वानस्पतिक नमूनों के लिए मजबूत डीएनए अलगाव और उच्च प्रवाह अनुक्रमण पुस्तकालय निर्माण

* These authors contributed equally
Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

यह आलेख डीएनए अलगाव और असाधारण खराब गुणवत्ता वाले डीएनए के बचाव सहित वानस्पतिक सामग्री से उच्च प्रवाह अनुक्रमण पुस्तकालय निर्माण के लिए एक विस्तृत प्रोटोकॉल प्रदर्शित करता है ।

Cite this Article

Copy Citation | Download Citations

Saeidi, S., McKain, M. R., Kellogg, E. A. Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens. J. Vis. Exp. (133), e56837, doi:10.3791/56837 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Herbaria संयंत्र सामग्री है कि जैविक अध्ययन की एक किस्म में इस्तेमाल किया जा सकता है की एक अमूल्य स्रोत हैं । वानस्पतिक नमूनों का उपयोग नमूना संरक्षण की गुणवत्ता, अपमानित डीएनए, और दुर्लभ नमूनों की विनाशकारी नमूना सहित चुनौतियों के एक नंबर के साथ जुड़ा हुआ है । आदेश में और अधिक प्रभावी ढंग से बड़ी अनुक्रमण परियोजनाओं में वानस्पतिक सामग्री का उपयोग करने के लिए, डीएनए अलगाव और पुस्तकालय की तैयारी के एक भरोसेमंद और स्केलेबल विधि की जरूरत है । इस कागज एक मजबूत, डीएनए अलगाव और उच्च प्रवाह वानस्पतिक नमूनों कि व्यक्तिगत नमूनों के लिए संशोधन की आवश्यकता नहीं है से पुस्तकालय निर्माण के लिए अंत प्रोटोकॉल को दर्शाता है । इस प्रोटोकॉल कम गुणवत्ता संयंत्र सामग्री के लिए सिलवाया है और ऊतक पीसने के अनुकूलन के द्वारा मौजूदा तरीकों का लाभ लेता है, पुस्तकालय आकार चयन को संशोधित करने, और कम उपज पुस्तकालयों के लिए एक वैकल्पिक पुनर्वर्धन कदम शुरू । कम उपज डीएनए पुस्तकालयों के पुनर्वर्धन अपूरणीय और संभावित मूल्यवान वानस्पतिक नमूनों से व्युत्पंन नमूने, अतिरिक्त विनाशकारी नमूने की आवश्यकता को नकारने और आम के लिए प्रत्यक्ष अनुक्रमण पूर्वाग्रह शुरू करने के बिना बचाव कर सकते हैं वंशावली अनुप्रयोगों । प्रोटोकॉल घास प्रजातियों के सैकड़ों पर परीक्षण किया गया है, लेकिन सत्यापन के बाद अन्य संयंत्र वंश में उपयोग के लिए अनुकूलनीय होने की उम्मीद है. इस प्रोटोकॉल अत्यंत अपमानित डीएनए, जहां टुकड़े वांछित आकार सीमा में मौजूद नहीं है द्वारा सीमित किया जा सकता है, और माध्यमिक चयापचयों कुछ संयंत्र सामग्री में मौजूद है कि स्वच्छ डीएनए अलगाव को बाधित । कुल मिलाकर, इस प्रोटोकॉल का परिचय एक तेज और व्यापक विधि है कि डीएनए अलगाव और 24 नमूनों के पुस्तकालय की तैयारी के लिए अनुमति देता है से कम 13 ज, सक्रिय हाथों के केवल 8 एच के साथ समय पर ंयूनतम संशोधनों के साथ ।

Introduction

वानस्पतिक संग्रह दोनों प्रजातियों और जीनोमिक phylogenetics1,2,3, जनसंख्या आनुवंशिकी4,5, संरक्षण सहित अध्ययन के लिए विविधता का एक संभावित मूल्यवान स्रोत हैं जीव विज्ञान6, इनवेसिव प्रजातियों जीव विज्ञान7, और विशेषता विकास8। प्रजातियों, आबादी, भौगोलिक स्थानों की एक समृद्ध विविधता प्राप्त करने की क्षमता, और समय अंक "खजाना सीने"9 कि वानस्पतिक है पर प्रकाश डाला गया । ऐतिहासिक, वानस्पतिक-प्राप्त डीएनए की विकृत प्रकृति पीसीआर आधारित परियोजनाओं में बाधा है, अक्सर केवल उच्च प्रतिलिपि में पाया मार्करों का उपयोग करने के लिए शोधकर्ताओं माफिक, जैसे chloroplast जीनोम या आंतरिक लिखित स्पेसर (इसके) के क्षेत्रों के रूप में राइबोसोमल आरएनए. नमूनों और डीएनए की गुणवत्ता बड़े पैमाने पर9संरक्षण के तरीकों के आधार पर,10, डबल-फंसे टूट जाता है और सुखाने की प्रक्रिया में इस्तेमाल किया गर्मी से विखंडन के साथ हानि का सबसे आम रूपों जा रहा है, बनाने तथाकथित 90% डीएनए लॉक अप कि भारग्रस्त है पीसीआर आधारित अध्ययन11। विखंडन के अलावा, वानस्पतिक जीनोमिक्स में दूसरा सबसे प्रचलित मुद्दा दूषित है, जैसे कि endophytic कवक से व्युत्पंन13 या कवक संग्रह के बाद गुजाइश का अधिग्रहण किया, लेकिन वानस्पतिक12में बढ़ते पहले, हालांकि इस समस्या को हल किया जा सकता है bioinformatically सही कवक डेटाबेस दिया (नीचे देखें) । एक तिहाई, और कम आम, समस्या cytosine के माध्यम से अनुक्रम संशोधन है (सी/जी → T/ए)14, हालांकि यह कम होने का अनुमान है (~ 0.03%) वानस्पतिक नमूनों में11। उच्च प्रवाह अनुक्रमण (HTS) के आगमन के साथ, विखंडन का मुद्दा कम पढ़ता है और अनुक्रमण गहराई12,15, कम गुणवत्ता के साथ कई नमूनों से जीनोमिक स्तर के डेटा अधिग्रहण की अनुमति के साथ दूर किया जा सकता डीएनए, और यहां तक कि कई बार15पूरे जीनोम अनुक्रमण की अनुमति ।

वानस्पतिक नमूने और अक्सर इस्तेमाल किया जा रहे है और वंशावली परियोजनाओं के एक बड़े घटक है16। HTS के लिए वानस्पतिक नमूनों का उपयोग कर के एक मौजूदा चुनौती लगातार पर्याप्त डबल फंसे डीएनए, अनुक्रमण प्रोटोकॉल के लिए एक आवश्यक शर्त, एक समय पर तरीके से कई प्रजातियों से, व्यक्ति के लिए तरीकों का अनुकूलन करने की जरूरत के बिना प्राप्त है नमूनों. इस पत्र में, डीएनए निष्कर्षण और वानस्पतिक नमूनों की पुस्तकालय तैयार करने के लिए एक प्रोटोकॉल का प्रदर्शन किया है कि मौजूदा तरीकों का लाभ लेता है और उंहें संशोधित करने के लिए तेजी से और replicable परिणामों के लिए अनुमति देते हैं । यह विधि नमूना से पूरा प्रसंस्करण के लिए 13 घंटे में 24 नमूनों की एक पुस्तकालय के लिए अनुमति देता है, 8 घंटे के साथ समय पर, या 16 एच, के साथ 9 ज हाथ समय पर, जब वैकल्पिक पुनर्वर्धन कदम की आवश्यकता है । अधिक नमूनों की एक साथ प्रसंस्करण प्राप्त है, हालांकि सीमित कारक क्षमता और तकनीकी कौशल केंद्रापसारक है । प्रोटोकॉल के लिए केवल विशिष्ट प्रयोगशाला उपकरण की आवश्यकता होती है (thermocycler, केंद्रापसारक, और चुंबकीय खड़ा है) के बजाय विशेष उपकरण, जैसे एक छिटकानेवाला या sonicator, बाल काटना डीएनए के लिए के लिए डिज़ाइन किया गया है ।

डीएनए गुणवत्ता, टुकड़ा आकार, और मात्रा उच्च प्रवाह अनुक्रमण प्रयोगों में वानस्पतिक नमूनों के उपयोग के लिए कारक सीमित कर रहे हैं । वानस्पतिक डीएनए को अलग करने और उच्च प्रवाह अनुक्रमण पुस्तकालयों बनाने के लिए अन्य तरीकों के रूप में कम के रूप में 10 डीएनए के एनजी का उपयोग करने की उपयोगिता का प्रदर्शन किया है16; लेकिन वे प्रयोग कर पीसीआर पुस्तकालय की तैयारी के लिए आवश्यक चक्र के इष्टतम संख्या निर्धारित की आवश्यकता है । यह अव्यावहारिक हो जाता है जब व्यवहार्य डबल असहाय डीएनए (dsDNA) की बेहद छोटी मात्रा के साथ काम, के रूप में कुछ वानस्पतिक नमूनों एक पुस्तकालय की तैयारी के लिए केवल पर्याप्त डीएनए का उत्पादन । यहां प्रस्तुत विधि नमूना गुणवत्ता की परवाह किए बिना चक्रों की एक संख्या का उपयोग करता है, तो कोई डीएनए पुस्तकालय अनुकूलन चरणों में खो दिया है । जब लायब्रेरीज़ sequencing के लिए आवश्यक ंयूनतम मात्रा को पूरा नहीं इसके बजाय, एक पुनर्वर्धन चरण लाया है । कई वानस्पतिक नमूने दुर्लभ है और यह मुश्किल कई मामलों में विनाशकारी नमूने का औचित्य साबित करने के लिए बनाने के लिए थोड़ा सामग्री के अधिकारी । इस काउंटर करने के लिए, प्रस्तुत प्रोटोकॉल की अनुमति देता है dsDNA इनपुट आकार से कम 1.25 पुस्तकालय तैयार करने की प्रक्रिया में एनजी, उच्च प्रवाह अनुक्रमण के लिए व्यवहार्य नमूनों की गुंजाइश का विस्तार और नमूनों की विनाशकारी नमूना लेने की आवश्यकता को कम करने ।

निंनलिखित प्रोटोकॉल घास के लिए अनुकूलित और वानस्पतिक नमूनों से विभिंन प्रजातियों के सैकड़ों पर परीक्षण किया गया है, हालांकि हम उंमीद है कि प्रोटोकॉल कई अंय संयंत्र समूहों के लिए लागू किया जा सकता है । यह कम गुणवत्ता और/या दुर्लभ नमूनों को बचाने के लिए इस्तेमाल किया जा सकता है कि एक वैकल्पिक वसूली कदम भी शामिल है । के आधार पर २०० वानस्पतिक नमूनों का परीक्षण किया, इस प्रोटोकॉल कम ऊतक इनपुट और गुणवत्ता के साथ नमूनों पर काम करता है, ंयूनतम विनाशकारी नमूना के माध्यम से दुर्लभ नमूनों के संरक्षण के लिए अनुमति देता है । यहां यह पता चला है कि इस प्रोटोकॉल उच्च गुणवत्ता पुस्तकालयों कि phylogenomics आधारित परियोजनाओं के लिए अनुक्रम किया जा सकता प्रदान कर सकते हैं ।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. शुरू करने से पहले

  1. बना ताजा cetyl trimethylammonium ब्रोमाइड (CTAB) बफर17 को जोड़कर CTAB के 20 गाम, polyvinylpyrrolidone के 10 ग्राम (PVP) 40, १००.० एमएल 1 एम Tris पीएच 8.0, 0.5 मीटर ethylenediaminetetraacetic एसिड की 40 मिलीलीटर (EDTA) पीएच 8.0, 5 एम NaCl के २८०.० मिलीलीटर, और रिएजेंट पानी की ४००.० मिलीलीटर एक साथ, और 1 एल के लिए कुल मात्रा लाने के लिए एजेंट ग्रेड पानी का उपयोग कर । 8.0 के लिए पीएच समायोजित करें ।
    नोट: अतिरिक्त रिएजेंट व्यक्तिगत taxa में द्वितीयक यौगिकों के आधार पर CTAB को जोड़ा जा सकता है । देखें एलन एट अल । 18 additive रिएजेंट की एक पूरी सूची के लिए ।
  2. के 10 µ l जोड़ें β-mercaptoethanol प्रति 5 मिलीलीटर की CTAB बफ़र ।
    नोट: यह 50 मिलीलीटर के बैचों में तैयार किया जा सकता है और 3 के लिए कमरे के तापमान पर संग्रहित-4 सप्ताह ।
    1. एक 65 डिग्री सेल्सियस पानी स्नान में CTAB समाधान गर्मी ।
  3. चिल मोर्टार और मूसलों में-20 डिग्री सेल्सियस कम 20 मिनट के लिए ।
  4. लेबल 2 x n 2 एमएल ट्यूबों के 4 सेट (जहां n नमूनों की संख्या =) । बर्फ पर लेबल ट्यूबों के 1 सेट रखो ।
  5. सर्द बर्फ पर isopropanol या एक-20 डिग्री सेल्सियस फ्रीजर में ।
  6. ठोस चरण प्रतिवर्ती स्थिरीकरण (SPRI) मोती निकालें ( सामग्री की तालिकादेखें) फ्रिज से, और उन्हें कमरे के तापमान के लिए equilibrate करने के लिए अनुमति दें (न्यूनतम 30 मिनट).
  7. 80% इथेनॉल तैयार करते हैं ।
  8. निष्कर्षण के लिए वानस्पतिक नमूनों का चयन करें और प्राप्त ~ 1 सेमी2, या 10 मिलीग्राम, नमूना प्रति ऊतक के, अधिमानतः पत्ती सामग्री.

2. डीएनए निष्कर्षण

  1. ठंडा मोर्टार और मूसल का उपयोग कर चुने हुए वानस्पतिक ऊतक के ~ 1 सेमी2 पीस । तरल नाइट्रोजन और 30 जोड़ें-50 मिलीग्राम निष्फल रेत । जब तक ऊतक ठीक पाउडर में बदल जाता है पीसने ।
    नोट: 10 मिलीग्राम या अधिक ऊतक वांछनीय है, लेकिन कम भी कुछ मामलों में काम किया है. एक बार तरल नाइट्रोजन लुप्त हो जाती है, जब तक ऊतक पूरी तरह से जमीन है जरूरत के रूप में और अधिक जोड़ें । कोशिकाओं और ऊतकों को बाधित करने के लिए एक और आम तरीका एक मनका डिब्बा का उपयोग है । हालांकि, इस विधि इन प्रयोगों में इस्तेमाल नमूनों के लिए अच्छी तरह से काम नहीं करने के लिए पाया गया था ।
  2. दो 2 मिलीलीटर ट्यूबों में जमे हुए पाउडर हस्तांतरण (ट्यूब की मात्रा के आधे से अधिक नहीं जोड़ें) । प्रत्येक ट्यूब के लिए गर्म CTAB समाधान के 600 µ एल जोड़ें और ट्यूब उलटा और भंवर द्वारा अच्छी तरह से मिश्रण ।
    नोट: के बाद से मात्रा और वानस्पतिक सामग्री की गुणवत्ता अक्सर कम है, दो पुनरावृत्तियों में डीएनए अलगाव प्रदर्शन उच्च पैदावार प्राप्त करने में मदद करता है ।
  3. 1-1.5 घंटे के लिए एक 65 ° c पानी स्नान में नमूनों की मशीन, हर 15 मिनट भंवर ।
  4. 5 मिनट के लिए 10,000 x g पर नमूने के लिए लेबल ट्यूबों (~ 500 µ एल) का एक ताजा सेट करने के लिए supernatant स्थानांतरण । एक मानक गैर chlorinated निपटान प्रक्रिया का उपयोग गोली त्यागें ।
  5. प्रत्येक ट्यूब के लिए RNase-A (10 मिलीग्राम/एमएल) के 4 µ एल जोड़ें और पलटना या pipetting द्वारा मिश्रण । 15 मिनट के लिए एक गर्मी ब्लॉक या पानी के स्नान में 37 डिग्री सेल्सियस पर नमूनों की मशीन ।
  6. एक 25:24:1 phenol के बराबर मात्रा (~ 500 µ एल) जोड़ें: क्लोरोफॉर्म: isoamyl शराब मिश्रण एक बार ट्यूबों कमरे के तापमान तक पहुंच चुके हैं । pipetting द्वारा अच्छी तरह से मिश्रण और नीचे और/ 15 मिनट के लिए 12,000 x जी में ट्यूबों केंद्रापसारक लेबल ट्यूबों (~ 400 µ एल) का एक ताजा सेट करने के लिए जलीय परत (ऊपरी परत) स्थानांतरण । एक chlorinated अपशिष्ट कंटेनर में कार्बनिक परत त्यागें ।
    नोट: यदि द्वितीयक यौगिकों की बड़ी मात्रा संयंत्र सामग्री में अपेक्षित हैं, तो 2.6 चरण दोहराया जा सकता है ।
  7. एक 24:1 क्लोरोफॉर्म के बराबर वॉल्यूम (~ 400 µ l) जोड़ें: isoamyl शराब मिश्रण । pipetting द्वारा अच्छी तरह से मिश्रण और नीचे और/ 15 मिनट के लिए 12,000 x जी में ट्यूबों केंद्रापसारक., लेबल ट्यूबों (~ 300 µ एल) की एक ताजा सेट करने के लिए जलीय परत (ऊपरी परत) हस्तांतरण । एक chlorinated अपशिष्ट कंटेनर में कार्बनिक परत त्यागें ।
  8. एक बराबर मात्रा (~ 300 µ एल) की ठंडा isopropanol और प्रत्येक ट्यूब के लिए 2.5 एम सोडियम एसीटेट के 12 µ एल जोड़ें । 30-60 मिनट के लिए-20 डिग्री सेल्सियस पर नमूने की मशीन ।
    ध्यान दें: मशीन समय (रात भर के लिए गर्मी) बढ़ाया जा सकता है, लेकिन डीएनए की गुणवत्ता में कमी होगी अब नमूनों की मशीन ।
  9. नमूने फ्रीजर से बाहर ले लो और 15 मिनट के लिए 12,000 x g पर ट्यूबों को दूर करना और supernatant धीरे गोली परेशान बिना त्यागें । ताजा 70% इथेनॉल (लगभग 300-500 µ एल) के साथ निलंबन से धो गोली । प्रत्येक दोगुना नमूना के लिए, साथ इथेनॉल के साथ एक में दो व्यक्ति छर्रों मजबूत ।
    नोट: नमूने एक ट्यूब में पहले इथेनॉल का उपयोग कर समेकित किया जाना चाहिए और फिर आगे बढ़ना । यह आवश्यक नहीं है इथेनॉल के साथ अलग से प्रत्येक नमूने को धोने ।
  10. 10 मिनट के लिए 12,000 x जी में ट्यूबों के केंद्रापसारक निकालें और गोली से परेशान बिना धीरे supernatant त्यागें । हवा छर्रों सूखी ।
    नोट: नमूने तेजी से एक सूखी गर्मी ब्लॉक का उपयोग कर सूख जा सकता है (65 डिग्री सेल्सियस से अधिक नहीं है) । सुनिश्चित करें कि नमूनों पर सूखी नहीं है, के रूप में यह डीएनए की अंतिम उपज कम कर सकते हैं ।
  11. 1x ते के 50 µ l में अलग डीएनए सस्पेंड । में स्टोर-20 ° c फ्रीजर लंबी अवधि के भंडारण के लिए या 4 ° c निम्नलिखित सप्ताह में उपयोग के लिए.

3. गुणवत्ता नियंत्रण (QC)

  1. गुणवत्ता की जांच के लिए एक agarose जेल चलाते हैं ।
    1. एक 1x Tris/बोराटे/EDTA (TBE) बफर 54 जी Tris आधार, 27.5 जी बोरिक एसिड, और 3.75 ग्राम EDTA disodium नमक जोड़कर, 5 एल के लिए कुल मात्रा लाने के लिए एजेंट ग्रेड पानी का उपयोग कर तैयार करते हैं ।
    2. 1x TBE के 100 मिलीलीटर में 1 ग्राम agarose जोड़कर 1% agarose जेल तैयार करें । माइक्रोवेव जब तक कोई agarose दिखाई नहीं देता समाधान । 0.01% न्यूक्लिक एसिड जेल दाग जोड़ें ( सामग्री की तालिकादेखें) । कुप्पी को तब तक ठंडा होने दें जब तक यह स्पर्श गर्म न हो जाए. चमचे से अच्छी तरह मिला लें । एक जेल ट्रे में agarose डालो और इसे जब तक यह जम बैठते हैं ।
    3. मिश्रण 3 µ एल का नमूना, 2 µ एल के एजेंट ग्रेड पानी, और 1 µ l के 6x लोडिंग डाई. जेल मैट्रिक्स में नमूनों लोड, उनके आदेश टिप्पण ।
    4. 60-70 वी छवि पर 60-70 मिनट के लिए नमूनों को चलाने के लिए यूवी प्रकाश के तहत जेल सही प्रदर्शन और ध्यान के साथ ।
      नोट: एक स्पष्ट उच्च आणविक वजन बैंड की उपस्थिति उच्च गुणवत्ता वाले डीएनए का संकेत है, जबकि धब्बों आमतौर पर डीएनए क्षरण का संकेत है । ज्यादातर वानस्पतिक नमूनों को नीचा दिखाया गया है ।
  2. डबल फंसे डीएनए की मात्रा निर्धारित करने के लिए एक dsDNA ठहराव विश्लेषण (सामग्री की तालिका देखें) चलाएँ.
    1. विश्लेषण के लिए नमूना के 2 µ l का उपयोग करें ।
      नोट: वानस्पतिक सामग्री के ठहराव विश्लेषण के लिए कमजोर पड़ने की जरूरत नहीं है के रूप में वे ंयूनतम मात्रा में हो जाते हैं । सफल पुस्तकालयों के रूप में छोटे से इस कदम से 1.26 कुल dsDNA एनजी के रूप में किया गया है ।

4. डीएनए कतरनी

नोट: यह एक वाणिज्यिक डबल असहाय fragmentase प्रोटोकॉल का एक अनुकूलित संस्करण है ( सामग्री की तालिकादेखें).

  1. 3 एस के लिए भंवर के बाद बर्फ पर प्लेस dsDNA विखंडन एंजाइम ।
  2. एक बाँझ 0.2 मिलीलीटर पोलीमरेज़ चेन रिएक्शन (पीसीआर) ट्यूब में, मिश्रण 1 – 16 µ एल अलग डीएनए साथ विखंडन प्रतिक्रिया बफर के 2 µ l के साथ. nuclease नि: शुल्क पानी जोड़कर कुल मात्रा को 18 µ l पर लाएं । जोड़ें 2 µ एल dsDNA विखंडन एंजाइम और भंवर के लिए मिश्रण 3 एस ।
    नोट: डीएनए की जरूरत की राशि डीएनए एकाग्रता के आधार पर बदलता है (के लिए लक्ष्य 200 ट्यूब में कुल एनजी) ।
  3. 8.5 मिनट के लिए 37 डिग्री सेल्सियस पर नमूनों की मशीन । इसके बाद 5 µ l को 0.5 मीटर EDTA की टहनियां डालकर डालें ।
    नोट: इस कदम के रूप में जल्दी के रूप में प्रदर्शन की जरूरत है गर्मी की प्रतिक्रिया समाप्त करने के लिए खत्म हो गया है और पर से डीएनए के नमूनों को रोकने-कतरनी ।

5. मनका साफ-अप

  1. Homogenize को SPRI मोतियों से भंवर कर ।
  2. nuclease मुक्त पानी के 25 µ l को जोड़कर 50 µ l को कतरनी डीएनए की कुल मात्रा को लाओ । कमरे के तापमान SPRI मोती के 45 µ एल जोड़ें (90% मात्रा) के 50 µ एल के लिए कतरनी डीएनए और pipetting द्वारा अच्छी तरह से मिश्रण ऊपर और नीचे ।
    नोट: कुल नमूना मात्रा के 90% से कम मोतियों को जोड़ने डीएनए टुकड़े की छोटी, अक्सर 200 आधार जोड़े नीचे हटाने के लिए किया जाता है ।
  3. नमूने 5 मिनट के लिए मशीन चलो एक चुंबकीय प्लेट पर ट्यूबों रखो और उंहें 5 मिनट के लिए बैठते हैं । ध्यान से हटाने और supernatant को त्यागें ।
    नोट: वे वांछित डीएनए लक्ष्य होते हैं, के रूप में मोतियों को परेशान करने के लिए नहीं सावधान रहना ।
  4. जबकि चुंबकीय स्टैंड पर ट्यूबों के लिए ताजा 80% इथेनॉल के 200 µ एल जोड़ें । 30 एस के लिए कमरे के तापमान पर मशीन और फिर ध्यान से हटाने और supernatant को त्यागें । इस चरण को एक बार दोहराएं । हवा 5 मिनट के लिए मोती शुष्क जबकि ट्यूब अपने ढक्कन खुले के साथ चुंबकीय स्टैंड पर है ।
    नोट: अधिक से बचें-मोती सूखने । यह डीएनए की कम वसूली में परिणाम कर सकते हैं ।
  5. चुंबक से ट्यूबों निकालें । Elute में मोतियों से डीएनए को 0.1 x TE के 55 µ l में मिलाकर अच्छी तरह से ऊपर और नीचे pipetting करके मिक्स करें । 5 मिनट के लिए कमरे के तापमान पर मशीन चुंबकीय स्टैंड पर ट्यूब प्लेस और समाधान के लिए प्रतीक्षा करने के लिए स्पष्ट बारी (~ 2 मिनट) ।
  6. supernatant के 52 µ l को खींचे । नमूने पर एक डीएनए ठहराव विश्लेषण चलाने के लिए वसूली और प्रारंभिक एकाग्रता है कि पुस्तकालय तैयारी में चला जाता है की जांच करें ।
    नोट: पुस्तकालयों के साथ किया गया है कुल dsDNA से कम करने का अनुमान है 1.25 एनजी, हालांकि प्रत्येक मामले में पुनर्वर्धन की आवश्यकता थी ।

6. पुस्तकालय की तैयारी

नोट: यह एक व्यावसायिक रूप से उपलब्ध लाइब्रेरी किट का एक संशोधित संस्करण है ( सामग्री प्रोटोकॉल की तालिका देखें) ।

  1. अंत तैयारी
    1. endonuclease और फॉस्फेट पूंछ एंजाइमों के 3 µ l जोड़ें, और 7 µ एल के साथ प्रतिक्रिया बफर के 50 µ l के लिए साफ, कतरनी डीएनए. ऊपर और नीचे pipetting द्वारा अच्छी तरह से मिश्रण । ट्यूबों स्पिन बुलबुले को दूर करने के लिए ।
      नोट: कुल वॉल्यूम 60 µ l होना चाहिए ।
    2. एक thermocycler में नमूने निंनलिखित कार्यक्रम के साथ प्लेस: 20 ° c, 65 डिग्री सेल्सियस पर 30 मिनट में 30 मिनट, तो 4 डिग्री सेल्सियस पर पकड़ ।
      नोट: गरम ढक्कन ≥ 75 डिग्री सेल्सियस के लिए सेट किया गया था
  2. एडेप्टर बंधाव
    1. अनुकूलक का पतला 25 – 50 गुना (काम अनुकूलक एकाग्रता 0.6 – 0.3 µ मी) । बंधाव मास्टर मिक्स, बंधाव बढ़ाने के 1 µ एल के 30 µ एल जोड़ें, और उच्च प्रवाह कम ट्यूबों के लिए पढ़ने के लिए अनुकूलक के 2.5 µ एल ।
      नोट: कुल वॉल्यूम ९३.५ µ l होना चाहिए ।
    2. ऊपर और नीचे pipetting द्वारा अच्छी तरह से मिश्रण । ट्यूबों स्पिन बुलबुले को दूर करने के लिए । 15 मिनट के लिए 20 डिग्री सेल्सियस पर ट्यूबों की मशीन ।
    3. uracil डीएनए glycosylase (UDG) और डीएनए glycosylase-lyase Endonuclease VIII के वाणिज्यिक मिश्रण के 3 µ एल जोड़ें ( सामग्री की तालिकादेखें) ट्यूबों के लिए । सुनिश्चित करें कि कुल मात्रा ९६.५ µ एल है अच्छी तरह से मिश्रण और एक thermocycler का उपयोग कर 15 मिनट के लिए 37 डिग्री सेल्सियस पर गर्मी ।
      नोट: ढक्कन 47 डिग्री सेल्सियस ≥ करने के लिए सेट किया जाना चाहिए । व्यावसायिक प्रोटोकॉल का मूल संस्करण है आकार चयन एडेप्टर बंधाव चरण, अंतिम चरण के रूप में एक मनका क्लीनअप के बाद के बाद । इस प्रोटोकॉल, जो उच्च पैदावार प्राप्त करता है, इन कदमों के क्रम में स्विच और एक अंतिम चरण के रूप में आकार चयन लागू करता है ।
  3. सफाई एंजाइमों और छोटे टुकड़े को दूर करने के लिए
    1. भंवर द्वारा Homogenize चुंबकीय मोती ।
    2. SPRI चुंबकीय मोती के 78 µ एल जोड़ें (80% मात्रा) और ऊपर और नीचे pipetting द्वारा अच्छी तरह से मिश्रण ।
      नोट: कुल नमूना मात्रा के 80% से कम मोतियों को जोड़ने के लिए सबसे छोटा डीएनए टुकड़े, जो अक्सर 250 आधार जोड़े से कम कर रहे हैं को दूर करने के लिए किया जाता है । छोटे डीएनए टुकड़े को और अधिक कठोर हटाने के लिए है (i) अधिशेष एडेप्टरों को हटाने और (ii) निम्न चरणों में बड़े अंशों के प्रवर्धन पर जोर दें ।
    3. नमूने 5 मिनट के लिए मशीन चलो 5 मिनट के लिए एक चुंबकीय प्लेट पर ट्यूबों रखो । ध्यान से हटाने और supernatant कि वांछित आकार सीमा के बाहर डीएनए शामिल त्यागें ।
      नोट: वांछित डीएनए लक्ष्य होते हैं कि मोतियों को परेशान करने के लिए नहीं सावधान रहना.
    4. जबकि चुंबकीय स्टैंड पर ट्यूबों के लिए ताजा 80% इथेनॉल के 200 µ एल जोड़ें । 30 एस के लिए कमरे के तापमान पर मशीन और फिर ध्यान से हटाने और supernatant को त्यागें । इस चरण को एक बार दोहराएं । हवा 5 मिनट के लिए मोती शुष्क जबकि ट्यूब ढक्कन खुला के साथ चुंबकीय स्टैंड पर है ।
      नोट: मोतियों को सूखने से अधिक से बचें । यह डीएनए की कम वसूली में परिणाम कर सकते हैं ।
    5. चुंबक से ट्यूबों निकालें । Elute को 0.1 x TE के 17 µ l को जोड़कर मोतियों से डीएनए टारगेट को ऊपर और नीचे pipetting करके अच्छी तरह मिला लें ।
    6. 5 मिनट के लिए कमरे के तापमान पर मशीन चुंबकीय स्टैंड पर ट्यूब प्लेस और समाधान के लिए प्रतीक्षा करने के लिए स्पष्ट बारी (~ 2 मिनट) ।
    7. supernatant के 15 µ l को खींचे ।
  4. पीसीआर प्रवर्धन
    1. उच्च निष्ठा पीसीआर मास्टर मिक्स के 25 µ एल जोड़ें, 5 µ के एल उच्च प्रवाह कम पढ़ें अनुक्रमण पुस्तकालय तैयारी 5 ' प्राइमर, और 5 µ एल के उच्च प्रवाह कम पढ़ें अनुक्रमण पुस्तकालय तैयारी 3 ' प्राइमर, के लिए 15 µ l को साफ अनुकूलक-ligated डीएनए ।
      नोट: कुल मात्रा 50 µ एल होना चाहिए ।
    2. अच्छी तरह से भंवर करके मिलाएं । नमूनों को तालिका 1: thermocycler प्रवर्धन सेटिंग में मिली सेटिंग्स का उपयोग करते हुए thermocycler में रखें ।
      नोट: चक्र की एक बड़ी संख्या में इनपुट डीएनए की कम मात्रा के कारण की जरूरत है ।
सायकल स्टेप temp. समय चक्र
प्रारंभिक विकार 98 ° c 30 एस 1
विकार 98 ° c 10 एस 12
एनीलिंग विस्तार/ 65 डिग्री सेल्सियस 75 एस 12
अंतिम विस्तार 65 डिग्री सेल्सियस 5 min 1
पकड़ 4 ° c

तालिका 1: पीसीआर प्रोटोकॉल विकार, एनीलिंग, और विस्तार बार और तापमान । तापमान और समय इस प्रोटोकॉल में प्रस्तुत रिएजेंट के लिए अनुकूलित किया गया । रिएजेंट बदल रहे हैं, तो तापमान और बार फिर से अनुकूलित किया जाना चाहिए ।

  1. इच्छित लायब्रेरी आकार के लिए चयन का आकार
    नोट: यह मनका चरण दोनों के ऊपर और नीचे लक्ष्य श्रेणी के टुकड़े हटा देगा ।
    1. Homogenize SPRI मोतियों को भंवर करके.
    2. कमरे के तापमान चुंबकीय मोतियों की 25 µ एल (50% मात्रा) जोड़ें और ऊपर और नीचे pipetting द्वारा अच्छी तरह से मिश्रण । नमूने 5 मिनट के लिए मशीन चलो एक चुंबकीय प्लेट पर ट्यूबों रखो और उंहें 5 मिनट के लिए बैठते हैं । ध्यान से हटाने और लेबल ट्यूबों का एक नया सेट करने के लिए supernatant हस्तांतरण ।
      नोट: इस खंड वांछित पुस्तकालय आकार के आधार पर समायोजित किया जा सकता है । supernatant वांछित आकार के डीएनए टुकड़े होते हैं । पहले मनका गर्मी में, मोती बड़ा पुस्तकालय टुकड़े बाध्यकारी हैं । ये 400 में उन पर ध्यान केंद्रित-600 आधार जोड़ी रेंज हटा रहे हैं । supernatant में छोटे अंश होते हैं ।
    3. supernatant करने के लिए कमरे के तापमान SPRI मोतियों की 6 µ एल जोड़ें और ऊपर और नीचे pipetting द्वारा अच्छी तरह से मिश्रण । नमूने 5 मिनट के लिए मशीन चलो एक चुंबकीय प्लेट पर ट्यूबों रखो और उंहें 5 मिनट के लिए बैठते हैं ।
      नोट: यह खंड चरण 6.5.2 के अनुसार में वांछित पुस्तकालय आकार के आधार पर समायोजित किया जा सकता है ।
    4. supernatant को सावधानीपूर्वक निकालें और छोड़ें ।
      नोट: सावधान रहें कि वांछित डीएनए वाले मोतियों को परेशान न करें. दूसरी मनका मशीन में, मोतियों की सबसे बड़ी डीएनए टुकड़े के प्रारंभिक हटाने के बाद छोड़ दिया टुकड़े करने के लिए बाध्यकारी हैं । टुकड़ों के इस सेट में आम तौर पर वांछित आकार रेंज में है ।
    5. जबकि चुंबकीय स्टैंड पर ट्यूबों के लिए ताजा 80% इथेनॉल के 200 µ एल जोड़ें । 30 एस के लिए कमरे के तापमान पर मशीन, तो ध्यान से हटाने और supernatant त्यागें । दोहराएं. हवा 5 मिनट के लिए मोती शुष्क जबकि ट्यूब ढक्कन खुला के साथ चुंबकीय स्टैंड पर है ।
      नोट: अधिक से बचें-मोती सूखने । यह डीएनए की कम वसूली में परिणाम कर सकते हैं ।
    6. चुंबक से ट्यूबों निकालें । Elute के डीएनए लक्ष्य को मोतियों से मिलाकर 0.1 x TE के 33 µ l में डालकर अच्छी तरह से ऊपर और नीचे pipetting करके मिक्स करें ।
    7. 5 मिनट के लिए कमरे के तापमान पर मशीन चुंबकीय स्टैंड पर ट्यूब प्लेस और समाधान के लिए प्रतीक्षा करने के लिए स्पष्ट बारी (~ 2 मिनट) । supernatant के 30 µ एल खींचो और 2 मिलीलीटर ट्यूबों के लिए स्थानांतरण ( सामग्री की तालिकादेखें) भंडारण के लिए ।
      नोट: लंबी अवधि के स्टोरेज के लिए पुस्तकालयों में-20 ˚ सी रखी जा सकती है ।
  2. गुणवत्ता नियंत्रण
    1. डीएनए पुस्तकालयों पर एक गुणवत्ता नियंत्रण परीक्षण चलाते हैं । 3.1 और 3.2 चरणों का संदर्भ लें ।
      नोट: डीएनए पुस्तकालयों के लिए, 96 वी में ~ 45 मिनट के लिए जेल चलाने के लिए ।
  3. लायब्रेरी पुनर्वर्धन: यदि लायब्रेरी मात्रा पर्याप्त नहीं है वैकल्पिक ।
    नोट: 10 एनएम के नीचे पुस्तकालय सांद्रता के साथ नमूने निंनलिखित चरणों का उपयोग कर reवर्धित किया जा सकता है । कम एकाग्रता पुस्तकालयों के पुनर्वर्धन अनुक्रमण के लिए व्यावहारिक परिणाम प्राप्त कर सकते हैं, लेकिन पुनर्वर्धन आधार संरचना विविधता में एक मामूली बदलाव का कारण हो सकता है, हालांकि इकट्ठा डेटा (तालिका 3) का सुझाव है कि यह कुछ मैट्रिक्स के लिए नगण्य है .
    1. सार्वभौमिक पुनर्वर्धन प्राइमरों 10-0.1 x ते का उपयोग गुना पतला ।
    2. उच्च निष्ठा पीसीआर मास्टर मिक्स के 25 µ एल जोड़ें, पतला सार्वभौमिक पुनर्वर्धन प्राइमरी 1 (AATGATACGGCGACCACCGA) के 5 µ एल, और 5 µ एल के पतला सार्वभौमिक पुनर्वर्धन प्राइमर 2 (CAAGCAGAAGACGGCATACGA) के लिए 15 µ एल कम एकाग्रता पुस्तकालयों की । नोट: कुल मात्रा पर होना चाहिए 50 µ l.
    3. अच्छी तरह से भंवर करके मिलाएं । नमूनों को तालिका 1: thermocycler प्रवर्धन सेटिंग में मिली सेटिंग्स का उपयोग करते हुए thermocycler में रखें
      नोट: चक्र की बड़ी संख्या में इनपुट डीएनए की कम मात्रा के कारण की जरूरत है ।
    4. मनका साफ-अप
    5. Homogenize SPRI मोतियों को भंवर करके. कमरे के तापमान SPRI मोती (90% मात्रा) के 45 µ एल जोड़ें और ऊपर और नीचे pipetting द्वारा अच्छी तरह से मिश्रण ।
    6. नमूने 5 मिनट के लिए मशीन चलो 5 मिनट के लिए एक चुंबकीय प्लेट पर ट्यूबों रखो ।
    7. अवांछित डीएनए वाले supernatant को सावधानीपूर्वक निकालें और छोड़ें ।
      नोट: वांछित डीएनए लक्ष्य होते हैं कि मोतियों को परेशान करने के लिए नहीं सावधान रहना.
    8. जबकि चुंबकीय स्टैंड पर ट्यूबों के लिए ताजा 80% इथेनॉल के 200 µ एल जोड़ें । 30 एस के लिए कमरे के तापमान पर मशीन, और फिर ध्यान से हटाने और supernatant को त्यागें । इस चरण को एक बार दोहराएं ।
    9. हवा 5 मिनट के लिए मोती शुष्क जबकि ट्यूब अपने ढक्कन खुले के साथ चुंबकीय स्टैंड पर है ।
      नोट: अधिक से बचें-मोती सूखने । यह डीएनए लक्ष्य की कम वसूली में परिणाम कर सकते हैं ।
    10. चुंबक से ट्यूबों निकालें । Elute के डीएनए लक्ष्य को मोतियों से मिलाकर 0.1 x TE के 33 µ l में डालकर अच्छी तरह से ऊपर और नीचे pipetting करके मिक्स करें ।
    11. 5 मिनट के लिए कमरे के तापमान पर मशीन चुंबकीय स्टैंड पर ट्यूब प्लेस और समाधान के लिए प्रतीक्षा करने के लिए स्पष्ट बारी (~ 2 मिनट) ।
    12. supernatant के 30 µ l को खींचे । पुस्तकालयों लंबी अवधि के भंडारण के लिए-20 डिग्री सेल्सियस पर संग्रहीत किया जा सकता है ।
  4. गुणवत्ता नियंत्रण
    1. डीएनए पुस्तकालयों पर एक गुणवत्ता नियंत्रण परीक्षण चलाते हैं । 3.1 और 3.2 चरणों का संदर्भ लें । डीएनए पुस्तकालयों के लिए, 96 वी में ~ 45 मिनट के लिए जेल चलाने के लिए ।
      नोट: यदि एक डबल बैंड जेल में देखा जाता है, यह संभावना पुनर्वर्धन कदम से प्राइमर थकावट का परिणाम है । बैंड 6.9 दोहरा द्वारा हटाया जा सकता है, लेकिन पीसीआर कार्यक्रम में केवल एक चक्र का उपयोग कर तालिका 1में चित्रित किया ।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

डीएनए अलगाव और अंतिम पुस्तकालय उपज
इस अध्ययन में, वानस्पतिक डीएनए के अलगाव और उच्च गुणवत्ता वाले अनुक्रमण पुस्तकालयों की वसूली के लिए प्रोटोकॉल की प्रभावकारिता 1920 से सबसे पुराने और 2012 (तालिका 2) से कम उम्र के साथ पचास विभिन्न नमूनों का उपयोग कर प्रदर्शन किया गया था. प्रत्येक नमूने के लिए, लगभग 10 पत्ती ऊतक के मिलीग्राम डीएनए अलगाव के लिए इस्तेमाल किया गया था । हरी पत्ती ऊतक इष्ट अगर उपलब्ध था, और स्पष्ट कवक संदूषण के साथ कोई ऊतक चुना गया था । सफल अलगाव पीले या भूरे रंग के ऊतकों का उपयोग किया जा सकता है, हालांकि उपज कम होने की उंमीद की जानी चाहिए । प्रारंभिक अलगाव से कुल डबल असहाय डीएनए (dsDNA) २,६१० एनजी करने के लिए एनजी से लेकर । के रूप में की उंमीद है, डीएनए वानस्पतिक नमूनों से प्राप्त उच्च अपमानित (चित्र 1a, पूरक चित्रा 1) था । इन अलगाव के एक हिस्से एंजाइमी बाल काटना (1.26-464 एनजी) के लिए इस्तेमाल किया गया । हालांकि वानस्पतिक डीएनए पहले से ही संरक्षण की प्रक्रिया के माध्यम से कतरनी है, प्रोटोकॉल का अनुकूलन अतिरिक्त बाल काटना समग्र पुस्तकालय उपज में सुधार की आवश्यकता है । dsDNA पोस्ट की कुल वसूली-बाल काटना < 1% से लेकर 51% तक के इनपुट dsDNA की है, जिसके परिणामस्वरूप न्यूनतम 1.25 से कम के लिए डीएनए शुरू करने के लिए पुस्तकालय की तैयारी और अधिकतम 328 एनजी । कुछ नमूनों में डीएनए की अत्यधिक हानि डीएनए के बहुत पहले से ही छोटे टुकड़े आकार के लिए जिंमेदार ठहराया जा सकता एंजाइमी बाल काटना (चित्र 1a, पूरक चित्रा 1) से पहले । कतरनी डीएनए पर एक 90% मात्रा मनका सफाई का उपयोग जानबूझकर डीएनए के छोटे टुकड़े को हटा बड़ा, अधिक वांछनीय टुकड़ा आकार के लिए समृद्ध । इन छोटे टुकड़ों में विशेष रूप से देखा गया नमूनों TK463, TK657, और TK694, चिह्नित के रूप में एक तीव्र संकेत द्वारा 100 आधार जोड़ी चिह्न (चित्र 1a) ।

पुस्तकालय पद का आकार चयन की कुल मात्रा १.४२५ एनजी से ९४२.५ एनजी (तालिका 2, पूरक तालिका 1) से लेकर । नमूनों में से 23 के लिए, प्रारंभिक निष्कर्षण और लाइब्रेरी तैयारी में पर्याप्त मात्रा में लाइब्रेरी नहीं थी (< 10 एनएम; तालिका 2, पूरक तालिका 1), इसलिए इन नमूनों को प्रोटोकॉल के पुनर्वर्धन और पुनर्प्राप्ति चरणों के अधीन किया गया, जिसके परिणामस्वरूप कुल लाइब्रेरी में 14 – 680x वृद्धि हुई (तालिका 2, पूरक तालिका 1). अंतिम पुस्तकालयों 350 और 500 आधार जोड़े (चित्र 1b, पूरक चित्रा 2) के बीच एक बैंड में हुई । कई बार, एक दूसरे बैंड है कि उंमीद की लाइब्रेरी के आकार से बड़ा था देखा (आंकड़ा 1b, पूरक चित्रा 2) था । यह तब हुआ जब पुनर्वर्धन पीसीआर उपलब्ध प्राइमरों समाप्त और गैर मुताबिक़ डीएनए टुकड़े के एनीलिंग पुस्तकालय एडेप्टर शुरू हुआ । यह एक अणु पैदा करता है जहाँ छोर (ढलने वाले) ठीक से एनीलिंग थे, लेकिन डीएनए डालने का नहीं हुआ. यह "बुलबुला" अणु एक जेल पर बड़ा दिखाई दिया, क्योंकि यह जेल मैट्रिक्स के माध्यम से और अधिक धीरे चले गए । इन एनीलिंग त्रुटियों पहले से ही प्रवर्धित पुस्तकालय से एक और पुनर्वर्धन प्रतिक्रिया तैयार करने और एक ही चक्र के लिए इसे चलाने के द्वारा तय किया गया । यह एक चक्र उचित एनीलिंग और प्रवर्धन के लिए प्राइमरों प्रदान की, दूसरा बैंड (पूरक चित्रा 3) को हटाने ।

पुस्तकालयों के पुनर्वर्धन को कम से कम 10 एनएम के अंतिम पुस्तकालय सांद्रता की सुविधा । इन सांद्रता पुस्तकालयों बराबर molarity और बराबर प्रतिनिधित्व में परित को पतला होने की अनुमति दी, मुद्दों है कि असमान नमूना गुणवत्ता और अनुक्रमण पुस्तकालय उपज के साथ उत्पंन होता है नकारने में मदद । यदि एक परियोजना के लक्ष्य chloroplast जीनोम अनुक्रमण है, तो आवश्यक अनुक्रमण की कुल राशि अलग वंश और ऊतकों के रूप में भिन्न हो जाएगा पढ़ता है कि chloroplast डीएनए से शुरू की कुल प्रतिशत में अलग19. आमतौर पर, 50-100x chloroplast जीनोम के अनुमानित कवरेज विधानसभा के लिए पर्याप्त है, और sequencing रन प्रजातियों और अनुक्रमण विधि के आधार पर के रूप में कई के रूप में 70 व्यक्तियों को शामिल करने के लिए परित किया जा सकता है ।

संवर्धन की वजह से संदूषण, पूर्वाग्रह और भिंनता के लिए परीक्षण
HTS अनुक्रमण के लिए एक उल्लेखनीय चिंता व्यापक पीसीआर प्रवर्धन20के माध्यम से पुस्तकालयों में पूर्वाग्रह की शुरूआत है । प्रवर्धन के प्रभाव का परीक्षण और वानस्पतिक सामग्री के आम वंशावली अनुप्रयोगों में संभावित पूर्वाग्रह की पहचान, हम एक ही पुस्तकालय पतला 1:5 और reवर्धित (नामित TK686-R) के साथ एक सफलतापूर्वक अनुक्रम पुस्तकालय (TK686) की तुलना में । दोनों TK686 और TK686-R इलिनोइस विश्वविद्यालय में एक Illumina HiSeq4000 पर अनुक्रम थे रॉय जे Carver जैव प्रौद्योगिकी केंद्र और मिशिगन राज्य विश्वविद्यालय अनुसंधान प्रौद्योगिकी सहायता सुविधा, क्रमशः, युग्मित अंत 150 आधार जोड़ी का उपयोग कर पढ़ता है (देखें sequencing विवरण के लिए तालिका 3) । रॉ NCBI SRA (SRP128083) में जमा किया गया है पढ़ता है । पढ़ता नेब एडेप्टर अनुक्रम, एक 10 आधार जोड़ी फिसलने खिड़की के लिए 20 के एक औसत phred स्कोर के लिए फ़िल्टरिंग गुणवत्ता, और 40 आधार जोड़े के आकार से एक ंयूनतम कटौती के लिए छानने का उपयोग trimmer सहित Trimmomatic v. 0.3621 का उपयोग कर साफ किया गया । वानस्पतिक नमूनों के साथ प्राथमिक मुद्दों में से एक के रूप में कवक संदूषण है, संदूषण JGI MycoCosm कवक जीनोम डेटाबेस के एक हिस्से के खिलाफ पढ़ता मानचित्रण द्वारा अनुमानित था22 (312 परमाणु जीनोम और 79 mitochondrial जीनोम) bowtie2 वी का उपयोग . 2.2.923 का उपयोग करते हुए "बहुत-संवेदनशील-स्थानीय" पैरामीटर सेट करें । TK686 और TK686-R पुस्तकालयों परमाणु कवक प्रदूषित (९.२४% और ९.६८%, क्रमशः) और mitochondrial कवक संदूषण (०.९४% और 0.8%) (तालिका 3) । हालांकि यह केवल एक उदाहरण है, यह सुझाव है कि वानस्पतिक नमूनों की फंगल संदूषण नगण्य नहीं है और वानस्पतिक-व्युत्पन्न अनुक्रम डेटा का उपयोग करने से पहले हटाया जाना चाहिए. डेटाबेस और आदेश की पहचान करने और कवक संदूषण को दूर करने के लिए इस्तेमाल किया एम. आर McKain के GitHub भंडार वानस्पतिक जीनोमिक्स24में पाया जा सकता है ।

Chloroplast जीनोम अनुक्रमण सामांयतः वंशावली विश्लेषण के लिए प्रयोग किया जाता है, और वानस्पतिक नमूनों तेजी से स्रोत सामग्री12के रूप में इस्तेमाल कर रहे हैं । आदेश में chloroplast जीनोम विधानसभा में पुनर्वर्धन की निष्ठा का परीक्षण करने के लिए, दोनों TK686 और TK686-R के लिए chloroplast जीनोम तेजी से प्लास्ट v. 1.2.525 bowtie के लिए सेट के साथ डिफ़ॉल्ट सेटिंग्स के तहत का उपयोग कर इकट्ठे हुए थे । एक पूर्ण chloroplast जीनोम TK686-आर के लिए प्राप्त किया गया था, लेकिन TK686 chloroplast जीनोम को कम पढ़ें गहराई के कारण सात contigs में इकट्ठा किया गया था । TK686 contigs McKain एट अल निंनलिखित मैंयुअल रूप से इकट्ठे थे । 26 पूरी तरह से इकट्ठे chloroplast जीनोम एक GUI-आधारित संरेखण सॉफ्टवेयर में एक दूसरे से गठबंधन किया गया ( सामग्री की तालिकादेखें) और विधानसभाओं के बीच भिंनता का आकलन किया गया । TK686 और TK686-आर के लिए chloroplast सभाओं के बीच कुल 12 SNPs और एक indel की पहचान की गई । प्रत्येक वैरिएंट के लिए, कवरेज दोनों TK686 और TK686-R से पढ़ें सेट में मूल्यांकन किया गया था । सभी मामलों में, सबसे सामांय संस्करण दो लायब्रेरीज़ के बीच समान था । TK686 एक टी → सी, एक जी → एक, एक जी → टी, एक जी →-, एक सी → एक, एक टी → एक, और चार सी → एक वेरिएंट का प्रदर्शन किया । इन वेरिएंट के पांच एक homopolymer स्ट्रिंग के भीतर हुई, विधानसभा में अपने निगमन सुझाव sequencing त्रुटि और कम समग्र कवरेज का परिणाम हो सकता है. दूसरों को या तो chloroplast haplotype भिन्नता का परिणाम हो सकता है, sequencing त्रुटि, या cytosine अमीनता, या इन कारकों में से कुछ संयोजन. TK686-R था एक सी → टी, एक जी → टी, और एक एक → जी C → t और G → t वेरिएंट को ऊपर के रूप में एक homopolymer में पाया गया । अंततः, समान पूरा chloroplast जीनोम दोनों पढ़ें सेट से पहचाने गए । TK686 से एक एकल chloroplast जीनोम सब्ज़21 का उपयोग कर व्याख्या की थी और जनजाति Andropogoneae के अंय सदस्यों की तुलना में । सभी मानक chloroplast विशेषताएं व्याख्या कर रहे थे: 8 rRNAs, 38 tRNAs, और 84 जीन कोडिंग प्रोटीन । पूरा chloroplast जीनोम GenBank (MF170217) और सब्ज़२७से उपलब्ध है.

पुस्तकालयों के पुनर्वर्धन से संभावित पूर्वाग्रह भी GC प्रतिशत और कुल अनुमानित transposon सामग्री के आकलन के माध्यम से निर्धारित किया गया था । प्रतिशत GC कस्टम स्क्रिप्ट24का उपयोग कर अनुमानित था । दो नमूनों की gc सामग्री में अंतर ४९.७% TK686 में gc और ५१.२% TK686 में gc-आर के साथ नगण्य थे । Transposon रचना Transposome२८प्रयोग गर्दा अनुमान गरिएको छ । दोनों पुस्तकालयों के लिए, 100,000 पढ़ता बेतरतीब ढंग से नमूना थे और transposon रचना 90, 0.55 का एक अंश कवरेज, 100 के एक क्लस्टर आकार, और RepBase २१.१० घास दोहराने संदर्भ सेट29का एक प्रतिशत पहचान का उपयोग कर अनुमान लगाया गया था । यह इन डेटासेट से transposon estimation पर bootstrapping करने के लिए 100 बार दोहराया गया था । transposons के प्रमुख उपपरिवारों के लिए कुल जीनोम प्रतिशत Transposome उत्पादन से निकाले गए थे, और मतलब है और इन के मानक विचलन के लिए 100 दोहराने का अनुमान किया गया । इन outputs उत्पंन करने के लिए इस्तेमाल सभी लिपियों एम आर McKain के Github भंडार Transposons30में पाया जा सकता है, और सभी परिणाम Dryad (दोी: 10.5061/Dryad. r8t2m) में जमा किया गया है । संकेतक (Copia और जिप्सी लंबे टर्मिनल दोहराने retrotransposons) के रूप में दो सबसे प्रचलित transposon उपपरिवारों का उपयोग करना, परिणाम ३३.५२ ± 4.00% और ३१.६८ ± २.९४% पर Copia के साथ लगभग समान थे और २४.८३ ± में जिप्सी TK686 और TK686-आर में २.७२% और 1, 00 ± 2.35% क्रमशः (तालिका 3) । ये परीक्षण परिणाम सुझाव देते हैं कि इस प्रोटोकॉल के पुनर्वर्धन चरण उच्च-स्तरीय जीनोम मैट्रिक्स के लिए सार्थक अनुक्रमण पूर्वाग्रह नहीं बना था । तथापि, यह ध्यान दिया जाना चाहिए कि यह एक उदाहरण के सभी प्रवर्धित पुस्तकालयों के पूरी तरह से प्रतिनिधि नहीं हो सकता है । यह एक परीक्षण दर्शाता है कि पुनर्वर्धन कदम स्वाभाविक TK686 में जीनोम मैट्रिक्स/TK686-R पक्षपातपूर्ण नहीं था । शुरू पूर्वाग्रह एक chloroplast जीनोम के विधानसभा अनुक्रमण के पर्याप्त कवरेज दिया प्रभावित नहीं होता, लेकिन यह अनुशंसित है कि प्रयोगों, TK686 के साथ इस अध्ययन में प्रस्तुत के रूप में/TK686-R, लक्ष्य वंश पर आयोजित की पुष्टि करने के लिए कि पूर्वाग्रह नहीं है transposable तत्व विविधता की जांच अध्ययन के दौरान होने वाली ।

Figure 1
चित्रा 1: एक के Agarose जेल छवियों डीएनए अलगाव और ख) दस वानस्पतिक नमूनों से अंतिम अनुक्रमण पुस्तकालयों. प्रत्येक लेन के लिए, डीएनए या पुस्तकालय के 3 µ एल का इस्तेमाल किया गया था । () डीएनए के रूप में आम धब्बा द्वारा देखा गया सभी वानस्पतिक अलगाव में नीचा था. () अंतिम अनुक्रमण पुस्तकालयों 200-1000 आधार जोड़े के एक व्यापक वितरण के साथ 300-500 आधार जोड़े के एक प्राथमिक बैंड चित्रित; उत्तरार्द्ध प्रवर्धित पुस्तकालयों में अधिक प्रचलित है. दोनों के लिए लेन (एक) और () नमूना द्वारा की पहचान की गई और तालिका 2में परिणाम की तुलना में किया जा सकता है । आधार जोड़े (बीपी) में सीढ़ी का आकार दर्शाया गया था । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्र 2 : परिपत्र की साजिश Schizachyrium scoparium (TK686) एनोटेशन के साथ chloroplast जीनोम । वानस्पतिक-व्युत्पन्न डीएनए की शॉटगन अनुक्रमण से पूरी तरह से इकट्ठा जीनोम १३९,२९६ आधार जोड़े (बीपी) की कुल लंबाई का प्रदर्शन किया, ८१,४०१ bp की एक बड़ी एकल प्रतिलिपि क्षेत्र (LSC), २२,६६९ bp के एक औंधा दोहराने क्षेत्र (IR), और १२,५५७ के एक छोटे एकल प्रतिलिपि क्षेत्र (एसएससी) बीपी. सभी मानक प्रोटीन कोडिंग जीन, tRNAs, और Andropogoneae जनजाति के सदस्यों के लिए rRNAs एनोटेशन में पहचान की गई । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

तालिका 2: डीएनए निष्कर्षण और दस वानस्पतिक नमूनों और चार reवर्धित पुस्तकालयों के लिए पुस्तकालय तैयारी परिणाम । प्रोटोकॉल में विभिंन चरणों में कुल डबल फंसे डीएनए का प्रदर्शन कैसे चर गुणवत्ता हो सकता है, खासकर जब आकार के लिए फ़िल्टर्ड । इस तालिका को डाउनलोड करने के लिए कृपया यहां क्लिक करें.

तालिका 3: TK686 और reवर्धित TK686R के लिए sequencing आँकड़े. पुनर्वर्धन कवक जीनोम संदूषण की समग्र घटनाओं को प्रभावित नहीं करता है, जीसी सामग्री अनुमान, transposon संरचना अनुमान, या पूरे chloroplast जीनोम को इकट्ठा करने की क्षमता । इस तालिका को डाउनलोड करने के लिए कृपया यहां क्लिक करें.

पूरक तालिका 1: डीएनए निष्कर्षण और बीस प्रवर्धित पुस्तकालयों सहित चालीस अतिरिक्त वानस्पतिक नमूनों के लिए पुस्तकालय तैयारी के परिणाम. कुल दोहरे फंसे डीएनए प्रोटोकॉल में विभिंन चरणों में प्रदर्शित कैसे चर गुणवत्ता हो सकता है, खासकर जब आकार के लिए फ़िल्टर्ड । इस तालिका को डाउनलोड करने के लिए कृपया यहां क्लिक करें.

पूरक चित्रा 1: वानस्पतिक नमूनों से चालीस अतिरिक्त डीएनए अलगाव की Agarose जेल छवियों. दोनों () और () बीस अलग डीएनए अलगाव को दर्शाती है और वानस्पतिक-व्युत्पंन डीएनए की विशेषता गिरावट का प्रदर्शन । प्रत्येक लेन के लिए, डीएनए के 3 µ एल का इस्तेमाल किया गया था । दोनों के लिए लेन (एक) और () नमूना द्वारा की पहचान की गई और पूरक तालिका 1में परिणाम की तुलना में किया जा सकता है. आधार जोड़े (बीपी) में सीढ़ी का आकार दर्शाया गया है । छवि पर सफेद flecks जेल imager में कलाकृतियों के कारण कर रहे है कि सफाई के साथ नहीं हटाया जा सकता है । इस आंकड़े को डाउनलोड करने के लिए कृपया यहां क्लिक करें ।

पूरक चित्रा 2: वानस्पतिक-व्युत्पंन डीएनए से चालीस अतिरिक्त अनुक्रमण पुस्तकालयों के Agarose जेल छवियों. प्रत्येक लेन के लिए, पुस्तकालय के 3 µ एल का उपयोग किया गया था । अंतिम अनुक्रमण पुस्तकालयों में पाया जाता है दोनों (A) और (B) 300-500 आधार जोड़े की एक औसत आकार के साथ । माध्यमिक कुछ परिवर्धित नमूनों में देखा बैंड का सुझाव "bubbling" पुस्तकालयों के । दोनों के लिए लेन (एक) और () नमूना द्वारा की पहचान कर रहे हैं और पूरक तालिका 1में परिणाम की तुलना में किया जा सकता है. आधार जोड़े (बीपी) में सीढ़ी का आकार दर्शाया गया है । इस आंकड़े को डाउनलोड करने के लिए कृपया यहां क्लिक करें ।

पूरक चित्रा 3: एक अतिरिक्त एकल चक्र पीसीआर कदम के साथ माध्यमिक बैंड हटाने की Agarose जेल छवि. इस आंकड़े को डाउनलोड करने के लिए कृपया यहां क्लिक करें ।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

प्रोटोकॉल यहां प्रस्तुत डीएनए अलगाव और अनुक्रमण सूखे संयंत्र नमूनों से पुस्तकालय की तैयारी के लिए एक व्यापक और मजबूत तरीका है । विधि की निरंतरता और इसे बदलने के लिए ंयूनतम जरूरत नमूना गुणवत्ता के आधार पर बड़े वानस्पतिक-आधारित अनुक्रमण परियोजनाओं के लिए स्केलेबल । कम उपज पुस्तकालयों के लिए एक वैकल्पिक पुनर्वर्धन कदम का समावेश कम गुणवत्ता, कम मात्रा, दुर्लभ, या ऐतिहासिक रूप से महत्वपूर्ण नमूने है कि अंयथा अनुक्रमण के लिए उपयुक्त नहीं होगा के शामिल किए जाने की अनुमति देता है ।

प्रारंभिक डीएनए उपज का महत्व
वानस्पतिक-प्राप्त डीएनए अक्सर प्रारंभिक नमूना संरक्षण का एक परिणाम के रूप में अपमानित किया जाता है11, कम 300 साल पुराने नमूनों के डीएनए के साथ के रूप में अपमानित करने के रूप में पशु से अलग है कि हजारों साल पुराने के कई सौ है रहता है31 , 32. नतीजतन, प्रारंभिक डीएनए उपज का अनुकूलन सफल अनुक्रमण पुस्तकालय की तैयारी के लिए पर्याप्त उच्च गुणवत्ता dsDNA प्राप्त करने में महत्वपूर्ण है । घास प्रजातियों के लिए, एक इष्टतम उपज प्रारंभिक पीस कदम में निष्फल रेत और तरल नाइट्रोजन के संयुक्त उपयोग के माध्यम से हासिल की है, सेल दीवारों और न्यूक्लिक एसिड की रिहाई का एक अधिक संपूर्ण विनाश प्रदान । यह दृष्टिकोण दोनों वांछनीय बड़ा dsDNA और अवांछनीय छोटे टुकड़े बढ़ जाती है (चित्रा 1, पूरक चित्रा 1, तालिका 2, पूरक तालिका 1). बाद मनका सफाई कदम अलग और अनुक्रमण के लिए उपयुक्त एक आकार के टुकड़े के लिए समृद्ध (300-500 आधार जोड़े), बहुत वसूली को कम करने लेकिन यह भी अब टुकड़े के लिए समृद्ध (तालिका 2, पूरक तालिका 1). प्रारंभिक डीएनए अलगाव कदम करने के लिए परिवर्तन आवश्यक हो वंश के आधार पर आदेश में अनुप्रवाह18प्रसंस्करण पर माध्यमिक चयापचयों के प्रभाव को कम करने के लिए नमूना किया जा रहा है ।

लाइब्रेरी एडेप्टर का ऑप्टिमाइज़ेशन
बंधाव के लिए इस्तेमाल किया एडेप्टर की एकाग्रता समाप्त पुस्तकालयों में एडेप्टर डिमर की मात्रा पर सीधा प्रभाव पड़ता है । एडेप्टर से dimers परिणाम एडेप्टर self-बंधाव जब अपर्याप्त नमूना मौजूद है, और दूषित sequencing33चलाता है । अपेक्षाकृत कम कुल dsDNA वानस्पतिक नमूनों से उपलब्ध आवश्यक कमजोर पड़ने से पहले बंधाव के लिए अनुकूल है । एडेप्टर 15 µ मीटर के शेयर एकाग्रता से 50 गुना पतला किया जा सकता है (देखें प्रोटोकॉल अनुभाग) को व्यक्तिगत रूप से मापने की आवश्यकता के बिना उच्च प्रवाह पुस्तकालय तैयारी को सुविधाजनक बनाने और प्रत्येक नमूने के लिए अनुकूलक पतला (तालिका 2, पूरक तालिका 1). हालांकि एडेप्टर के संतृप्ति सिद्धांत में समग्र पुस्तकालय उपज घट सकता है, यह संभावना नहीं है कि वानस्पतिक नमूनों अनुकूलक के इस तरह के अतिरिक्त में dsDNA उपज होगा ।

मनका में भिंनता उच्च पैदावार के लिए सफाई कदम
अनुक्रमण पुस्तकालयों की तैयारी में आकार चयन आमतौर पर अनुकूली बंधाव के बाद किया जाता है, इच्छित आकार सीमा के भीतर मुख्य रूप से टुकड़े के प्रवर्धन के लिए अनुमति; यह उन अंशों को निकालकर किया जाता है जो लक्ष्य आकार से बड़े और छोटे होते हैं । पुस्तकालय की तैयारी के लिए वानस्पतिक व्युत्पंन dsDNA की कम मात्रा में इस कदम पर आकार चयन के बाद गहरा हो गया है, अंतिम पुस्तकालय में कम कुल dsDNA और अंततः कम उपज में जिसके परिणामस्वरूप । बंधाव के बाद 90% मात्रा मोतियों का उपयोग कर एक मानक मनका सफाई कदम का आयोजन करके, अधिक कुल dsDNA प्रवर्धन कदम में संवर्धन के लिए रहता है । अत्यंत छोटे डीएनए टुकड़े तरजीही 90% मात्रा मोतियों का उपयोग कर हटा रहे हैं । आकार चयन प्रवर्धित पुस्तकालय है, जो वांछित टुकड़ा आकार के संवर्धन सुनिश्चित करता है पर अंतिम चरण में आयोजित किया जाता है । मोतियों की कुल मात्रा वांछित सीमा का चयन करने के लिए समायोजित किया जा सकता है, हालांकि दो-25 µ एल और मोती के 6 µ एल के कदम मात्रा इस प्रोटोकॉल के भीतर 400 के 500 बेस जोड़ी आवेषण के पुस्तकालयों को पुनः प्राप्त करने के लिए अनुकूलित कर रहे हैं (आंकड़ा 1b, अनुपूरक आंकड़ा 2) ।

पुस्तकालयों के पुनर्वर्धन के माध्यम से नमूना बचाव
डीएनए अलगाव और पुस्तकालय की तैयारी में सर्वोत्तम प्रथाओं के बावजूद, अनुक्रमण पुस्तकालयों के अंतिम सांद्रता आगे अनुक्रमण के लिए अपर्याप्त हो सकता है । नमूने की विनाशकारी प्रकृति और अक्सर वानस्पतिक नमूनों से सीमित व्यय सामग्री हमेशा दोहरा डीएनए अलगाव की अनुमति नहीं है । 12 अतिरिक्त पीसीआर चक्र तक पुस्तकालय को फिर से बढ़ाना, यहां तक कि असाधारण गरीब पुस्तकालयों को बचाया जा सकता है । एक मानक प्राइमर जोड़ी प्रवर्धन, जो या तो दोहरी या एकल अनुक्रमित पुस्तकालय प्रोटोकॉल के साथ संगत है के लिए प्रयोग किया जाता है । पुनर्वर्धन के लिए एक प्राथमिक चिंता का परिचय है पूर्वाग्रह की शुरूआत, अक्सर GC में कमी के माध्यम से-20का सबसे अमीर भागों । एक उच्च निष्ठा पोलीमरेज़ का उपयोग करके ( सामग्री की तालिकादेखें), इन संभावित पूर्वाग्रहों संभावित परहेज कर रहे हैं । यह अनुक्रम पुस्तकालयों TK686 और TK686-R (तालिका 3) की GC सामग्री की न्यूनतम भिन्नता के माध्यम से प्रदर्शन किया है । दूसरे सत्यापन के रूप में, TK686 और TK686-R दोनों की transposon सामग्री का अनुमान लगाया गया था और इसमें कोई प्रत्यक्ष अंतर नहीं दिखाई दिया (तालिका 3) । अंत में, इस प्रवेश के पूरे chloroplast जीनोम TK686 और TK686-R, जो दो विधानसभाओं (चित्रा 2, तालिका 3) के बीच SNP भिंनता के करीब निरीक्षण के बाद समान दृश्यों के परिणामस्वरूप से इकट्ठे हुए थे । इन परीक्षणों का सुझाव है कि ऐसे GC सामग्री और transposon संरचना के रूप में मानक जीनोमिक मैट्रिक्स, और पूरा chloroplast जीनोम को इकट्ठा करने की क्षमता, पुनर्वर्धन से प्रभावित नहीं हो सकता है । यह ऊपर वानस्पतिक नमूनों को शामिल करने की संभावना को खोलता है भी नीचा या पीसीआर के माध्यम से पेश पूर्वाग्रह के लिए चिंता के बिना phylogenomic अध्ययन में सामग्री में कमी है । ये reवर्धित पुस्तकालयों भी अनुक्रम पर कब्जा करने के लिए इस्तेमाल किया जा सकता है34, हालांकि यह परीक्षण करने के लिए आवश्यक होगा कि SNP कॉलिंग पक्षपातपूर्ण है । यह अनुशंसा की जाती है कि बायस के छोटे स्केल परीक्षण प्रत्येक प्रोजेक्ट के साथ कि बायस sequencing लायब्रेरीज़ में प्रस्तुत नहीं है सत्यापित करने के लिए आयोजित किया जा सकता है ।

सीमाएं और संभावित संशोधन
भले ही इस प्रोटोकॉल वानस्पतिक नमूनों के सैकड़ों पर काम किया है, खराब संरक्षित ऊतकों अभी भी कोई कदम पर विफल हो सकता है । यह है, तथापि, बेहद दुर्लभ पुस्तकालयों के लिए सफल डीएनए निकालने के साथ ऊतकों से विफल, विशेष रूप से पुनर्वर्धन के माध्यम से पुस्तकालय बचाव के बाद । आकार चयन चरणों अलग आकार के टुकड़े को लक्षित करने के लिए या कुछ अंतिम पुस्तकालयों में देखा टुकड़े की विस्तृत श्रृंखला को कम करने के लिए संशोधित किया जा सकता है । सभी संयंत्र आधारित निष्कर्षण प्रोटोकॉल के साथ के रूप में, कदम वंश-विशिष्ट माध्यमिक यौगिकों कि समग्र प्रोटोकॉल में बाधा उत्पंन कर सकते है हटाने की जरूरत हो सकती है । के रूप में प्रस्तुत किया, इस प्रोटोकॉल डीएनए अलगाव और उच्च प्रवाह घास वानस्पतिक नमूनों के लिए पुस्तकालय की तैयारी के लिए एक मानक विधि प्रदान करता है, और सत्यापन और प्रयोग के माध्यम से अंय संयंत्र वंश में संशोधन करने की संभावना है ।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखक घोषणा करते हैं कि उनके पास कोई प्रतिस्पर्धी रुचि नहीं है ।

Acknowledgments

हम टेलर AuBuchon-एल्डर, जॉर्डन Teisher, और क्रिस्टीना Zudock नमूना वानस्पतिक नमूनों में सहायता के लिए धंयवाद, और मिसौरी के लिए विनाशकारी नमूने के लिए वानस्पतिक नमूनों का उपयोग करने के लिए वनस्पति उद्यान । यह काम राष्ट्रीय विज्ञान फाउंडेशन (देब-१४५७७४८) से एक अनुदान द्वारा समर्थन किया गया ।

Materials

Name Company Catalog Number Comments
Veriti Thermal Cycler Applied Biosystems 4452300 96 well 
Gel Imaging System Azure Biosystems c300
Microfuge 20 Series Beckman Coulter B30137
Digital Dry Bath Benchmark Scientific BSH1001
Electrophoresis System EasyCast B2
PURELAB flex 2 (Ultra pure water) ELGA  89204-092
DNA LoBind Tube  Eppendorf 30108078 2 ml
Mini centrifuge Fisher Scientific 12-006-901
Vortex-Genie 2 Fisher Scientific 12-812
Mortar Fisher Scientific S02591 porcelain
Pestle fisher Scientific S02595 porcelain
Centrifuge tubes fisher Scientific 21-403-161
Microwave Kenmore 405.7309231
Qubit Assay Tubes Invitrogen Q32856
0.2 ml Strip tube and Cap for PCR VWR 20170-004
Qubit 2.0 Fluorometer Invitrogen Q32866
Balance Mettler Toledo PM2000
Liquid Nitrogen Short-term Storage Nalgene F9401
Magnetic-Ring Stand  ThermoFisher Scientific  AM10050 96 well 
Water Bath VWR 89032-210
Hot Plate Stirrers VWR 97042-754
Liquid Nitrogen Airgas UN1977
1 X TE Buffer Ambion AM9849 pH 8.0
CTAB AMRESCO 0833-500G
2-MERCAPTOETHANOL AMRESCO 0482-200ML
Ribonuclease A AMRESCO E866-5ML 10 mg/ml solution
Agencourt AMPure XP Beckman Coulter A63882
Sodium Chloride bio WORLD 705744
Isopropyl Alcohol bio WORLD 40970004-1
Nuclease Free water bio WORLD 42300012-2
Isoamyl Alcohol Fisher Scientific A393-500
Sodium Acetate Trihydrate Fisher Scientific s608-500
LE Agarose GeneMate E-3120-500
100bp PLUS DNA Ladder Gold Biotechnology D003-500
EDTA, Disodium Salt IBI Scientific IB70182
Qubit dsDNA HS Assay Kit Life Technologies Q32854
TRIS MP Biomedicals 103133 ultra pure
Gel Loading Dye Purple (6 X) New England BioLabs B7024S
NEBNext dsDNA Fragmentase New England BioLabs M0348L
NEBNext Ultra II DNA Library Prep Kit for Illumina  New England BioLabs E7645L
NEBNext Multiplex Oligos for Illumina New England BioLabs E7600S Dual Index Primers Set 1
NEBNext Q5 Hot Start HiFi PCR Master Mix New England BioLabs M0543L
Mag-Bind RXNPure Plus Omega bio-tek M1386-02
GelRed 10000 X Pheonix Research 41003-1
Phenol solution SIGMA Life Science P4557-400ml
PVP40 SIGMA-Aldrich PVP40-50G
Chloroform VWR EM8.22265.2500
Ethanol Koptec V1016 200 Proof
Silica sand VWR 14808-60-7
Reamplification primers Integrated DNA Technologies see text
Sequencher v.5.0.1 GeneCodes

DOWNLOAD MATERIALS LIST

References

  1. Savolainen, V., Cuénoud, P., Spichiger, R., Martinez, M. D. P., Crèvecoeur, M., Manen, J. F. The use of herbarium specimens in DNA phylogenetics: Evaluation and improvement. Plant Syst Evo. 197, (1-4), 87-98 (1995).
  2. Zedane, L., Hong-Wa, C., Murienne, J., Jeziorski, C., Baldwin, B. G., Besnard, G. Museomics illuminate the history of an extinct, paleoendemic plant lineage (Hesperelaea, Oleaceae) known from an 1875 collection from Guadalupe Island, Mexico. Bio J Linn Soc. 117, (1), 44-57 (2016).
  3. Teisher, J. K., McKain, M. R., Schaal, B. A., Kellogg, E. A. Polyphyly of Arundinoideae (Poaceae) and Evolution of the Twisted Geniculate Lemma Awn. Ann Bot. (2017).
  4. Cozzolino, S., Cafasso, D., Pellegrino, G., Musacchio, A., Widmer, A. Genetic variation in time and space: the use of herbarium specimens to reconstruct patterns of genetic variation in the endangered orchid Anacamptis palustris. Conserv Gen. 8, (3), 629-639 (2007).
  5. Wandeler, P., Hoeck, P. E. A., Keller, L. F. Back to the future: museum specimens in population genetics. Tre Eco & Evo. 22, (12), 634-642 (2007).
  6. Rivers, M. C., Taylor, L., Brummitt, N. A., Meagher, T. R., Roberts, D. L., Lughadha, E. N. How many herbarium specimens are needed to detect threatened species? Bio Conserv. 144, (10), 2541-2547 (2011).
  7. Saltonstall, K. Cryptic invasion by a non-native genotype of the common reed, Phragmites australis, into North America. PNAS USA. 99, (4), 2445-2449 (2002).
  8. Besnard, G., et al. From museums to genomics: old herbarium specimens shed light on a C3 to C4 transition. J Exp Bot. 65, (22), 6711-6721 (2014).
  9. Särkinen, T., Staats, M., Richardson, J. E., Cowan, R. S., Bakker, F. T. How to open the treasure chest? Optimising DNA extraction from herbarium specimens. PLoS ONE. 7, (8), e43808 (2012).
  10. Harris, S. A. DNA analysis of tropical plant species: An assessment of different drying methods. Plant Syst Evo. 188, (1-2), 57-64 (1994).
  11. Staats, M., et al. DNA damage in plant herbarium tissue. PLoS ONE. 6, (12), e28448 (2011).
  12. Bakker, F. T., et al. Herbarium genomics: plastome sequence assembly from a range of herbarium specimens using an Iterative Organelle Genome Assembly pipeline. Bio J of the Linn Soc. 117, (1), 33-43 (2016).
  13. Camacho, F. J., Gernandt, D. S., Liston, A., Stone, J. K., Klein, A. S. Endophytic fungal DNA, the source of contamination in spruce needle DNA. Mol Eco. 6, (10), 983-987 (1997).
  14. Hofreiter, M., Jaenicke, V., Serre, D., Von Haeseler, A., Pääbo, S. DNA sequences from multiple amplifications reveal artifacts induced by cytosine deamination in ancient DNA. Nucl Acids Res. 29, (23), 4793-4799 (2001).
  15. Staats, M., et al. Genomic treasure troves: Complete genome sequencing of herbarium and insect museum specimens. PLoS ONE. 8, (7), e69189 (2013).
  16. Bakker, F. T. Herbarium genomics: skimming and plastomics from archival specimens. Webbia. 72, (1), 35-45 (2017).
  17. Doyle, J. J., Doyle, J. L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bul. 19, 11-15 (1987).
  18. Allen, G. C., Flores-Vergara, M. A., Krasynanski, S., Kumar, S., Thompson, W. F. A modified protocol for rapid DNA isolation from plant tissue using cetryltrimethylammonium bromide. Nat Prot. 1, 2320-2325 (2006).
  19. Twyford, A. D., Ness, R. D. Strategies for complete plastid genome seqeuncing. Mol Eco Resour. (2016).
  20. Aird, D., et al. Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries. Genome Bio. 12, (2), R18 (2011).
  21. Bolger, A. M., Lohse, M., Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinf. 30, 2114-2120 (2014).
  22. Grigoriev, I. V., et al. MycoCosm portal: gearing up for 1000 fungal genomes. Nucl Acids Res. 42, (1), D699-D704 (2014).
  23. Langmead, B., Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat Meth. 9, (4), 357-359 (2012).
  24. McKain, M. R. Herbarium Genomics. Github Repository https://github.com/mrmckain/ (2017).
  25. McKain, M. R., Wilson, M. A. Fast-Plast: Rapid de novo assembly and finishing for whole chloroplast genomes. Github Repository https://github.com/mrmckain/ (2017).
  26. McKain, M. R., McNeal, J. R., Kellar, P. R., Eguiarte, L. E., Pires, J. C., Leebens-Mack, J. Timing of rapid diversification and convergent origins of active pollination within Agavoideae (Asparagaceae). Am J Bot. 103, (10), 1717-1729 (2016).
  27. McKain, M. R., Hartsock, R. H., Wohl, M. M., Kellogg, E. A. Verdant: automated annotation, alignment, and phylogenetic analysis of whole chloroplast genomes. Bioinf. (2016).
  28. Staton, S. E., Burke, J. M. Transposome: A toolkit for annotation of transposable element families from unassembled sequence reads. Bioinf. 31, (11), 1827-1829 (2015).
  29. Bao, W., Kojima, K. K., Kohany, O. Repbase Update, a database of repetitive elements in eukaryotic genomes. Mobile DNA. 6, (1), 11 (2015).
  30. McKain, M. R. Transposons. Github Repository https://github.com/mrmckain/ (2017).
  31. Weiß, C. L., et al. Temporal patterns of damage and decay kinetics of DNA retrieved from plant herbarium specimens. Royal Soc Open Sci. 3, (6), 160239 (2016).
  32. Sawyer, S., Krause, J., Guschanski, K., Savolainen, V., Pääbo, S. Temporal patterns of nucleotide misincorporations and DNA fragmentation in ancient DNA. PLoS ONE. 7, (3), e34131 (2012).
  33. Head, S. R., et al. Library construction for next-generation sequencing: overviews and challenges. BioTechniques. 56, (2), 61-64 (2014).
  34. Grover, C. E., Salmon, A., Wendel, J. F. Targeted sequence capture as a powerful tool for evolutionary analysis. Am J Bot. 99, 312-319 (2012).

Comments

1 Comment

  1. Thanks for this video!

    Reply
    Posted by: Anony m.
    August 25, 2018 - 10:13 AM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics