unngåelse av protoplastskader og RNA-nedbrytning er optimal. I figur 1D ble det oppnådd spesifikke proteinbåndsmønstre i alle CL-prøver ved sammenligning av forskjellige UV-bestrålingstider (1, 3 og 5 minutter). Under den samme UV-intensiteten (0,00875 W / cm 2 ) ble de mest optimale forholdene funnet å være 1 eller 3 minutter på grunn av uforskjelligeProtein bånd intensiteter. Svakere båndintensiteter ble observert med lengre tverrbindings-tid (5 min). Vi betraktet 1 minutt som den optimale betingelsen fordi en kortere varighet av tverrbinding har den ekstra fordelen av lettere overføring og samling av protoplaster fra petriskålen. Protoplaster kan raskt utfelles til bunnen av petriskålen under UV-bestråling fordi de holder seg fast i bunnbunnen. Dette gjør det vanskeligere å samle inn og overføre dem til rørene etter lengre UV-bestrålingsvarighet.

Basert på de optimaliserte forhold ble identifiseringen av proteiner fra tre biologiske replikater oppnådd ved kvalitativ og kvantitativ proteomik, som ble beskrevet i trinnene 9 og 10. I analysen ved kvalitative proteomikker ( Figur 1E , høyre) ble totalt 341 proteiner Ble identifisert i CL-prøver, hvorav 36 ble funnet både i ikke-CL-kontroll anD CL-prøver, og bare 8 proteiner ble detektert i ikke-CL-kontrollprøven. Denne enorme forskjellen i identifiserte protein tall mellom begge prøvene er i overensstemmelse med de forskjellige proteinbåndsmønstrene ( Figur 1D ), og støtter ideen om at SDS-PAGE og sølvfargingsanalysen er gode verktøy for å validere effektiviteten til oligo-d (T) 25 perle fangst. I analysen ved kvantitativ proteomikk ( Figur 1E , venstre) viste totalt 325 proteiner (blå og grønnfarget) en log2-fold endring større enn 2. Blant disse proteinene hadde 100 proteiner (blåfarget) liten p -verdier over signifikansnivået. Derfor ble de også definert som positive treff. Det er bemerkelsesverdig at p-verdiene av en annen 225 proteiner (grønn-farget) var større enn 0,05, under signifikansnivået på grunn av dataløshet. Med andre ord var det lavt rikelig peptider tilstede for hvert protein, med høy variasjon av peptid intensitetes. Men fordi de alle ble kvalitativt oppdaget bare i CL-prøver, ble de ansett som positive.

Basert på GO og InterPro databasene 50 (trinn 11) ble disse 325 proteiner videre klassifisert i kategori I (ribosomale proteiner), kategori II (hoved-RBP) og kategori III (kandidat-RBPer) ( figur 1F ). Det var 123 ribosomale proteiner i kategori I, mens i kategori II ble det observert 70 annoterte klassiske RBP. Disse to kategoriene, som inneholder de fleste annoterte proteiner som knytter seg til molekylær RNA-binding og RNA-biologi ( Figur 1F , høyre), og som opptar ca. 38% og 22% av hele mRNA-bundet proteome, angir høy effektivitet av optimalisert mRNA-interaktiv fange. De siste 40% (132 kandidat RBP) ble klassifisert i kategori III på grunn av mangel på konvensjonelle RBDer. Videre er det meste av thEir roller i RNA binding og RNA biologiske prosesser er ikke validert ( Figur 1F , venstre). Vi antar at proteiner fra denne kategorien kunne avsløre nye funksjoner i RNA-regelverket.

Figur 1
Figur 1: Flytskjema og resultater av den optimaliserte metoden for å oppdage mRNA-bundet protein fra Arabidopsis Leaf Mesophyll Protoplasts. ( A ) Hovedtrinnene i hele metoden er listet fra 1 til 11. Putative cellulære og molekylære prosesser er illustrert av bildet og tegneseriene. Detaljer for hvert trinn er blitt beskrevet intensivt i protokollen. ( B ) En halo ble observert rundt pelletspelleten i CL-prøven, men ikke i ikke-CL-kontrollprøven, under vaske trinn 4.3. ( C ) Sammenligning av relativ UBQ10 mRNA og 18S rRNA leveI ikke-CL-kontroll og CL-prøver ved qRT-PCR (verdier er gjennomsnittlig ± SD (n = 3); * og **: signifikante forskjeller med p <0,05 og <0,01). (D) Konsentrert proteinforholdet av ikke-CL kontrollprøve sammenlignet med CL prøvene bestrålt med en kontinuerlig-bølge UV-kilde for 1, 3, og 5 min, med UV-intensitet på 0,00875 W / cm2. ( E ) Identifikasjon av mRNA-bundet proteome av proteomics. I de kvantitative proteomikkene som utføres av Progenesis-programvarepakken (til venstre), viser vulkanplanen de gjennomsnittlige log2-fold-endringene (CL / ikke-CL) og tilhørende justerte p-verdier (-log10 (adj. P-verdier)) av Alle proteiner. I de kvalitative proteomikkene som utføres av Peaks-programvarepakken (høyre), er proteiene i prøvene illustrert i Venn-diagrammer. Mengden av proteiner er oppført i tall. FDR ved peptid og protein nivåer er under 5%. Antallet proteiner i de lysebrune rammene betraktes som positive treff. ( et al ., 2016. Vennligst klikk her for å se en større versjon av denne figuren.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Vi har med suksess anvendt mRNA interactome capture, utviklet for gjær og humane celler, til planteblad mesofyll protoplaster. Blad mesofyllceller er den viktigste typen bakkevev i plantebladene. Den største fordelen med denne metoden er at den bruker in vivo tverrbinding for å oppdage proteiner fra et fysiologisk miljø.

I denne protokollen presenterer vi hovedsakelig en rekke optimerte eksperimentelle forhold ( f.eks. Antall protoplaster som skal brukes som utgangsmateriale og varigheten av UV-bestråling) 50 . De innfangede proteinene i CL-prøvene kan bare detekteres ved SDS-PAGE og sølvfarging når minst 10 7 protoplaster (middels skala) blir brukt (trinn 1.5.5). Lavere konsentrasjoner gir ikke et observerbart mRBP-mønster på SDS-PAGE og bør sannsynligvis ikke brukes til videre analyse av proteomics. Faktisk bruker mer enn 10 7 celler ( f.eks. 10 9 inEt stort eksperiment) er også mulig 20 . Resultater fra sølvfargings analyser tyder på at UV-bestråling i 1 min med 0,00875 W / cm2 av intensitet som genereres av en kontinuerlig bølge UV-kilden er optimal (figur 1D). Høy effektivitet ved det kritiske trinnet ( dvs. mRNP-nedtrekk og rensing ved oligo-d (T) 25 perler, trinn 4) støttes av resultatene fra RT-qPCR, sølvfarging og MS-analyser ( Figur 1C ; 1D ; og 1E , høyre). Kombinasjonen av kvalitative og kvantitative proteomics kan bidra til å identifisere de positive RBPene i overlappingsområdet mellom ikke-CL-kontroll og CL-prøver ( Figur 1E ). Flertallet av identifiserte proteiner var RBPer som ikke tidligere var annotert i datasett ( Figur 1F ). Vi presenterte disse tidligere ukjente RNA-bindende proteiner i kategori III som kandidat-RBP'er <Sup class = "xref"> 50 ( figur 1F ). Undersøkelse av bindingsspecifikitetene til disse kandidat-RBPene må gjøres ved å anvende andre metoder, som for eksempel de tidligere nevnte CLIP-metodene 23 . Et eksempel som undersøker bindingsspecifikiteten til en RBP for å regulere sitt målmRNA-transkripsjon i Arabidopsis ved bruk av CLIP 51, finnes i Zhang et al ., 2015. I tillegg er en alternativ modifisert metode fra PAR-CLIP, kalt fotoaktiverbar- Ribonukleosidforbedret tverrbinding (PAR-CL, 365 nm UV-A) har også tidligere blitt anbefalt for undersøkelse av mRNA-bundet proteomer fra gjær og humane celler 14 , 23 . PAR-CL krever 4Su, som tas opp av celler og inkorporeres i nascent RNAs under RNA-metabolisme og kan være svært reaktiv, danner kovalente bindinger med aminosyrer 52 under UV-A (365 nm) irradiasjon. For tiden er det ingen studier som fokuserer på toksisiteten av 4sU til plantecellene og effektiv opptak av eksogene 4sU i mesofyllprotoplaster 53 . Imidlertid tror vi at det vil bli mulig å bruke både konvensjonelle CL (254 nm UV-C) og PAR-CL (365 nm UV-A) på planter som vil bidra til oppdagelse og validering av ulike RBP fra fysiologiske Miljø i fremtiden.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Forfatterne har ingenting å avsløre.

Acknowledgements

Vi anerkjenner laboratoriet av prof. Joris Winderickx, som ga UV-tverrbindingsapparatet utstyrt med den konvensjonelle UV-lampen. KG støttes av KU Leuvens forskningsfond og anerkjenner støtte fra FWO-stipend G065713N.

Materials

Name Company Catalog Number Comments
REAGENTS
0.8 M Mannitol Sigma M1902-500G Primary isotonic Enzyme solution &
MMg solution
2 M KCl MERCK Art. 4935 Primary isotonic Enzyme solution &
W5 buffer
0.2 M MES (pH 5.7)
(4-morpholineethanesulfonic acid)
Sigma-aldrich M2933 Primary isotonic Enzyme solution,
W5 buffer &
MMg solution,
Filtration sterilization
Cellulase R10 Yakult Pharmaceutical Industry Co., Ltd. CELLULASE
“ONOZUKA”
R-10, 10 g
Final isotonic enzyme solution
Macerozyme R10 Yakult Pharmaceutical Industry Co., Ltd. MACEROZYME R-10, 10g Final isotonic enzyme solution
10% (w/v) BSA
(Bovine Serum Albumin)
Sigma-aldrich A7906-100G Final isotonic enzyme solution &
Filtration sterilization
1 M CaCl2 Chem-Lab NV CL00.0317.1000 Final isotonic enzyme solution,
W5 buffer &
Digestion buffer
1 M NaCl Fisher Chemical S/3160/60 W5 buffer
2 M MgCl2 Sigma M8266-100G MMg solution
1 M LiCl
(Lithium Chloride)
Acros 199885000 Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2 &
Low salt buffer
5% (w/v) LiDS
(Lithium Dodecyl Sulphate)
Sigma-aldrich L4632-25G Lysis/binding buffer,
Wash buffer 1 &
Filtration sterilization
1 M DTT
(Dithiothreitol)
Thermo Fisher Scientific
Wash buffer 1 &
Wash buffer 2
307866 Lysis/binding buffer,
1 M Tris-HCl (pH 7.5) (Tris(hydroxymethyl)aminomethane, Hydrochloric acid S.G. (HCl)) Acros &
Fisher Chemical
167620010 &
H/1200/PB15
Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2,
Low salt buffer &
Elution buffer
0.5 M EDTA (pH 8.0) (Ethylenediaminetetraacetic acid) Sigma-aldrich ED-500G Lysis/binding buffer,
Wash buffer 1,
Wash buffer 2,
Low salt buffer &
Elution buffer
Tween 20 MERCK 8.22184.0500 Regeneration of oligo-d(T)25 beads
0.1 M NaOH VWR PROLABO CHEMICALS 28244.295 Regeneration of oligo-d(T)25 beads
1x PBS (pH 7.4)
(Phosphate Buffered Saline)
containing
(NaCl; KCl; Na2HPO4; KH2PO4)
Fisher Chemical, MERCK,
Sigma-aldrich & SAFC
S/3160/60,
Art. 4935,
71640-250G &
60230
Regeneration of oligo-d(T)25 beads
Proteinase K solution (2 μg/μL) Thermo Fisher Scientific 11789020 Protein digestion
Loading dye Invitrogen LC5925 SDS-PAGE
qPCR master mix Promega A6001 qRT-PCR assay
RNase Cocktail Thermo Fisher Scientific AM2286 RNA digestion
Methanol Sigma-aldrich 322415 Gel fixation and gel destaining
Acetic acid Sigma-aldrich 537020 Gel fixation and gel destaining
Coomassie Brilliant Blue R-250 Thermo Fisher Scientific 20278 Gel staining
1 M NH4HCO3
(Ammonium bicarbonate)
 
Sigma-aldrich 09830-500G Gel hydration &
Digestion buffer
CH3CN
(Acetonitrile)
Sigma-aldrich 34851-100ML Gel dehydration &
Peptide dissolving solution
IAA
(Iodoacetic acid)
Sigma-aldrich I4386-10G Alkylating agent
TFA
(Trifluoroacetic acid)
Sigma-aldrich 302031-10X1ML Peptide dissolving solution
FA
(Formic acid)
Sigma-aldrich 06554-5G Peptide extraction
Trypsin solution (6 ng/μL) Promega V5280 Digestion buffer
Name Company Catalog Number Comments
EQUIPMENT
Soil Peltracom LP2D Plant growth
Vermiculite 3 Sibli AS 05VERMICULIET Plant growth
Petri dish (150 x 20 mm) Sarstedt 82.1184.500 Carrier for protoplast suspension
0.22 μm filter Millipore SE2M229104 Homogenization of final isotonic enzyme solution
Razorblade Agar Scientific T585 Rosette leaf strips
35-75 μm nylon mesh SEFAR NITEX 74010 Protoplast suspension filtration
50 mL round bottom tubes Sigma-aldrich T1918-10EA Carrier for protoplast suspension
Hemocytometer
(Bürker hemocytometer)
MARIENFELD 650030 Protoplast cell counting
UV crosslinking apparatus
(HL-2000 HybriLinker)
UVP, LLC UVP95003101 in vivo UV crosslinking
UV lamp
(Sankyo-Denki G8T5)
SANKYO
DENKI
SD G8T5 in vivo UV crosslinking
50 mL glass syringe FORTUNA Optima Z314560 Homogenization of protoplast lysate
Narrow needle (0.9 x 25 mm) Becton Dickinson microlance 3 2021-04 Homogenization of protoplast lysate
Rotator Model L26 Labinco BV 26110912 Sample incubation by rotating
Oligo-d(T)25 magnetic beads
(5 mg/mL)
New England BioLabs S1419S mRNPs and mRNAs binding and pull-down
Magnetic rack Invitrogen CS15000 mRNPs and mRNAs binding and pull-down
Centrifugal filter units
(Amicon Ultra-4 centrifugal filter units)
EMD Millipore UFC800308 mRBP concentration
Pierce Silver Stain Kit Thermo Fisher Scientific 24612 Silver-staining assay
RNA purification kit
(InviTrap Spin Plant RNA Mini Kit)
STRATEC Molecular 1064100300 RNA purification
Spectrophotometer device (NanoDrop 1000 Spectrophotometer) Thermo Fisher Scientific ND-1000 RNA quality and quantity
Real-Time PCR cycler
(StepOne Real-Time PCR cycler)
Thermo Fisher Scientific 4376600 cDNA quantification
µ-C18 columns
(Millipore Zip Tip µ-C18 columns)
Sigma-aldrich 720046-960EA Peptide purification
Mass spectrometer
(Q Exactive Hybrid Quadrupole-Orbitrap Mass Spectrometer)
Thermo Fisher Scientific IQLAAEGAAPFALGMAZR Mass spectrometry-based proteomics
Liquid chromatography instrument (Ultimate 3000 ultra-high performance liquid chromatography (UHPLC) instrument) Thermo Fisher Scientific ULTIM3000RSLCNANO Mass spectrometry-based proteomics
C18 column
(Easy Spray Pepmap RSLC C18 column)
Thermo Fisher Scientific ES800 Mass spectrometry-based proteomics
C18 precolumn
(Acclaim Pepmap 100 C18 precolumn)
Thermo Fisher Scientific 160321 Mass spectrometry-based proteomics
Name Company Catalog Number Comments
Primers for qRT-PCR assay Sequences
UBQ10 mRNA
(Li et al., 2014)
Fw: AACTTTGGTGGTTTGTGTTTTGG
Rv: TCGACTTGTCATTAGAAAGAAAGAGATAA
18S rRNA
(Durut et al., 2014)
Fw: CGTAGTTGAACCTTGGGATG
Rv: CACGACCCGGCCAATTA

DOWNLOAD MATERIALS LIST

References

  1. Jankowsky, E., Harris, M. E. Specificity and nonspecificity in RNA-protein interactions. Nat Rev Mol Cell Biol. 16, (9), 533-544 (2015).
  2. Glisovic, T., Bachorik, J. L., Yong, J., Dreyfuss, G. RNA-binding proteins and post-transcriptional gene regulation. FEBS Lett. 582, (14), 1977-1986 (2008).
  3. Gerstberger, S., Hafner, M., Tuschl, T. A census of human RNA-binding proteins. Nat Rev Genet. 15, (12), 829-845 (2014).
  4. Lin, Q., Taylor, S. J., Shalloway, D. Specificity and determinants of Sam68 RNA binding. Implications for the biological function of K homology domains. J Biol Chem. 272, (43), 27274-27280 (1997).
  5. Deo, R. C., Bonanno, J. B., Sonenberg, N., Burley, S. K. Recognition of polyadenylate RNA by the poly(A)-binding protein. Cell. 98, (6), 835-845 (1999).
  6. Kattapuram, T., Yang, S., Maki, J. L., Stone, J. R. Protein kinase CK1 alpha regulates mRNA binding by heterogeneous nuclear ribonucleoprotein c in response to physiologic levels of hydrogen peroxide. J Biol Chem. 280, (15), 15340-15347 (2005).
  7. Patel, G. P., Ma, S., Bag, J. The autoregulatory translational control element of poly(A)-binding protein mRNA forms a heteromeric ribonucleoprotein complex. Nucleic Acids Res. 33, (22), 7074-7089 (2005).
  8. Song, J. K., McGivern, J. V., Nichols, K. W., Markley, J. L., Sheets, M. D. Structural basis for RNA recognition by a type II poly(A)-binding protein. Proc Natl Acad Sci USA. 105, (40), 15317-15322 (2008).
  9. Lambert, N., Robertson, A., Jangi, M., McGeary, S., Sharp, P. A., Burge, C. B. RNA Bind-n-Seq: quantitative assessment of the sequence and structural binding specificity of RNA binding proteins. Mol Cell. 54, (5), 887-900 (2014).
  10. Cook, K. B., Kazan, H., Zuberi, K., Morris, Q., Hughes, T. R. RBPDB: a database of RNA-binding specificities. Nucleic Acids Res. 39, Database issue D301-D308 (2011).
  11. Konig, J., Zarnack, K., Luscombe, N. M., Ule, J. Protein-RNA interactions: new genomic technologies and perspectives. Nat Rev Genet. 13, (2), 77-83 (2012).
  12. Hockensmith, J. W., Kubasek, W. L., Vorachek, W. R., von Hippel, P. H. Laser cross-linking of nucleic acids to proteins. Methodology and first applications to the phage T4 DNA replication system. J Biol Chem. 261, (8), 3512-3518 (1986).
  13. Pashev, I. G., Dimitrov, S. I., Angelov, D. Crosslinking proteins to nucleic acids by ultraviolet laser irradiation. Trends Biochem Sci. 16, (9), 323-326 (1991).
  14. Castello, A., et al. System-wide identification of RNA-binding proteins by interactome capture. Nat Protoc. 8, (3), 491-500 (2013).
  15. Nagy, E., Rigby, W. F. Glyceraldehyde-3-phosphate dehydrogenase selectively binds AU-rich RNA in the NAD(+)-binding region (Rossmann fold). J Biol Chem. 270, (6), 2755-2763 (1995).
  16. Hentze, M. W., Preiss, T. The REM phase of gene regulation. Trends Biochem Sci. 35, (8), 423-426 (2010).
  17. Nicholls, C., Li, H., Liu, J. P. GAPDH: a common enzyme with uncommon functions. Clin Exp Pharmacol Physiol. 39, (8), 674-679 (2012).
  18. Baltz, A. G., et al. The mRNA-bound proteome and its global occupancy profile on protein-coding transcripts. Mol Cell. 46, (5), 674-690 (2012).
  19. Castello, A., et al. Insights into RNA Biology from an Atlas of Mammalian mRNA-Binding Proteins. Cell. 149, (6), 1393-1406 (2012).
  20. Kwon, S. C., et al. The RNA-binding protein repertoire of embryonic stem cells. Nat Struct Mol Biol. 20, (9), 1122-1130 (2013).
  21. Mitchell, S. F., Jain, S., She, M., Parker, R. Global analysis of yeast mRNPs. Nat Struct Mol Biol. 20, (1), 127-133 (2013).
  22. Beckmann, B. M., et al. The RNA-binding proteomes from yeast to man harbour conserved enigmRBPs. Nat Commun. 6, (10127), 1-9 (2015).
  23. Bailey-Serres, J., Sorenson, R., Juntawong, P. Getting the message across: cytoplasmic ribonucleoprotein complexes. Trends Plant Sci. 14, (8), 443-453 (2009).
  24. Quesada, V., Macknight, R., Dean, C., Simpson, G. G. Autoregulation of FCA pre-mRNA processing controls Arabidopsis flowering time. EMBO J. 22, (12), 3142-3152 (2003).
  25. Lim, M. H., et al. A new Arabidopsis gene, FLK, encodes an RNA binding protein with K homology motifs and regulates flowering time via FLOWERING LOCUS C. Plant Cell. 16, (3), 731-740 (2004).
  26. Hornyik, C., Terzi, L. C., Simpson, G. G. The spen family protein FPA controls alternative cleavage and polyadenylation of RNA. Dev Cell. 18, (2), 203-213 (2010).
  27. Stern, D. B., Goldschmidt-Clermont, M., Hanson, M. R. Chloroplast RNA metabolism. Annu Rev Plant Biol. 61, 125-155 (2010).
  28. Schmal, C., Reimann, P., Staiger, D. A circadian clock-regulated toggle switch explains AtGRP7 and AtGRP8 oscillations in Arabidopsis thaliana. PLoS Comput Biol. 9, (3), e1002986 (2013).
  29. Staiger, D. RNA-binding proteins and circadian rhythms in Arabidopsis thaliana. Philos Trans R Soc Lond B Biol Sci. 356, (1415), 1755-1759 (2001).
  30. Fischer, B., et al. NovoHMM: a hidden Markov model for de novo peptide sequencing. Anal Chem. 77, (22), 7265-7273 (2005).
  31. Kwak, K. J., Kim, Y. O., Kang, H. Characterization of transgenic Arabidopsis plants overexpressing GR-RBP4 under high salinity, dehydration, or cold stress. J Exp Bot. 56, (421), 3007-3016 (2005).
  32. Raab, S., Toth, Z., de Groot, C., Stamminger, T., Hoth, S. ABA-responsive RNA-binding proteins are involved in chloroplast and stromule function in Arabidopsis seedlings. Planta. 224, (4), 900-914 (2006).
  33. Liu, H. H., et al. Molecular cloning and characterization of a salinity stress-induced gene encoding DEAD-box helicase from the halophyte Apocynum venetum. J Exp Bot. 59, (3), 633-644 (2008).
  34. Wang, S. C., Liang, D., Shi, S. G., Ma, F. W., Shu, H. R., Wang, R. C. Isolation and Characterization of a Novel Drought Responsive Gene Encoding a Glycine-rich RNA-binding Protein in Malus prunifolia (Willd.) Borkh. Plant Mol Biol Report. 29, (1), 125-134 (2011).
  35. Lorkovic, Z. J., Barta, A. Genome analysis: RNA recognition motif (RRM) and K homology (KH) domain RNA-binding proteins from the flowering plant Arabidopsis thaliana. Nucleic Acids Res. 30, (3), 623-635 (2002).
  36. Ambrosone, A., Costa, A., Leone, A., Grillo, S. Beyond transcription: RNA-binding proteins as emerging regulators of plant response to environmental constraints. Plant Science. 182, 12-18 (2012).
  37. Frank, A., Pevzner, P. PepNovo: de novo peptide sequencing via probabilistic network modeling. Anal Chem. 77, (4), 964-973 (2005).
  38. Marondedze, C., Thomas, L., Serrano, N. L., Lilley, K. S., Gehring, C. The RNA-binding protein repertoire of Arabidopsis thaliana. Sci Rep. 6, (29766), 1-13 (2016).
  39. Reichel, M., et al. In Planta Determination of the mRNA-Binding Proteome of Arabidopsis Etiolated Seedlings. Plant Cell. 28, (10), 2435-2452 (2016).
  40. Yoo, S. D., Cho, Y. H., Sheen, J. Arabidopsis mesophyll protoplasts: a versatile cell system for transient gene expression analysis. Nat Protoc. 2, (7), 1565-1572 (2007).
  41. Niu, Y., Sheen, J. Transient expression assays for quantifying signaling output. Methods Mol Biol. 876, 195-206 (2012).
  42. Petersson, S. V., et al. An auxin gradient and maximum in the Arabidopsis root apex shown by high-resolution cell-specific analysis of IAA distribution and synthesis. Plant Cell. 21, (6), 1659-1668 (2009).
  43. Bargmann, B. O., Birnbaum, K. D. Fluorescence activated cell sorting of plant protoplasts. J Vis Exp. (36), (2010).
  44. Hong, S. Y., Seo, P. J., Cho, S. H., Park, C. M. Preparation of Leaf Mesophyll Protoplasts for Transient Gene Expression in Brachypodium distachyon. J Plant Biol. 55, (5), 390-397 (2012).
  45. Li, Y., Van den Ende, W., Rolland, F. Sucrose Induction of Anthocyanin Biosynthesis Is Mediated by DELLA. Mol Plant. 7, (3), 570-572 (2014).
  46. Durut, N., et al. A duplicated NUCLEOLIN gene with antagonistic activity is required for chromatin organization of silent 45S rDNA in Arabidopsis. Plant Cell. 26, (3), 1330-1344 (2014).
  47. Han, Y. H., Ma, B., Zhang, K. Z. SPIDER: Software for protein identification from sequence tags with De Novo sequencing error. J Bioinform Comput Biol. 3, (3), 697-716 (2005).
  48. Han, X., He, L., Xin, L., Shan, B., Ma, B. PeaksPTM: Mass spectrometry-based identification of peptides with unspecified modifications. J Proteome Res. 10, (7), 2930-2936 (2011).
  49. Zhang, J., et al. PEAKS DB: de novo sequencing assisted database search for sensitive and accurate peptide identification. Mol Cell Proteomics. 11, (4), 010587 (2012).
  50. Zhang, Z., et al. UV crosslinked mRNA-binding proteins captured from leaf mesophyll protoplasts. Plant Methods. 12, (42), 1-12 (2016).
  51. Zhang, Y., et al. Integrative genome-wide analysis reveals HLP1, a novel RNA-binding protein, regulates plant flowering by targeting alternative polyadenylation. CellRes. 25, (7), 864-876 (2015).
  52. Steen, H., Jensen, O. N. Analysis of protein-nucleic acid interactions by photochemical cross-linking and mass spectrometry. Mass Spec Rev. 21, (3), 163-182 (2002).
  53. Miller, C., et al. Dynamic transcriptome analysis measures rates of mRNA synthesis and decay in yeast. Mol Syst Biol. 7, (458), 1-13 (2011).
  54. Eng, J., McCormack, A. L., Yates, J. R. An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database. J Am Soc Mass Spectrom. 5, (11), 976-989 (1994).
  55. Perkins, D. N., Pappin, D. J. C., Creasy, D. M., Cottrell, J. S. Probability-based protein identification by searching sequence databases using mass spectrometry data. Electrophoresis. 20, (18), 3551-3567 (1999).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics