توليد نماذج خلية سرطان البروستاتا لمقاومة دوسيتاكسيل عامل مكافحة الانقسامية

Cancer Research
 

Summary

المقاومة لعلاجات السرطان يسهم في تطور المرض والموت. تحديد الأسس الميكانيكية للمقاومة أمر حاسم لتحسين الاستجابة العلاجية. تفاصيل المخطوطة هذا البروتوكول لتوليد نماذج خلية تشن مقاومة سرطان البروستاتا (PC) للمساعدة في تشريح المسارات تشارك في التقدم للمقاومة دوسيتاكسيل في المرضى PC.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Mohr, L., Carceles-Cordon, M., Woo, J., Cordon-Cardo, C., Domingo-Domenech, J., Rodriguez-Bravo, V. Generation of Prostate Cancer Cell Models of Resistance to the Anti-mitotic Agent Docetaxel. J. Vis. Exp. (127), e56327, doi:10.3791/56327 (2017).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

ميكروتوبولي استهداف عملاء (MTAs) دعامة أساسية في معالجة مجموعة واسعة من الأورام. ومع ذلك، هو المقاومة المكتسبة على أدوية العلاج الكيميائي إليه مشتركة لتطور المرض وميزة التنبؤات-العوامل المحددة للأورام الخبيثة. في سرطان البروستات (PC)، يملي المقاومة للاتفاقات التجارية المتعددة الأطراف مثل تشن دوسيتاكسيل فشل العلاج، فضلا عن التقدم نحو المراحل المميتة من المرض التي يتم تعريفها سوء تشخيص وارتفاع معدلات الوفيات. على الرغم من دراستها لعدة عقود، مجموعة الآليات التي تسهم في المقاومة المكتسبة ليست مفهومة تماما، وهكذا تشكل قيداً كبيرا على تطوير استراتيجيات علاجية جديدة يمكن أن تفيد المرضى في هذه المراحل المتقدمة المرض. في هذا البروتوكول، يصف لنا توليد دوسيتاكسيل المقاوم خطوط خلايا سرطان البروستات التي تحاكي ميزات قاتلة من سرطان البروستاتا المرحلة المتأخرة، وذلك يمكن استخدامها لدراسة الآليات التي تشيموريسيستانسي المكتسبة التي تنشأ. على الرغم من القيود المحتملة الجوهرية لخلية على أساس نموذج، مثل فقدان خصائص المقاومة مع مرور الوقت، خطوط الخلايا دوسيتاكسيل المقاوم المنتجة بهذه الطريقة قد استخدمت بنجاح في الدراسات الحديثة وتوفر فرصة للمضي قدما لدينا فهم الجزيئية تشيموريسيستانسي المكتسبة في سرطان البروستاتا المميتة.

Introduction

زيادة معدل الانتشار الناجم عن فقدان السيطرة على دورة الخلية السمة مميزة للسرطان1. هذه الخاصية الوظيفية الخلايا السرطانية يجعل فريد يعتمد على الإخلاص للعمليات الرئيسية لدورة الخلية خلال S-M-مراحل و، مما أدى إلى تطوير مختلف دورة الخلية مقاومة العقاقير التي تسبب تلف الحمض النووي أو عيوب الانقسامية. على الرغم من وكلاء مكافحة الانقسامية العديد، مثل مثبطات مؤنزم الانقسامية أو السيارات والبروتينات، ويجري حاليا تطوير واختبارها في التجارب السريرية، ميكروتوبولي القديمة تستهدف وكلاء (MTAs) الاستمرار في النهج المعتمد سريرياً فقط استهداف الانقسام في سرطان2،،من34. الاتفاقات التجارية المتعددة الأطراف أما زعزعة (فينبلاستيني, فينكريستيني, فينوريلبيني) أو استقرار microtubules (المشتقة من تاكساني وكلاء باكليتاكسيل أو دوسيتاكسيل أو كابازيتاكسيل) وبالتالي منع تكوين المغزل التفتلي عاملة5،6. هذه العوامل تؤدي المغزل الجمعية حاجز7،8، مما يسفر عن اعتقال الانقسامية المطول وموت الخلايا في نهاية المطاف في الخلايا المستزرعة9،10 وعيوب الانقسامية في الأورام11 ،12 ، وهي لذلك مفيدة لعلاج مجموعة كبيرة ومتنوعة من أنواع السرطان، منها سرطان البروستاتا13.

ومعظم الأحيان يتم تشخيص سرطان البروستاتا سرطان وسببا رئيسيا للسرطان المتعلقة بالوفيات في الرجال14. وكلاء أنتيميتوتيك مثل دوسيتاكسيل تحسين بقاء المريض سرطان البروستاتا وهي دعامة أساسية في علاج هذا المرض15،،من1617. ولسوء الحظ، وعلى الرغم من انكماش الورم الأولى، الخلايا السرطانية غالباً ما تضع مقاومة المخدرات أثناء فترة العلاج. العديد من الآليات الخلوية قد تورطت في التسبب في تنمية تشيموريسيستانسي، بما في ذلك إزالة القيود المفروضة على أبوبتوتيك ومسارات التحريضية، أو التنشيط/overexpression مضخات efflux المخدرات مثل الناقل ملزم ATP كاسيت فبروتين سكري (ف-gp/ABCB1)، هذه الأخيرة التي يؤدي تصدير وكلاء العلاج الكيميائي من أصل18،الخلايا19. كما ارتبطت المقاومة إلى تاكسانيس مع أسباب أخرى، مثل التغيرات في التعبير عن إيسوتيبيس توبولين أو الطفرات tubulin، التي تمنع التفاعل بين المخدرات ولها هدف 20،21. وعلاوة على ذلك، قد تم المتصلة بالمقاومة إلى تراكم عدم الاستقرار الجينوم والورم التغايرية22،23. ومع ذلك، آليات المساهمة في المقاومة تشن هي ليست مفهومة تماما، الذي هو واضح بسبب غياب الاستراتيجيات العلاجية التي تمنع مظهره. ولذلك، هناك حاجة ملحة لإنشاء النماذج التجريبية التي تساعد في تشريح هذه الآليات وتحديد النهج العلاجية الرواية التي تحول دون تطور المقاومة لهذه الأدوية.

في هذا المقال يصف لنا أسلوب الذي يتيح توليد دوسيتاكسيل المقاوم (DR) خلايا سرطان البروستاتا. كذلك ونحن سوف تصف كيفية التحقق من صحة حالة مقاومة هذه الخلايا باستخدام فحوصات تشكيل مستعمرة والكمية RT-PCR. الخلايا التي تنتجها هذه الطريقة لها ميزة أتصدى العديد من السمات الجزيئية في الأورام البشرية متاحة لنماذج قواعد البيانات مع فائدة إضافية تتمثل في توفير براعة لأداء مجموعة متنوعة من الاختبارات التجريبية على مدى فترات أطول مما يسمح به عينات الورم. هذه النماذج السرطان مقاومة العلاج يمكن توسيعها لعدة أسابيع في زراعة الأنسجة، وبين النهج الأخرى، يمكن وراثيا التلاعب بها، وتصور بأساليب الفحص المجهري وتحليلها للتعبير الجيني. وعلاوة على ذلك، يمكن أن تكون إكسينوتراسبلانتيد في الفئران لمواصلة تحليل الآثار في تشكيل ونمو الورم في فيفو. الأسلوب البديل الرئيسي لدراسة مقاومة المخدرات في سياق الإصابة بسرطان البروستات حاليا تحليل عينات الورم مباشرة. حين هذه العينات الحالي نظاما قويا جداً لجمع المعلومات حول التعبير الجيني وحيث حالة أورام معينة، يمكن الوصول إليها محدودة للغاية ومن الصعب الحفاظ على مزيد من التلاعب وتحليل تجريبي، الذي يمكن أن يتم بسهولة مع خطوط الخلايا التي تم إنشاؤها مع هذا البروتوكول24،25. الأهم من ذلك، في المستقبل، النهج البديلة مثل توليد البشرية أورجانويدس المشتقة مباشرة من المرضى أن تكون أداة قوية جداً وبديل لل26،الأسلوب الحالي27. وبما أنهم سوف الخص في سياق 3D ما ورم كان في بيئتها الأصلية، سيكون أورجانويدس النموذج المثالي بين خطوط الخلايا والأورام البشرية. حتى الآن، نماذج تجريبية الخلية المبينة في هذا البروتوكول لا يزال أكثر بأسعار معقولة للحفاظ على ومناسبة لتحليل أسرع. ويمكن استقراء للنتائج التي توصلت إليها دراسة هذه الخطوط الخلية وأيد في العينات البشرية والثقافات 3D. ولذلك، قد يكون هذا البروتوكول من اهتمام الباحثين البحث عن نماذج الخلية دراسة آليات تشيموريسيستانسي في أي خط الخلية، نظراً إلى أن البروتوكول يمكن تكييفها لدراسة العقاقير وأنواع السرطان الأخرى. الأساليب الموصوفة هنا من السهل تطبيق في أي مختبر، بأسعار معقولة والسماح للدراسات الأولية للآليات الجزيئية والخلوية للمقاومة للعقاقير.

Protocol

1-تحديد تركيز دوسيتاكسيل تسبب 50% انخفاض في "القدرة على تشكيل مستعمرة" (IC50)

ملاحظة: في هذا البروتوكول، تركيز IC50 دوسيتاكسيل قد تم تقييمها باستخدام تكوين مستعمرة القدرة. يمكن استخدام طرق بديلة تستخدم لتقييم جدوى الخلية (أي فحوصات MTS) استناداً إلى المحققين ' تفضيلات.

  1. تنمو DU145 أو 22Rv1 الخلايا في قارورة 2 75 سم وإعداد ما يكفي المخزون من 10 مم دوسيتاكسيل المخفف في [دمس] لاستخدامها في التجارب المقبلة.
  2. للوحة الخلايا لتحديد IC50 دوسيتاكسيل، قم بإزالة الوسائط من قارورة وتغسل بعناية الخلايا مع 5 مل برنامج تلفزيوني واحتضان مع 2 مل 0.05% يدتا التربسين لمدة 3-5 دقيقة في 37 درجة مئوية لفصل الخلايا من سطح قارورة.
  3. شطف الخلايا تريبسينيزيد من قارورة استخدام 5 مل من وسائط الإعلام الجديدة وجمع تعليق خلية في أنبوب 15 مل. بيليه الخلايا بالطرد المركزي (300 x ز، 3 دقيقة، بدرجة حرارة الغرفة (RT))-
  4. إزالة المادة طافية، ريسوسبيند بيليه الخلية في 5 مل من وسائط الإعلام الجديدة وحساب الخلايا. تمييع تعليق الخلية إلى 2-2.5 × 10 5 خلايا/مليلتر بالنسبة DU145 و 4-4.5 × 10 5 خلايا/مل ل 22Rv1، ومزيج جيد من قبل بيبيتينج صعودا وهبوطاً والبذور 2 مل التعليق في كل بئر لاثنين 6-جيدا لوحات.
  5. بعد 24 ساعة، عندما تكون الخلايا في التقاء 70-80%، أضف تصعيد جرعة دوسيتاكسيل تركيزات من 1 نانومتر، 2.5 نانومتر، 5 نانومتر، 10 نانومتر، 25 نانومتر، 50 نانومتر، 100 نانومتر، 250 نيوتن متر، 500 شمال البحر الأبيض المتوسط، وشمال البحر الأبيض المتوسط 1000 لكل بئر. التعامل مع عنصر التحكم جيدا مع [دمس] في أعلى حجم المستخدمة دوسيتاكسيل ( الشكل 2A).
  6. ح
  7. بعد 72، نضح المخدرات التي تحتوي على وسائط الإعلام، وإضافة 2 مل وسائط جديدة. اللوحات حوالي 4-5 أيام، سيكون جاهزاً لتلطيخ.
  8. وصمة عار المستعمرات، غسلها برفق مع 2-3 مل برنامج تلفزيوني واحتضانها لهم مع الحل البنفسجي كريستال 2-3 مل (0.1% w/v في الفورمالين 10%) لمدة 20 دقيقة داخل غطاء زراعة الأنسجة أو غطاء دخان.
  9. إزالة لوحات الحل ويغسل المصبوغة مع 2-3 مل ح 2 س، ح 2 س ولوحات أيردري.
  10. تحليل النتائج من خلال تصور الآبار لتحديد أي واحد لديه تركيز دوسيتاكسيل أن يقلل من جدوى الخلية بنسبة 50% (IC50). عد المستعمرات بالمساعدة من قلم ماركر (لتجنب عد المستعمرات نفسها مرتين) وتمثل النسبة المئوية لبقاء الخلية في الرسم بياني ( الشكل 2A) يدوياً. وأخيراً، أن الصور الرقمية من اللوحات لتمثيل الشكل (كما هو موضح في الشكل 3 ألف)-

2. جيل من "خلايا سرطان البروستاتا" المقاوم دوسيتاكسيل

ملاحظة: إجراء علاجات الخلية باستخدام نفس الرصيد حل دوسيتاكسيل المستخدمة لتحديد تركيز المخدرات IC50 (إعداد ما يكفي المخزون مقدما للتجريبية استخدام). احتفظ قارورة صغيرة من الخلايا من الخطوة السابقة، فقط في حالة ما لم تعمل بشكل جيد. خلايا الوالدين ينبغي نمت بالتوازي في قارورة صغيرة في جميع أنحاء الإجراء بأكمله ويتعرضون للمركبات ([دمس]) في وحدات التخزين المطابقة محاكاة المبالغ المستخدمة في قوارير دوسيتاكسيل تعامل.

  1. الخلايا DU145 لوحة أو 22Rv1 في 150 سم 2 قوارير تحتوي على 20 مل من وسائل الإعلام (3.5 × 10 6 خلايا كل قارورة ل DU145 و 6.5 * 10 6 خلايا كل قارورة ل 22Rv1). يوصي باستخدام قوارير 10 إلى 20 من الخلايا إلى خلايا كافية في نهاية البروتوكول.
  2. بعد 24 ساعة، عندما تكون الخلايا في حوالي 70-80% التقاء ( الشكل 2B، قبل دوسيتاكسيل)، أضف دوسيتاكسيل في تركيز IC50 تحديد في الخطوة 1 من البروتوكول (5 نانومتر للخلايا المبينة في هذا البروتوكول)-
  3. ح
  4. 72 بعد، نضح المخدرات التي تحتوي على وسائط الإعلام، وإضافة وسائط جديدة، خالية من دوسيتاكسيل ( الشكل 2، ح 72 بعد دوسيتاكسيل). تغيير وسائل الإعلام كل 3-4 أيام. ضمن ما يقرب من 1-2 أسابيع، سوف تظهر مقاومة استنساخ واضحا تحت المجهر ( الشكل 2B، 7 و 14 يوما بعد دوسيتاكسيل)-
  5. نضح وسائط الإعلام، وتغسل بعناية الخلايا مع 15 مل برنامج تلفزيوني واحتضان مع 4 مل 0.05% يدتا التربسين لمدة 3-5 دقيقة في 37 درجة مئوية لفصل الخلايا من سطح قارورة.
  6. ريسوسبيند تريبسينيزيد الخلايا من قارورة استخدام 8 مل وسائط جديدة. تجمع الخلايا من قوارير تعامل كافة. بيليه الخلايا بالطرد المركزي (300 x ز، 3 دقيقة، RT).
  7. إزالة المادة طافية، ريسوسبيند بيليه الخلية في 20 مل من وسائط الإعلام الجديدة ولوحة الخلايا في قوارير 2 150 سم (3.5 × 10 6 خلايا كل قارورة ل DU145 و 6.5 * 10 6 خلايا كل قارورة ل 22Rv1)-
  8. بعد 24 ساعة، عندما تكون الخلايا في حوالي 70-80% التقاء، إضافة 5 نانومتر دوسيتاكسيل (تركيز IC50 الأولية) مرة أخرى.
  9. كرر الخطوات 2، 3 إلى 2، 6 في يوم 3-
  10. بعد 24 ساعة، عندما تكون الخلايا في حوالي 70-80% التقاء، علاج الخلايا مع 2 X IC50 دوسيتاكسيل تركيز (10 نانومتر للخلايا المبينة في هذا البروتوكول)-
  11. كرر الخطوات 2.3 إلى 2.8، بعد جرعة تصعيدا لتركيزات دوسيتاكسيل (25 نانومتر، 50 نانومتر، 100 نانومتر و 250 نيوتن متر)، توليد عدد سكانها مستقرة من خلايا تنمو في قوارير الخاص بك تحت أعلى تركيز النهائي. لتركيزات أعلى، يمكن تنفيذ البروتوكول تصعيد الجرعة لمدة تصل إلى 6 أشهر حتى يتم التوصل إلى تركيز 1,000 شمال البحر الأبيض المتوسط ( الشكل 1A).

3. توصيف وظيفي "لاكتسبت المقاومة دوسيتاكسيل" "مقايسة تشكيل مستعمرة"

ملاحظة: في هذا البروتوكول، تشيموريسيستانسي قد تم تقييمها باستخدام فحوصات تشكيل مستعمرة. يمكن استخدام طرق بديلة تستخدم لتقييم جدوى الخلية (أي فحوصات MTS) استناداً إلى المحققين ' تفضيلات.

  1. الخلايا 2,000 لوحة (DU145 أو 22Rv1، كل من الوالدين ودوسيتاكسيل المقاوم) كل بئر في لوحات 6-جيدا، باستخدام 2 مل من وسائل الإعلام كل بئر.
  2. بعد 24 ساعة، أضف التركيزات المتزايدة دوسيتاكسيل (خلايا الوالدين: 0.25، 0.5، 1، شمال البحر الأبيض المتوسط 2.5 و 5؛ خلايا الدكتور: 50، 125، 250، 500 و 000 1 نانومتر). لخطوط الخلايا DU145 و 22Rv1 على حد سواء. إضافة [دمس] إلى بئر واحدة فقط كعنصر تحكم في نفس وحدة التخزين المستخدمة لأعلى جرعة دوسيتاكسيل.
  3. بعد 72 ساعة، نضح المخدرات التي تحتوي على وسائط الإعلام وإضافة وسائط جديدة خالية من دوسيتاكسيل.
  4. احتضان لوحات 1-2 أسابيع حتى مستعمرات مرئية تحت المجهر.
  5. وصمة عار المستعمرات، غسلها برفق مع 2-3 مل برنامج تلفزيوني واحتضانها لهم مع الحل البنفسجي كريستال 2-3 مل (0.1% w/v في الفورمالين 10%) لمدة 20 دقيقة داخل غطاء زراعة الأنسجة أو غطاء دخان.
  6. إزالة لوحات الحل ويغسل المصبوغة مع 2-3 مل ح 2 س، ح 2 س ولوحات أيردري.
  7. تحليل النتيجة بتصور الآبار والعد يدوياً المستعمرات بالمساعدة من قلم ماركر (لتجنب عد المستعمرات نفسها مرتين) وتمثل النسبة المئوية لبقاء الخلية في الرسم بياني. تأخذ الصور الرقمية من اللوحات لتمثيل الشكل ( الشكل 3A).

4. المظهرية "توصيف دوسيتاكسيل المقاومة المكتسبة النمط الظاهري" عن طريق تحليل PCR قرة

ملاحظة: خلايا دوسيتاكسيل المقاوم (DR) يحمل ملف تعريف تعبير مختلفة مقارنة بخطوط الخلية الأبوية 28 ، 29-ولذلك يمكن التحقق من نجاح الاختيار طريق qRT-بكر استخدام كبسولة تفجير لعلامات محددة (لمتواليات التمهيدي، الرجوع إلى قسم المواد؛ للحصول على تفاصيل، راجع قسم النتائج). وهذا ينبغي أن يتم بعد كل جولة من التحديد ابتداء من بعد الجولة الثالثة. بدلاً من ذلك، الممكن أيضا تقييم النمط الظاهري دوسيتاكسيل المقاوم بغربي النشاف.

  1. "استخراج الحمض النووي الريبي" من خلايا كل من الوالدين ودوسيتاكسيل المقاوم باستخدام أدوات استخراج الحمض النووي الريبي وعقب الشركة المصنعة ' تعليمات s (انظر الجدول للمواد والمواد الكاشفة للحصول على التفاصيل). استخدام الحد أدنى من المستحسن 1-2 × 10 6 خلايا.
  2. Quantify الجيش الملكي النيبالي في 260 امتصاص نانومتر، باستخدام جهاز المطياف الضوئي. لنقاء أفضل، ينبغي أن تكون نسب امتصاص نانومتر nm/280 260 قريبة من 2.0-
  3. Perfoجمهورية مقدونيا عكس النسخ للحصول على التكميلية الحمض النووي (كدنا) باستخدام مجموعة النسخ العكسي، وعقب الشركة المصنعة ' تعليمات s (انظر الجدول للمواد والمواد الكاشفة لمزيد من التفاصيل)، باستخدام 1 ميكروغرام من الجيش الملكي النيبالي في 20 ميليلتر مزيج التفاعل (إذا كان هناك حاجة إلى كمية أعلى من كدنا، الارتقاء بهذا المزيج رد الفعل تبعاً لذلك).
  4. إعداد رد فعل قبكر في ثلاث نسخ لكل الجينات من الفوائد على النحو التالي:
    --2 ميليلتر من 10 ميكرون التمهيدي إلى الأمام
    --2 ميليلتر من 10 ميكرون عكس التمهيدي
    --10 ميليلتر "سيبر الأخضر بكر" مزيج الرئيسي
    --5 ميليلتر ح 2 س
    -1 ميليلتر من كدنا أعدت حديثا من الخطوة 4، 3-
    ملاحظة: انظر الجدول للمواد لمتواليات الإشعال المستخدمة في هذا البروتوكول-
  5. تعيين البرنامج بكر كما يلي:
    -95 درجة مئوية لمدة 15 دقيقة
    --94 درجة مئوية لمدة 30 ثانية |
    -56 درجة مئوية مقابل 40 s | مرات 40
    --72 درجة مئوية لمدة 30 ثانية |
  6. لتحليل نتائج قبكر وتحديد التغيرات في التعبير الجيني بين الوالدين والدكتور العينات، يتم تحديد قيم العتبة (Ct) دورة لكل الجينات من الفائدة في ثلاث نسخ وتطبيع المتوسط لتحميل عنصر التحكم (أكتين المتوسط ثلاث ) للدكتور (Ct DR) والخلايا الأبوية (Ct الوالدية). يتم تطبيع قيم الخلايا الأبوية إلى 1. ΔCt (Ct الدكتور-Ct الأبوية) مصممة للحصول على مرناً النهائية إضعاف التغييرات والممثلة في الرسم بياني. أي بزيادة قدرها > 2 أو نقصان < 0.5 تعتبر هامة وعملية التحقق من إنشاء دوسيتاكسيل صحة جيدة اكتسبت مقاومة النمط الظاهري ( الشكل 3B).

Representative Results

هذا البروتوكول سيؤدي إلى توليد خلايا سرطان البروستاتا دوسيتاكسيل المقاوم (DR). الجدول الزمني لإنجاز قد تتراوح من 4 إلى 7 أشهر كما هو ملخص في التمثيل التخطيطي لخطوات البروتوكول في الشكل 1A و 1B الشكل. استثمار الوقت يمكن أن تختلف تبعاً لخط الخلية للاختيار والتركيزات المخدرات المستخدمة كما هو موضح في البروتوكول. الأهم من ذلك، يسمح تحديد تركيز IC50 دوسيتاكسيل لكل خط خلية تصميم المخدرات تصاعد نطاق التركيز لاستخدامها في البروتوكول للخلايا للاختيار (الشكل 2A). بمجرد بدء تشغيل البروتوكول، يمكن ملاحظة الآثار دوسيتاكسيل الأولية على الخلايا DU145 و 22Rv1 في نقاط زمنية مختلفة تحت المجهر لرصد حالة البروتوكول وتعمل بشكل صحيح. اقترح النقاط الزمنية لرصد عملية المعالجة دوسيتاكسيل: قبل التعرض دوسيتاكسيل (خط الأساس)، بعد تعرض دوسيتاكسيل ح 72، 7 أيام و 14 يوما. ملاحظة أن أقلية فقط من الخلايا السرطانية البقاء على قيد الحياة التعرض دوسيتاكسيل وتوليد الحيوانات المستنسخة، التي يمكن ملاحظتها تحت المجهر (الشكل 2).

وترد في الشكل 3 ألففحوصات تشكيل مستعمرة الممثل والرسوم البيانية التحديد الكمي للوالدين والخلايا دوسيتاكسيل المقاوم (DR) الذي تم إنشاؤه حديثا. ملاحظة أن الخلايا دوسيتاكسيل المقاوم الذي تم إنشاؤه يمكن البقاء على قيد الحياة من المخدرات تركيزات تصل إلى 1,000-fold أعلى من الخلايا الأبوية.

أخيرا، يمكن التحقق من صحة النمط الظاهري دوسيتاكسيل المقاوم ب qRT-بكر (الشكل 3B). لاحظ أن عرض الخلايا دوسيتاكسيل المقاوم، مقارنة بالخلايا الأبوية، ومتابعة مميزة-تنظيم ABCB1 و GATA2 وأسفل-تنظيم CK19 و CDH1. واختيرت هذه الجينات للتحقق من الصحة لأننا أظهرنا الفعل تجريبيا في الأعمال المنشورة سابقا أوبريجولاتيون GATA2 ودوونريجوليشن من CK19 إلى جانب CDH1 في كلا الدكتور خلية نماذج28،29. كما اختير الجين ABCB1 جينات أساسية التي ظهرت قبل الآخرين أن استمرار أوبريجولاتيد في خلايا مقاومة المخدرات18،19. ومع ذلك، من المهم ملاحظة أن جينات أخرى قد يتم اختيار وفقا للأدب واعتماداً على نماذج الخلية والمخدرات اختاره الباحث لتوليد خلايا مقاومة.

Figure 1
رقم 1: الجدول الزمني لتوليد نماذج خلية سرطان البروستاتا المقاوم دوسيتاكسيل. (أ) رسم تخطيطي الممثل بروتوكول الخط الزمني لتوليد نماذج الخلية دوسيتاكسيل المقاوم. يصف الرسم التوضيحي معاملة دوسيتاكسيل وخطوات التحقق من الصحة، والوقت اللازم لكل جزء. (ب) التمثيل التخطيطي من خطوات التحقق من الصحة للبروتوكول بما في ذلك فحوصات تشكيل مستعمرة الوظيفية للوالدين ودوسيتاكسيل مقاومة الخلايا تعامل مع تركيزات دوسيتاكسيل المشار إليها ح 72 (باللون الأحمر)، الممثل رسم بياني للنسبة المئوية مستعمرة وبكر قرة للتحقق من صحة المظهرية. الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم-

Figure 2
رقم 2: جيل نظم نموذجية خلية سرطان البروستاتا المقاوم دوسيتاكسيل. يصور تصميم IC50 دوسيتاكسيل في خطوط خلايا سرطان البروستاتا الأبوية DU145 و 22Rv1 المخطط (A) (الخطوة 1 من البروتوكول). وترد النسب المئوية المتوقعة لبقاء الخلية ودوسيتاكسيل تركيزات تتصاعد الجرعة اللازمة. الممثل DU145 و 22Rv1 خلية بقاء الرسوم البيانية التي تشير إلى 5 نانومتر ك IC50 بعد 72 ساعة تعرض دوسيتاكسيل مدرجة. التجارب تريبليكاتيس والبيانات تمثل الممثل الميداني مشرق التنمية المستدامة. (ب) يعني ± صور مجهرية DU145 والخلايا 22Rv1 في ذكر مرات خلال جيل المقاومة دوسيتاكسيل (الخطوة 2 من البروتوكول). الأسهم الحمراء تشير إلى استنساخ مقاومة دوسيتاكسيل بعد الانتهاء من البروتوكول. تغيير حجم أشرطة = 50 نانومتر. الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم-

Figure 3
الشكل 3: توصيف وظيفي والمظهرية نماذج الخلية مقاومة دوسيتاكسيل. (أ) مستعمرة الممثل فحوصات تشكيل خلايا الوالدين والمقاوم دوسيتاكسيل تعامل مع تركيزات دوسيتاكسيل المشار إليها حاء 72 – النسبة المئوية للمستعمرات لكل تركيز العلاج تتمثل في الرسم البياني المضمنة. التجارب تريبليكاتيس والبيانات تمثل ± يعني أشرطة مقياس التنمية المستدامة. = 5 مم. (ب) الدكتور/الأبوية مرناً إضعاف الزيادة النسبية كمياً ببكر قرت من ABCB1، GATA2، CK19 و CDH1 تظهر. هو تطبيع qPCR جميع البيانات الخام إلى أكتين (انظر البروتوكول للحصول على التفاصيل). التجارب تريبليكاتيس والبيانات تمثل ± تعني التنمية المستدامة. * ف < 0.05. الرجاء انقر هنا لمشاهدة نسخة أكبر من هذا الرقم-

Discussion

في هذه المخطوطة، يمكننا وصف أسلوب لإنشاء نظم نموذجية خلية سرطان البروستاتا المقاوم دوسيتاكسيل يسمح لدراسة آليات تسهم في اكتساب النمط الظاهري تشيموريسيستانسي. في حين أن هذا النهج موثوق بها للغاية واستنساخه، ينبغي النظر في بعض القيود المحتملة. منذ ذلك الحين فقط سوف يحمل جزء صغير من سكان الجزء الأكبر من خلايا تشيموريسيستانسي28، من المستحسن أن تبدأ مع عدد كبير من سكان من الخلايا (نحن عادة لوحة قوارير 20 من 150 سم2، التي تستأثر بحوالي 1.2 x 108 الخلايا). الخطوات الرئيسية للبروتوكول ينبغي لضمان نجاح هذا الإجراء. أولاً، من المهم جداً استخدام دوسيتاكسيل نفس طازج المخزون لفترة طويلة الأجل الاستخدام (10 ملم الأسهم يمكن أن تستخدم مختبرين لسنوات عند تخزينها بشكل صحيح في-80 درجة مئوية). تغييرات طفيفة في دوسيتاكسيل الكوة يمكن أن تؤثر نتائج IC50، جيل من توقيت خط الخلية ونتائج تشكيل مستعمرة. وثانيا، من الأهمية بمكان لبدء تشغيل بروتوكول تحديد IC50 في كل خط الخلية الفردية، لأن الاختلافات يمكن أن تحدث عند استخدام دفعة جديدة من الخلايا. وثالثاً، من الضروري رصد أن العلاج من تعاطي المخدرات بفعالية عن طريق فحص الخلايا تحت المجهر كثيرا حتى يمكن الكشف عنها بسرعة وتصحيح أية أخطاء. وأخيراً نوصي دائماً الاحتفاظ بمخزون خطوات الوسيطة في حالة التلوث أو المشاكل غير المتوقعة التي يمكن أن تؤثر على بقاء الخلايا في منتصف البروتوكول. الأهم من ذلك، لدينا بروتوكول يهدف إلى توليد نماذج مقاومة للعقاقير وذلك بتعريض خلايا سرطان البروستاتا لجرعات عالية من دوسيتاكسيل ح 72 تليها فترات الانتعاش الطويل، بدلاً من تركيزات ثابتة أقل من المخدرات في محاولة لتقليد الأفضل السريرية وأفادت السيناريو لعلاج سرطان البروستاتا بهذا تشن عامل15،16.

بالإضافة إلى ذلك، تجدر الإشارة إلى أن المعرض خلايا مقاومة للعقاقير اللدونة عالية، مما قد يؤدي إلى خسارة تدريجي في خصائص المقاومة المكتسبة على مر الزمن. ولذلك، توسيع نطاق استخدام هذه الخلايا لأكثر من 2-3 أشهر في الثقافة غير مستحسن. إذا كانت هناك حاجة إلى إمدادات دائمة فمن المستحسن أن توليد دفعات جديدة من خلايا المقاومة بشكل مستمر. ومع ذلك، إذا كان قد تم استزراع دفعات خلايا لفترة طويلة، يمكن استخدام فحوصات تشكيل مستعمرة و qPCR لإعادة تقييم مقاومتهم. ثمة بديل آخر زيادة المقاومة تراجع في علاج الخلايا مع جرعة عالية من دوسيتاكسيل ح 72 (500-1,000 nM). بعد فترة نقاهة لمدة أسبوع أو أسبوعين، النمط الظاهري يمكن إعادة اختبارها بتشكيل قبكر ومستعمرة فحوصات. من الممكن أيضا، على الرغم من أن غير مستحسن، لتخزين مختبرين للخلايا المعالجة في النتروجين السائل (في FBS، 10% [دمس]). يرجى ملاحظة أن بعد دورة تجميد أذاب، النمط الظاهري تشيموريسيستانسي ينبغي دائماً إعادة تقييمها باستخدام الأساليب المذكورة أعلاه.

وعلى الرغم من هذه المحاذير، نحن28،29 وآخرون30،31،،من3233 كانت قادرة على توظيف هذه الأنظمة النموذجية لتحديد مفتاح الرواية الخلوية بنجاح و رفع الجزيئية الآليات المؤدية إلى بدء الورم القدرة وبقاء الخلية، والعدوانية في خلايا مقاومة دوسيتاكسيل. استخدام هذه النظم النموذجية خلية السرطان، فقد اكتشفنا أن الخلايا العارضة النمط الظاهري غير متمايز، تتميز بعدم وجود علامات التمايز الظهارية والمتصلة بالبروستات و overexpression من استهدافها الإنمائية (الدرجة و القنفذ) مما يشير إلى مسارات، البقاء على قيد الحياة28من التعرض للعلاج الكيميائي. في دراسة ثانية باستخدام هذه النماذج جنبا إلى جنب مع مجموعات البيانات المتاحة للعموم الجين المريض24،25، نحن اكتشفت أن عامل النسخ الرواد GATA2 هو الغاية overexpressed في المنتشر المقاوم للخصي خلايا سرطان البروستاتا المقاوم للعلاج الكيميائي. GATA2 يزيد بقاء الخلايا بتفعيل كيناز المصب تعتمد على IGF2 إشارات الشبكة29مباشرة. جدير بالذكر أن هذه الدراسات قد ساعدت على تحديد رواية أدوار رئيسية من GATA2 في سرطان البروستاتا المنتشر متقدمة العدوانية34.

تطوير مقاومة للأدوية هي مشكلة لا تقتصر على دوسيتاكسيل وسرطان البروستاتا، كما أنه منتشر بين العديد من أنواع أخرى من السرطانات تعامل مع مجموعة واسعة من العقاقير العلاج الكيميائي. في الواقع، تطبيق قيود مماثلة على التوافر نماذج تجريبية، ويمكن تصور أن لدينا بروتوكول يمكن تكييفها لدراسة أنواع السرطان الأخرى وآلياتها تشيموريسيستانسي كل منهما.

توليد خلايا مقاومة دوسيتاكسيل كما هو موضح في هذا البروتوكول يمكن استخدامها كأداة وظيفية لتحديد الآليات الجزيئية والخلوية ذات الصلة رواية تشيموريسيستانسي. وهذا يفتح الباب لإيجاد أهداف جديدة، على أساسها قد بلورة تطوير علاجات جديدة لسرطان البروستاتا الخبيث عاليا، دفع مرة أخرى في حدود ما نعرفه عن هذا المرض وكيفية التعامل مع المرضى.

Disclosures

الكتاب يعلن أن لديهم لا تضارب المصالح المالية.

Acknowledgments

V.R.-باء. تتلقى تمويلاً من "وزارة الصحة الأميركية" & الإنسان الخدمات، المعاهد الوطنية للصحة، المعهد الوطني للسرطان منح رقم 1 K22 CA207458-01 ودكتوراه-دال. ويتلقى تمويلاً من "وزارة الصحة الأميركية" & الإنسان الخدمات، المعاهد الوطنية للصحة، المعهد الوطني للسرطان منح رقم 1 R01 CA207311-01.

Materials

Name Company Catalog Number Comments
DU145 cells ATCC HTB-81
22Rv1 cells ATCC CRL-2505
Docetaxel Selleck Chemicals S1148 in DMSO (10mM)
Tissue culture flask 150cm2 Falcon 355001
6-well tissue culture plates Falcon 353046
RPMI 1640 Medium Gibco 11875093 Supplemented with 10% FBS and 1% Penicilin/Streptomycin
Foundation B Fetal Bovine Serum Gemini 900208
1X Phosphate-Buffered Saline (PBS) Corning 21-040-CM
0.05%Trypsin-EDTA Gibco 25300-062
Penicillin-Streptomycin Gibco 15140122
RNeasy Mini Kit Qiagen 74106
SuperScript III first strand synthesis system for RT-PCR Invitrogen 18080051
Power SYBR Green PCR Master Mix Invitrogen 4367659
Crystal Violet Sigma-Aldrich C0775
10% Formalin Solution Sigma-Aldrich HT501128
Primers for qRT-PCR: Life technologies
CK19 F: CTGCGGGACAAGATTCTTGGT
CK19 R: CCAGACGGGCATTGTCGAT
CDH1 F: GGAAGTCAGTTCAGACTCCAGCC
CDH1 R: AGGCCTTTTGACTGTAATCACACC
ABCB1 F: TGTTCAAACTTCTGCTCCTGA
ABCB1 R: CCCATCATTGCAATAGCAGG
GATA2 F: CATCAAGCCCAAGCGAAGA
GATA2 R: TTTGACAGCTCCTCGAAGCA
ACTIN F: CATGTACGTTGCTATCCAGGC
ACTIN R: CTCCTTAATGTCACGCACGAT

DOWNLOAD MATERIALS LIST

References

  1. Hanahan, D., Weinberg, R. A. Hallmarks of cancer: the next generation. Cell. 144, (5), 646-674 (2011).
  2. Lapenna, S., Giordano, A. Cell cycle kinases as therapeutic targets for cancer. Nature reviews. Drug discovery. 8, (7), 547-566 (2009).
  3. Jackson, J. R., Patrick, D. R., Dar, M. M., Huang, P. S. Targeted anti-mitotic therapies: can we improve on tubulin agents? Nature reviews. Cancer. 7, (2), 107-117 (2007).
  4. Dumontet, C., Jordan, M. A. Microtubule-binding agents: a dynamic field of cancer therapeutics. Nature reviews. Drug discovery. 9, (10), 790-803 (2010).
  5. Schiff, P. B., Fant, J., Horwitz, S. B. Promotion of microtubule assembly in vitro by taxol. Nature. 277, (5698), 665-667 (1979).
  6. Schiff, P. B., Horwitz, S. B. Taxol stabilizes microtubules in mouse fibroblast cells. Proceedings of the National Academy of Sciences of the United States of America. 77, (3), 1561-1565 (1980).
  7. Musacchio, A., Salmon, E. D. The spindle-assembly checkpoint in space and time. Nature reviews. Molecular cell biology. 8, (5), 379-393 (2007).
  8. Kops, G. J. P. L., Weaver, B. A. A., Cleveland, D. W. On the road to cancer: aneuploidy and the mitotic checkpoint. Nature reviews. Cancer. 5, (10), 773-785 (2005).
  9. Derry, W. B., Wilson, L., Jordan, M. A. Substoichiometric binding of taxol suppresses microtubule dynamics. Biochemistry. 34, (7), 2203-2211 (1995).
  10. Jordan, M. A., Wendell, K., Gardiner, S., Derry, W. B., Copp, H., Wilson, L. Mitotic block induced in HeLa cells by low concentrations of paclitaxel (Taxol) results in abnormal mitotic exit and apoptotic cell death. Cancer research. 56, (4), 816-825 (1996).
  11. Orth, J. D., Kohler, R. H., Foijer, F., Sorger, P. K., Weissleder, R., Mitchison, T. J. Analysis of mitosis and antimitotic drug responses in tumors by in vivo microscopy and single-cell pharmacodynamics. Cancer research. 71, (13), 4608-4616 (2011).
  12. Zasadil, L. M., et al. Cytotoxicity of paclitaxel in breast cancer is due to chromosome missegregation on multipolar spindles. Science translational medicine. 6, (229), (2014).
  13. Dominguez-Brauer, C., Thu, K. L., Mason, J. M., Blaser, H., Bray, M. R., Mak, T. W. Targeting Mitosis in Cancer: Emerging Strategies. Molecular cell. 60, (4), 524-536 (2015).
  14. Torre, L. A., Bray, F., Siegel, R. L., Ferlay, J., Lortet-Tieulent, J., Jemal, A. Global cancer statistics, 2012. CA: a cancer journal for clinicians. 65, (2), 87-108 (2015).
  15. Petrylak, D. P., et al. Docetaxel and estramustine compared with mitoxantrone and prednisone for advanced refractory prostate cancer. The New England journal of medicine. 351, (15), 1513-1520 (2004).
  16. Tannock, I. F., et al. Docetaxel plus prednisone or mitoxantrone plus prednisone for advanced prostate cancer. The New England journal of medicine. 351, (15), 1502-1512 (2004).
  17. Sweeney, C. J., et al. Chemohormonal Therapy in Metastatic Hormone-Sensitive Prostate Cancer. The New England journal of medicine. 373, (8), 737-746 (2015).
  18. Mahon, K. L., Henshall, S. M., Sutherland, R. L., Horvath, L. G. Pathways of chemotherapy resistance in castration-resistant prostate cancer. Endocrine-related cancer. 18, (4), R103-R123 (2011).
  19. Follit, C. A., Brewer, F. K., Wise, J. G., Vogel, P. D. In silico identified targeted inhibitors of P-glycoprotein overcome multidrug resistance in human cancer cells in culture. Pharmacology research & perspectives. 3, (5), e00170 (2015).
  20. Ranganathan, S., Benetatos, C. A., Colarusso, P. J., Dexter, D. W., Hudes, G. R. Altered beta-tubulin isotype expression in paclitaxel-resistant human prostate carcinoma cells. British journal of cancer. 77, (4), 562-566 (1998).
  21. Martello, L. A., et al. Elevated levels of microtubule destabilizing factors in a Taxol-resistant/dependent A549 cell line with an alpha-tubulin mutation. Cancer research. 63, (6), 1207-1213 (2003).
  22. Lee, A. J. X., et al. Chromosomal instability confers intrinsic multidrug resistance. Cancer research. 71, (5), 1858-1870 (2011).
  23. Sansregret, L., Swanton, C. The Role of Aneuploidy in Cancer Evolution. Cold Spring Harbor perspectives in medicine. 7, (1), (2017).
  24. Grasso, C. S., et al. The mutational landscape of lethal castration-resistant prostate cancer. Nature. 487, (7406), 239-243 (2012).
  25. Taylor, B. S., et al. Integrative genomic profiling of human prostate cancer. Cancer cell. 18, (1), 11-22 (2010).
  26. Gao, D., et al. Organoid cultures derived from patients with advanced prostate cancer. Cell. 159, (1), 176-187 (2014).
  27. Drost, J., et al. Organoid culture systems for prostate epithelial and cancer tissue. Nature Protocols. 11, (2), 347-358 (2016).
  28. Domingo-Domenech, J., et al. Suppression of acquired docetaxel resistance in prostate cancer through depletion of notch- and hedgehog-dependent tumor-initiating cells. Cancer cell. 22, (3), 373-388 (2012).
  29. Vidal, S. J., et al. A targetable GATA2-IGF2 axis confers aggressiveness in lethal prostate cancer. Cancer cell. 27, (2), 223-239 (2015).
  30. Marín-Aguilera, M., et al. Identification of docetaxel resistance genes in castration-resistant prostate cancer. Molecular cancer therapeutics. 11, (2), 329-339 (2012).
  31. Zhao, L., et al. Identification of candidate biomarkers of therapeutic response to docetaxel by proteomic profiling. Cancer research. 69, (19), 7696-7703 (2009).
  32. Lin, H. -M., et al. Circulating microRNAs are associated with docetaxel chemotherapy outcome in castration-resistant prostate cancer. British journal of cancer. 110, (10), 2462-2471 (2014).
  33. Puhr, M., et al. Epithelial-to-mesenchymal transition leads to docetaxel resistance in prostate cancer and is mediated by reduced expression of miR-200c and miR-205. The American journal of pathology. 181, (6), 2188-2201 (2012).
  34. Rodriguez-Bravo, V., Carceles-Cordon, M., Hoshida, Y., Cordon-Cardo, C., Galsky, M. D., Domingo-Domenech, J. The role of GATA2 in lethal prostate cancer aggressiveness. Nature reviews. Urology. 14, (1), 38-48 (2017).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics