Isolamento del DNA robusto e costruzione della libreria High-throughput sequenziamento per campioni di erbario

* These authors contributed equally
Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

Welcome!

Enter your email below to get your free 10 minute trial to JoVE!





We use/store this info to ensure you have proper access and that your account is secure. We may use this info to send you notifications about your account, your institutional access, and/or other related products. To learn more about our GDPR policies click here.

If you want more info regarding data storage, please contact gdpr@jove.com.

 

Summary

Questo articolo viene illustrato un protocollo dettagliato per isolamento di DNA e la costruzione della libreria sequenziamento ad alte prestazioni da materiale di erbario tra cui salvataggio di eccezionalmente scarsa qualità del DNA.

Cite this Article

Copy Citation | Download Citations

Saeidi, S., McKain, M. R., Kellogg, E. A. Robust DNA Isolation and High-throughput Sequencing Library Construction for Herbarium Specimens. J. Vis. Exp. (133), e56837, doi:10.3791/56837 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Gli erbari sono una preziosa fonte di materiale vegetale che può essere utilizzato in una varietà di studi biologici. L'uso di campioni di erbario è associato con una serie di sfide tra cui qualità di conservazione del campione, DNA degradato e campionamento distruttivo di rari esemplari. Per poter utilizzare in modo più efficace materiale di erbario in progetti di sequenziamento di grandi dimensioni, è necessario un metodo affidabile e scalabile di preparazione di isolamento e libreria di DNA. Questa carta dimostra un protocollo robusto, inizio-to-end per DNA alto-rendimento e isolamento costruzione della libreria da esemplari che non richiedono la modifica di singoli campioni. Questo protocollo è su misura per la bassa qualità secchi pianta materiale e approfitta dei metodi esistenti ottimizzando tessuto rettifica, modifica selezione dimensione biblioteca ed introducendo un passo opzionale reamplification per librerie di basso rendimento. Reamplification di librerie di basso rendimento del DNA può salvare i campioni provenienti da campioni di erbario potenzialmente preziosi e insostituibili, negando la necessità per ulteriore campionamento distruttivo e senza introdurre bias di sequenziamento discernibile per comune applicazioni filogenetiche. Il protocollo è stato testato su centinaia di specie di erba, ma dovrebbe essere adatto per l'impiego in altri lignaggi pianta dopo la verifica. Questo protocollo può essere limitato dal DNA estremamente degradato, dove non esistono frammenti nel campo dimensione desiderata, e di metaboliti secondari presenti in alcuni materiale vegetale che inibiscono pulito isolamento del DNA. Nel complesso, questo protocollo introduce un metodo veloce e completo che permette di isolamento del DNA e preparazione della biblioteca di 24 campioni in meno di 13 ore, con solo 8 h di tempo attivo hands-on con modifiche minime.

Introduction

Erbario collezioni sono una fonte potenzialmente importante di entrambe le specie e diversità genomica per studi compreso phylogenetics1,2,3, genetica delle popolazioni4,5, conservazione biologia6, specie invasive biologia7e tratto evolution8. La capacità di ottenere una ricca diversità di specie, popolazioni, luoghi geografici e punti di tempo mette in evidenza il "forziere"9 che è l'erbario. Storicamente, la natura degradata del DNA erbario-derivato ha ostacolato progetti basati su PCR, relegando spesso i ricercatori a usando solo gli indicatori trovati in alta copia, quali le regioni del genoma del cloroplasto o il distanziatore interno trascritto (ITS) della ribosomiale RNA. Qualità dei campioni e DNA variano ampiamente basata su metodi di conservazione9,10, con rotture a doppio filamento e la frammentazione da calore utilizzato nel processo di essiccazione, essendo le forme più comuni di danno, creando il cosiddetto 90% DNA di lock-up che ha gravato studi basati su PCR11. A parte la frammentazione, il problema secondo più prevalente in erbario genomica è contaminazione, come quello derivato da funghi endofiti13 o funghi acquisito post mortem dopo la raccolta, ma prima di montare nell'erbario12, però Questo problema può essere risolto bioinformatically dato il database proprio fungo (Vedi sotto). Un terzo problema, meno comune, è modifica di sequenza attraverso citosina deaminazione (C/G→T/A)14, anche se si stima essere bassa (~ 0,03%) in campioni di erbario11. Con l'avvento di sequenziatori di alto-rendimento (HTS), il problema di frammentazione può essere superato con brevi letture e sequenziamento profondità12,15, permettendo l'acquisizione di dati a livello genomico dalle numerosi esemplari con bassa qualità DNA e a volte anche permettendo di sequenziamento del genoma intero15.

I campioni di erbario stanno diventando sempre più frequentemente utilizzati e una maggiore componente di filogenetica progetti16. Una sfida attuale della utilizzando campioni di erbario per HTS è costantemente ottenere sufficiente DNA a doppia elica, un prerequisito indispensabile per protocolli di sequenziamento, da numerose specie in modo tempestivo, senza la necessità di ottimizzare i metodi per individuo esemplari. In questa carta, un protocollo per l'estrazione di DNA e preparazione di libreria di campioni di erbario è dimostrato che si avvale dei metodi esistenti e li modifica per consentire risultati veloci e replicabili. Questo metodo consente completo elaborazione da esemplare a una libreria di 24 campioni in 13 h, con tempo di preparazione manuale h 8, o 16 h, con hands-on tempo h 9, quando è richiesto il passaggio opzionale reamplification. Elaborazione simultanea di più campioni è realizzabile, anche se il fattore limitante è la capacità della centrifuga e abilità tecnica. Il protocollo è progettato per richiedere solo attrezzature tipici del laboratorio (termociclatore, centrifuga e supporti magnetici) invece di attrezzature specializzate, come un nebulizzatore o un sonicatore, per la tosatura del DNA.

Qualità del DNA, la dimensione del frammento e la quantità sono fattori per l'utilizzo di campioni di erbario a esperimenti di sequenziamento ad alta velocità limitanti. Altri metodi per isolare il DNA di erbario e creazione di librerie di sequenziamento ad alte prestazioni hanno dimostrato l'utilità dell'utilizzo di appena 10 ng di DNA16; Tuttavia hanno bisogno di determinare sperimentalmente il numero ottimale di PCR cicli necessari per la preparazione di biblioteca. Questo diventa impraticabile quando trattare con estremamente piccole quantità di vitali double stranded DNA (dsDNA), come alcuni esemplari di erbario producono solo abbastanza DNA per una preparazione unica libreria. Il metodo presentato qui utilizza un singolo numero di cicli indipendentemente dalla qualità del campione, quindi nessun DNA si perde nelle fasi di ottimizzazione biblioteca. Invece, un passo di reamplification viene richiamato quando le librerie non soddisfano gli importi minimi necessari per la sequenza. Molti campioni di erbario sono rari e possiedono poco materiale che lo rende difficile da giustificare campionamento distruttivo in molti casi. Per contrastare ciò, il protocollo presentato permette di dsDNA ingresso taglie meno di 1,25 ng nel processo di preparazione di biblioteca, ampliando l'ambito dei campioni praticabili per high throughput sequenziamento e riducendo al minimo la necessità di campionamento distruttivo degli esemplari.

Il seguente protocollo è stato ottimizzato per erbe e testato su centinaia di specie diverse dai campioni di erbario, anche se ci aspettiamo che il protocollo può essere applicato a molti altri gruppi di piante. Esso comprende un passaggio di ripristino opzionale che può essere utilizzato per salvare bassa qualità e/o rari esemplari. Questo protocollo basato su oltre duecento esemplari di erbario testati, funziona sugli esemplari con tessuto basso input e qualità, consentendo la conservazione di esemplari rari tramite campionamento distruttivo minimo. Qui è indicato che questo protocollo può fornire librerie di alta qualità che possono essere ordinati in sequenza per progetti basati su phylogenomics.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. prima di iniziare

  1. Fare fresco cetilico trimetilammonio bromuro (CTAB) buffer17 aggiungendo 20 g di CTAB, 10 g di polivinilpirrolidone (PVP) 40, 100,0 mL 1 M Tris pH 8.0, 40 mL di 0,5 M etilendiamminotetraacetico (EDTA) l'acido pH 8.0, 280,0 mL 5 M di NaCl e 400,0 mL di reagente acqua insieme e portare il volume totale a 1 L con reagente-grado dell'acqua. Regolare il pH a 8.0.
    Nota: Altri reagenti possono essere aggiunto al CTAB a seconda di composti secondari in singoli taxa. Vedere Allen et al. 18 per una lista completa dei reagenti additivi.
  2. Aggiungere 10 µ l di β-mercaptoetanolo ogni 5 mL di tampone CTAB.
    Nota: ciò può essere preparato in lotti da 50 mL e conservato a temperatura ambiente per 3 – 4 settimane.
    1. Riscaldare la soluzione CTAB in un bagno di acqua di 65 ° C.
  3. Chill mortai e pestelli a-20 ° C per almeno 20 min.
  4. Etichetta 4 set di 2 x provette 2 mL n (dove n = numero di campioni). Metti 1 set di provette in ghiaccio.
  5. Isopropanolo freddo sul ghiaccio o in un congelatore a-20 ° C.
  6. Rimuovere perline di immobilizzazione reversibile (SPRI) fase solida (Vedi Tabella materiali) dal frigo e consentire loro di stabilizzare a temperatura ambiente (almeno 30 min).
  7. Preparare 80% di etanolo.
  8. Selezionare i campioni di erbario per estrazione e recuperare ~ 1 cm2, o 10 mg, di tessuto al campione, preferibilmente materiale fogliare.

2. DNA estrazione

  1. Macinare ~ 1 cm2 di tessuto preselezionato erbario con pestelli e mortai prechilled. Aggiungere azoto liquido e sabbia di 30 – 50 mg sterilizzato. Macinare fino a quando il tessuto si trasforma in polvere fine.
    Nota: 10 mg o più tessuto è auspicabile, ma meno ha lavorato anche in alcuni casi. Una volta che l'azoto liquido evapora, aggiungerne altri se necessario fino a quando il tessuto è completamente a terra. Un altro metodo comune per interrompere le cellule ed i tessuti è l'uso di un battitore di tallone. Tuttavia, questo metodo è stato trovato per non funzionano bene per gli esemplari utilizzati in questi esperimenti.
  2. Trasferire la polvere gelata in due provette da 2 mL (aggiungere non più di metà del volume del tubo). Aggiungere 600 µ l di soluzione CTAB calda ad ogni provetta e mescolare i tubi approfonditamente da inversione e Vortex.
    Nota: Poiché la quantità e la qualità del materiale di erbario è spesso basso, esecuzione di isolamento del DNA in due ripetizioni consente di ottenere rendimenti più alti.
  3. Incubare i campioni in un bagno di acqua di 65 ° C per 1 – 1,5 h, Vortex ogni 15 min.
  4. Centrifugare i campioni a 10.000 x g per 5 min. trasferire il surnatante in una nuova serie di provette (~ 500 µ l). Scartare il pellet utilizzando una procedura standard smaltimento non clorurati.
  5. Aggiungere 4 µ l di RNasi-A (10 mg/mL) ad ogni provetta e mescolare capovolgendo o pipettaggio. Incubare i campioni a 37 ° C in un bagno di acqua o blocco di calore per 15 min.
  6. Aggiungere un volume equivalente (~ 500 µ l) di una miscela di alcol fenolo: cloroformio: isoamyl 25:24:1 una volta che i tubi hanno raggiunto la temperatura ambiente. Mescolare accuratamente pipettando su e giù e/o con inversione. Centrifugare le provette a 12.000 x g per 15 min trasferimento lo strato acquoso (strato superiore) per una nuova serie di provette (~ 400 µ l). Eliminare lo strato organico in un contenitore per rifiuti clorurato.
    Nota: Passaggio 2.6 può essere ripetuto se grandi quantità di composti secondari sono attesi in materiale vegetale.
  7. Aggiungere un volume equivalente (~ 400 µ l) di una miscela di alcool di 24:1 cloroformio: isoamilico. Mescolare accuratamente pipettando su e giù e/o con inversione. Centrifugare le provette a 12.000 x g per 15 min trasferimento lo strato acquoso (strato superiore) per una nuova serie di tubi prechilled, etichettati (~ 300 µ l). Eliminare lo strato organico in un contenitore per rifiuti clorurato.
  8. Aggiungere un volume equivalente (~ 300 µ l) di isopropanolo prechilled e 12 µ l di acetato di sodio 2,5 M per ogni tubo. Incubare i campioni a-20 ° C per 30 – 60 min.
    Nota: I tempi di incubazione possono essere esteso (fino a incubazione durante la notte), ma la qualità del DNA diminuirà più Incubare i campioni.
  9. Prelevare i campioni fuori dal congelatore e centrifugare le provette a 12.000 x g per 15 min. rimuovere e scartare il surnatante delicatamente senza disturbare il pellet. Lavare la pallina da sospensione con etanolo al 70% (circa 300 – 500 µ l). Per ogni campione raddoppiato, consolidare le due palline individuali in uno con l'accompagnamento dell'etanolo.
    Nota: I campioni dovrebbero essere consolidati in un tubo utilizzando etanolo prima e poi procedere. Non è necessario lavare separatamente ciascun campione con etanolo.
  10. Centrifugare le provette a 12.000 x g per 10 min. rimuovere e scartare il surnatante delicatamente senza disturbare il pellet. Asciugare all'aria il pellet.
    Nota: I campioni possono essere essiccati più velocemente utilizzando un blocco a calore secco (non superare i 65 ° C). Assicurarsi che i campioni non asciugano troppo, come questo può ridurre la resa finale del DNA.
  11. Sospendere il DNA isolato in 50 µ l di 1 x TE. Conservare in freezer per stoccaggio a lungo termine-20 ° C o 4 ° C per uso nella settimana successiva.

3. controllo di qualità (QC)

  1. Eseguire un gel di agarosio per controllo di qualità.
    1. Preparare un tampone Tris/Borato/EDTA (TBE) 1x aggiungendo 54g Tris base, 27,5 g di acido borico e 3,75 g EDTA sale disodico, portando il volume totale a 5 L, utilizzando acqua di grado reagente.
    2. Preparare un gel di agarosio 1% con l'aggiunta di agarosio 1 g per 100 mL di 1 x TBE. Forno a microonde la soluzione fino a quando non dell'agarosi sono visibile. Aggiungi 0,01% gel di acido nucleico macchia (Vedi Tabella materiali). Lasciare raffreddare il pallone fino a quando è caldo al tatto. Mescolare bene per agitazione. Versarvi un cassetto del gel dell'agarosi e lasciate riposare fino a quando non si solidifica.
    3. Mix 3 µ l di campione, 2 µ l di acqua di grado reagente e 1 µ l di 6x loading dye. Caricare i campioni nella matrice del gel, notando il loro ordine.
    4. Eseguire gli esempi per 60 – 70 min a 60 – 70 V. immagine il gel luce UV con messa a fuoco e l'esposizione corretta.
      Nota: Presenza di una banda chiara ad alto peso molecolare è un segno di alta qualità del DNA, mentre le sbavature di solito indicano degradazione del DNA. Maggior parte degli esemplari di erbario sono degradata.
  2. Eseguire un'analisi di quantificazione di dsDNA (Vedi tabella materiali) per determinare la quantità di doppio DNA incagliato.
    1. Utilizzare 2 µ l di campione per l'analisi.
      Nota: Diluizioni non sono necessari per l'analisi di quantificazione del materiale di erbario come essi tendono ad essere in quantità minime. Librerie di successo sono state effettuate da appena 1.26 ng totale dsDNA da questo passaggio.

4. DNA tosatura

Nota: Questa è una versione ottimizzata di un fragmentase doppio filamento commerciale protocollo (Vedi Tabella materiali).

  1. Enzima di frammentazione di dsDNA posto sul ghiaccio dopo Vortex per 3 s.
  2. In un tubo di reazione a catena (PCR) polimerasi sterile 0,2 mL, mix 1 – 16 µ l DNA isolato con 2 µ l di tampone di reazione di frammentazione di accompagnamento. Portare il volume totale a 18 µ l con l'aggiunta di acqua gratuita nucleasi. Aggiungere 2 µ l di enzima di frammentazione di dsDNA e vortice la miscela per 3 s.
    Nota: La quantità di DNA necessaria varia a seconda della concentrazione di DNA (obiettivo per 200 totali ng nel tubo).
  3. Incubare i campioni a 37 ° C per 8,5 min. Quindi aggiungere 5 µ l di EDTA 0.5 M per i tubi.
    Nota: Questo passaggio deve essere eseguita, non appena il periodo di incubazione è finita per terminare la reazione e impedire l'over-tosatura di campioni di DNA.

5. bead Clean-up

  1. Omogeneizzare i branelli SPRI nel Vortex.
  2. Portare il volume totale del DNA tranciato a 50 µ l aggiungendo 25 µ l di acqua gratuita nucleasi. Aggiungere 45 µ l di perle di temperatura SPRI (90% del volume) a 50 µ l di DNA tranciate e mescolare accuratamente pipettando su e giù.
    Nota: L'aggiunta di perline al 90% del volume totale del campione viene eseguita per rimuovere il più piccolo dei frammenti di DNA, spesso di sotto di 200 paia di basi.
  3. Lasciare Incubare i campioni per 5 min. mettere i tubi su una piastra magnetica e lasciarli riposare per 5 min. con attenzione rimuovere e scartare il surnatante.
    Nota: Fare attenzione per non disturbare le perle, poiché contengono gli obiettivi desiderati di DNA.
  4. Aggiungere 200 µ l di etanolo al 80% per i tubi mentre su supporto magnetico. Incubare a temperatura ambiente per 30 s e quindi attentamente rimuovere e scartare il surnatante. Ripetere questo passaggio una volta. Asciugare all'aria le perline per 5 min mentre il tubo è lo stand magnetico con il coperchio aperto.
    Nota: Evitare sovra le perline. Questo può provocare il recupero inferiore del DNA.
  5. Rimuovere i tubi dal magnete. Eluire il DNA dalle perle in 55 µ l di 0.1 x TE e mescolare accuratamente pipettando su e giù. Incubare a temperatura ambiente per 5 min. tubi di posto sul supporto magnetico e attendere che la soluzione al girare chiaro (~ 2 min).
  6. Tirare fuori 52 µ l del surnatante. Eseguire un'analisi di quantificazione del DNA sui campioni per verificare il recupero e la concentrazione iniziale che va nella preparazione di biblioteca.
    Nota: Le librerie sono state fatte con dsDNA totale stimato a meno di 1,25 ng, però in ogni caso reamplification è stato richiesto.

6. Biblioteca preparazione

Nota: Questa è una versione modificata di un kit disponibile in commercio biblioteca (Vedi Tabella materiali protocollo).

  1. Fine Prep
    1. Aggiungere 3 µ l di endonucleasi e fosfato tailing enzimi e 7 µ l di tampone di reazione di accompagnamento a 50 µ l di DNA pulito, tranciato. Mescolare accuratamente pipettando su e giù. Girare i tubi per rimuovere le bolle.
      Nota: Il volume totale dovrebbe essere 60 µ l.
    2. Posizionare i campioni in un termociclatore con il seguente programma: 30 min a 20 ° C, 30 min a 65 ° C, quindi tenere a 4 ° C.
      Nota: Il coperchio riscaldato è stato impostato su ≥ 75 ° C
  2. Adattatore legatura
    1. Diluire l'adattatore 25 – 50 volte (lavorare concentrazione adattatore di 0,6 – 0,3 µM). Aggiungere 30 µ l di mix master legatura, 1 µ l di potenziatore della legatura e 2,5 µ l di adattatore per la sequenza di lettura breve ad alta produttività per i tubi.
      Nota: Il volume totale dovrebbe essere 93,5 µ l.
    2. Mescolare accuratamente pipettando su e giù. Girare i tubi per rimuovere le bolle. Incubare le provette a 20 ° C per 15 min.
    3. 3 µ l di miscela commerciale di uracile DNA glicosilasi (UDG) e il VIII endonucleasi di DNA glicosilasi-liasi (Vedi Tabella materiali) ai tubi. Assicurarsi che il volume totale è di 96,5 µ l. mescolare accuratamente e incubare a 37 ° C per 15 min utilizzando un termociclatore.
      Nota: Il coperchio deve essere impostato su ≥47 ° C. La versione originale del protocollo commerciale ha dimensioni selezione dopo la fase di legatura di adattatore, seguita da una pulizia della perla come il passaggio finale. Questo protocollo, che consente di ottenere rendimenti più elevati, passa l'ordine di questi passaggi e implementa la selezione della dimensione come un passaggio finale.
  3. Pulitura per rimuovere gli enzimi e piccoli frammenti
    1. Omogeneizzare biglie magnetiche nel Vortex.
    2. Aggiungere 78 µ l di biglie magnetiche SPRI (80% del volume) e mescolare accuratamente pipettando su e giù.
      Nota: L'aggiunta di perline all'80% del volume totale del campione viene eseguita per rimuovere i frammenti di DNA più piccoli, che spesso sono più corte di 250 paia di basi. La rimozione più rigorosa di piccoli frammenti di DNA è (i) rimuovere eccedenze adattatori e (ii) sottolineare l'amplificazione di frammenti più grandi nei passaggi seguenti.
    3. Lasciare che incubare i campioni per 5 min, mettere i tubi su una piastra magnetica per 5 min, attentamente rimuovere e scartare il surnatante contenente il DNA esterno all'intervallo di dimensione desiderata.
      Nota: Fare attenzione a non disturbare le perline che contengono gli obiettivi desiderati di DNA.
    4. Aggiungere 200 µ l di etanolo al 80% per i tubi mentre su supporto magnetico. Incubare a temperatura ambiente per 30 s e quindi attentamente rimuovere e scartare il surnatante. Ripetere questo passaggio una volta. Asciugare all'aria le perline per 5 min mentre il tubo è lo stand magnetico con il coperchio aperto.
      Nota: Evitare l'eccessivo essiccamento le perline. Questo può provocare il recupero inferiore del DNA.
    5. Rimuovere i tubi dal magnete. Eluire il DNA bersaglio dalle perle aggiungendo 17 µ l di 0.1 x TE e mescolare accuratamente pipettando su e giù.
    6. Incubare a temperatura ambiente per 5 min. tubi di posto sul supporto magnetico e attendere che la soluzione al girare chiaro (~ 2 min).
    7. Tirare fuori 15 µ l del surnatante.
  4. Amplificazione di PCR
    1. Aggiungere 25 µ l di mix master di PCR ad alta fedeltà, 5 µ l di alto-rendimento breve lettura libreria prep 5' primer di sequenziamento e 5 µ l di alto-rendimento breve lettura sequenziamento libreria preparazione 3' primer, a 15 µ l di DNA adattatore-legati pulito.
      Nota: Il volume totale dovrebbe essere 50 µ l.
    2. Mescolare bene su Vortex. Inserire i campioni in un termociclatore usando le impostazioni si trovano nella tabella 1: impostazione di amplificazione del termociclatore.
      Nota: Un gran numero di cicli è necessario a causa della bassa quantità di DNA ingresso.
Passaggio di ciclo Temp. Tempo Cicli
Denaturazione iniziale 98 ° C 30 s 1
Denaturazione 98 ° C 10 s 12
Ricottura/estensione 65 ° C 75 s 12
Estensione finale 65 ° C 5 min 1
Tenere premuto 4 ° C

Tabella 1: protocollo PCR temperature e tempi di denaturazione, ricottura ed estensione. Temperatura e tempi sono state ottimizzate per i reagenti presentati in questo protocollo. Se i reagenti sono alterati, temperature e tempi dovrebbero essere ottimizzati nuovamente.

  1. Selezione della dimensione per la dimensione desiderata biblioteca
    Nota: Questo passaggio perlina rimuoverà frammenti sia sopra che sotto l'intervallo di destinazione.
    1. Omogeneizzare perline SPRI nel Vortex.
    2. Aggiungere 25 µ l (50% del volume) di biglie magnetiche temperatura ambiente e mescolare accuratamente pipettando su e giù. Lasciare Incubare i campioni per 5 min. mettere i tubi su una piastra magnetica e lasciarli riposare per 5 min. con attenzione rimuovere e trasferire il surnatante in un nuovo set di provette.
      Nota: Questo volume può essere regolato sulla base dimensioni libreria desiderata. Il surnatante contiene frammenti di DNA della dimensione desiderata. Nella prima incubazione del branello, le perle sono vincolanti frammenti più grandi di biblioteca. Questi sono rimossi per concentrarsi su quelle nella gamma 400-600 paia di basi. Il surnatante contiene frammenti più piccoli.
    3. Aggiungere 6 µ l di perline SPRI temperatura surnatante e mescolare accuratamente pipettando su e giù. Lasciare che incubare i campioni per 5 min. mettere i tubi su una piastra magnetica e lasciarli riposare per 5 min.
      Nota: Questo volume può essere regolato sulla base biblioteca desiderata dimensioni secondo passo 6.5.2.
    4. Rimuovere con cautela e scartare il surnatante.
      Nota: Fare attenzione a non disturbare le perline che contengono il DNA desiderato. Nella seconda incubazione perlina, le perle sono vincolanti per i frammenti a sinistra dopo la rimozione iniziale del DNA più grande frammenti. Questo insieme di frammenti è solitamente nella gamma dimensione desiderata.
    5. Aggiungere 200 µ l di etanolo al 80% per i tubi mentre su supporto magnetico. Incubare a temperatura ambiente per 30 s, quindi rimuovere con cautela e scartare il surnatante. Ripetere l'operazione. Asciugare all'aria le perline per 5 min mentre il tubo è lo stand magnetico con il coperchio aperto.
      Nota: Evitare sovra le perline. Questo può provocare il recupero inferiore del DNA.
    6. Rimuovere i tubi dal magnete. Eluire il DNA bersaglio dalle perle in 33 µ l di 0.1 x TE e mescolare accuratamente pipettando su e giù.
    7. Incubare a temperatura ambiente per 5 min. tubi di posto sul supporto magnetico e attendere che la soluzione al girare chiaro (~ 2 min). Tirare fuori 30 µ l del surnatante e trasferimento per provette da 2 mL (Vedi Tabella materiali) per l'archiviazione.
      Nota: Le librerie possono essere tenute a-20 ˚ c per la conservazione a lungo termine.
  2. Controllo di qualità
    1. Eseguire un test di controllo qualità sulle librerie di DNA. Fare riferimento ai punti 3.1 e 3.2.
      Nota: Per le librerie di DNA, eseguire il gel per ~ 45 min a 96 V.
  3. Reamplification biblioteca: opzionale se libreria quantità non è sufficiente.
    Nota: I campioni con concentrazioni di libreria inferiore a 10 nM può essere riamplificati attenendosi alla seguente procedura. Reamplification delle librerie di bassa concentrazione può raggiungere risultati praticabile per la sequenza, ma reamplification possono causare uno spostamento modesto nella diversità di composizione base, anche se raccolti dati (tabella 3) suggeriscono che questo è irrilevante per determinate metriche .
    1. Diluire i primer universale reamplification 10 volte utilizzando 0.1 x TE.
    2. Aggiungere 25 µ l di mix master di PCR ad alta fedeltà, 5 µ l di primer diluito universale reamplification 1 (AATGATACGGCGACCACCGA) e 5 µ l di primer diluito universale reamplification 2 (CAAGCAGAAGACGGCATACGA) a 15 µ l di librerie di bassa concentrazione. Nota: Il volume totale dovrebbe essere a 50 µ l.
    3. Mescolare bene su Vortex. Inserire i campioni in un termociclatore usando le impostazioni si trovano nella tabella 1: impostazione di amplificazione del termociclatore
      Nota: Il gran numero di cicli è necessario a causa della scarsa quantità di DNA input.
    4. Pulitura della perla
    5. Omogeneizzare perline SPRI nel Vortex. 45 µ l di perle di temperatura SPRI (90% del volume) e mescolare accuratamente pipettando su e giù.
    6. Lasciate che i campioni Incubare per 5 minuti, mettere i tubi su una piastra magnetica per 5 min.
    7. Rimuovere con cautela e scartare il supernatante contenente il DNA indesiderato.
      Nota: Fare attenzione a non disturbare le perline che contengono gli obiettivi desiderati di DNA.
    8. Aggiungere 200 µ l di etanolo al 80% per i tubi mentre su supporto magnetico. Incubare a temperatura ambiente per 30 s e quindi con attenzione rimuovere e scartare il surnatante. Ripetere questo passaggio una volta.
    9. Asciugare all'aria le perline per 5 min mentre il tubo è lo stand magnetico con il coperchio aperto.
      Nota: Evitare sovra le perline. Questo può provocare il recupero inferiore del DNA bersaglio.
    10. Rimuovere i tubi dal magnete. Eluire il DNA bersaglio dalle perle in 33 µ l di 0.1 x TE e mescolare accuratamente pipettando su e giù.
    11. Incubare a temperatura ambiente per 5 min. tubi di posto sul supporto magnetico e attendere che la soluzione al girare chiaro (~ 2 min).
    12. Tirare fuori 30 µ l del surnatante. Le librerie possono essere memorizzate a-20 ° C per la conservazione a lungo termine.
  4. Controllo di qualità
    1. Eseguire un test di controllo qualità sulle librerie di DNA. Fare riferimento ai punti 3.1 e 3.2. Per le librerie di DNA, è possibile eseguire il gel per ~ 45 min a 96 V.
      Nota: Se una doppia fascia è visto nel gel, questo è probabilmente una conseguenza dell'esaurimento di primer dal passo di reamplification. Le bande possono essere rimossi ripetendo 6.9, ma utilizzando solo un ciclo nel programma di PCR descritto in tabella 1.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Isolamento del DNA e la resa finale biblioteca
In questo studio, l'efficacia del protocollo per l'isolamento del DNA di erbario e al recupero delle librerie di sequenziamento di alta qualità è stata dimostrata utilizzando cinquanta diversi campioni con la più antica dal 1920 e il più giovane dal 2012 (tabella 2). Per ogni campione, circa 10 mg di tessuto fogliare è stato usato per isolamento del DNA. Più verde tessuto fogliare è stato favorito se disponibile, ed è stato selezionato nessun tessuto con evidente contaminazione fungina. Gli isolamenti di successo possono avvenire utilizzando tessuto giallo o marrone, anche se resa deve essere dovrebbe essere inferiore. Totale double stranded DNA (dsDNA) dall'isolamento iniziale ha variato da 3,56 ng a 2.610 ng. Come previsto, il DNA ottenuto da campioni di erbario è stato altamente degradato (Figura 1A, Supplemental Figura 1). Una porzione di questi isolamenti sono stati utilizzati per la tosatura enzimatica (GN 1,26-464). Anche se erbario DNA è già Tosato attraverso il processo di conservazione, ottimizzazione del protocollo richiede tosatura aggiuntive per migliorare la resa complessiva biblioteca. Il recupero totale del dsDNA post-tosatura ha variato da < 1% al 51% di ingresso dsDNA, risultante in un minimo di meno di 1,25 ng di DNA di partenza per preparazione di biblioteca e di un massimo di 328 ng. La perdita estrema di DNA in alcuni campioni può essere attribuita alla dimensione già piccolo frammento di gran parte del DNA prima enzimatica taglio (Figura 1A, supplementare nella figura 1). L'utilizzo di una pulitura del branello di 90% del volume sul DNA tranciata volutamente rimosso i più piccoli frammenti di DNA per arricchire per taglie più grandi, più desiderabile frammento. Questi piccoli frammenti sono stati veduti soprattutto nei campioni TK463, TK657 e TK694, come indicato da un segnale intenso al contrassegno 100 coppie di basi (Figura 1A).

La quantità totale della selezione della dimensione post biblioteca ha variato da 1.425 ng a 942.5 ng (tabella 2, supplementare tabella 1). Per 23 dei campioni, la preparazione iniziale di estrazione e raccolta non ha dato una quantità adeguata di biblioteca (< 10 nM; Tabella 2, supplementare tabella 1), quindi questi campioni sono stati sottoposti alla procedura reamplification e recupero del protocollo, risultante in un 14 – 680 x aumentare nella libreria totale (tabella 2, supplementare tabella 1). Librerie di finale è provocato da una banda tra 350 e 500 paia di basi (Figura 1B, Supplemental Figura 2). A volte, è stato visto una seconda band che era più grande rispetto alla dimensione di biblioteca previsto (Figura 1B, Supplemental Figura 2). Questo si è verificato quando il reamplification PCR esaurito disponibile primer e cominciò adattatori libreria di frammenti di DNA non-omologo di ricottura. Questo crea una molecola dove le estremità (gli adattatori di rete) sono state correttamente ricottura, ma non ha fatto l'inserto di DNA. Questa molecola "gorgogliare" sembrava più grande su un gel, mentre si è mosso più lentamente attraverso la matrice di gel. Questi errori di ricottura sono stati risolti preparando un'altra reazione di reamplification dalla libreria già reamplified e in esecuzione per un singolo ciclo. Questo ciclo unico previste primer adeguato ricottura e amplificazione, rimuovendo la seconda banda (Supplemental figura 3).

Reamplification delle biblioteche ha facilitato le concentrazioni di raccolta finale di almeno 10 nM. Queste concentrazioni ammessi librerie per essere diluito per uguale molarità e riunita in rappresentanza paritaria, contribuendo a negare i problemi che sarebbero sorti con qualità disuguale del campione e sequenziamento resa libreria. Se l'obiettivo di un progetto è il genoma del cloroplasto sequenziamento, quindi la quantità totale di sequenziamento necessaria varierà come diversi lignaggi e tessuti si differenziano per la percentuale totale di letture che provengono da cloroplasto DNA19. In genere, 50 – 100 x copertura proiettata del genoma del cloroplasto è sufficiente per il montaggio, e viene eseguito l'ordinamento può essere pool per includere oltre 70 individui a seconda della specie e del metodo di sequenziamento.

Test di contaminazione, Bias e variazione causata da Reamplification
Una notevole preoccupazione per il sequenziamento di HTS è introduzione di bias in librerie attraverso vaste di amplificazione di PCR20. Per verificare gli effetti della reamplification e identificare potenziali bias in comune filogenetiche applicazioni del materiale di erbario, abbiamo confrontato una biblioteca con successo in sequenza (TK686) con la stessa libreria diluito 1:5 e riamplificati (designato TK686-R). Sia TK686 e TK686-R sono stati sequenziati su un'Illumina HiSeq4000 presso il centro di biotecnologie dell'Università di Illinois Roy J. Carver e Michigan State University Research Technology supporto Facility, rispettivamente, utilizzando 150 coppie di basi accoppiate fine legge (Vedi Tabella 3 per i dettagli di sequenziamento). RAW letture sono state depositate nella NCBI SRA (SRP128083). Letture venivano pulite utilizzando Trimmomatic v.0.3621 compresi guarnizione adattatore utilizzando NEB adattatore sequenza, qualità di filtraggio per un punteggio di phred medio di 20 per un paio di base 10 finestra scorrevole, e un minimo tagliato con dimensioni di 40 paia di basi. Come uno dei principali problemi con esemplari di erbario è la contaminazione fungina, la contaminazione è stata stimata mappando letture contro una porzione del JGI MycoCosm fungine genome database22 (312 genomi nucleari e 79 genomi mitocondriali) utilizzando bowtie2 v . 2.2.923 utilizzando il set di parametri "molto sensibile-locale". Librerie TK686 e TK686-R erano indistinguibili nella contaminazione fungina nucleare (9,24% e 9.68%, rispettivamente) e la contaminazione fungina mitocondriale (0,94% e 0,8%) (Tabella 3). Anche se questo è solo un esempio, suggerisce che la contaminazione fungina di campioni di erbario non è trascurabile e deve essere rimosso prima di utilizzare i dati di sequenza erbario-derivato. Il database e i comandi utilizzati per identificare e rimuovere la contaminazione fungina possono essere trovati nel repository di GitHub di M. R. McKain erbario genomica24.

Sequenziamento del genoma di cloroplasto è comunemente usato per le analisi filogenetiche ed Erbario esemplari sono sempre più usati come fonte del materiale12. Al fine di verificare la fedeltà del reamplification all'Assemblea di genoma del cloroplasto, genomi cloroplasto per TK686 e TK686-R sono stati assemblati utilizzando Fast-Plast v.1.2.525 impostazioni predefinite con l'indice di bowtie impostata su Poales. Un genoma completo cloroplasto è stato ottenuto per TK686-R, ma il genoma del cloroplasto di TK686 è stato assemblato in sette contigs grazie alla profondità di lettura inferiore. Il contigs di TK686 sono stati assemblati manualmente seguendo McKain et al. 26 completamente assemblato cloroplasto genomi sono stati allineati a vicenda in un software GUI-ha basato l'allineamento (Vedi Tabella materiali) ed è stata valutata la variazione tra gli assembly. Un totale di 12 SNPs e uno indel sono stati identificati tra gli assembly cloroplasto per TK686 e TK686-R. Per ogni variante, la copertura è stata valutata in lettura set da sia TK686 e TK686-R. In tutti i casi, la variante più comune era la stessa fra le due biblioteche. TK686 ha dimostrato uno T→C, uno G→A, uno G→T, uno G→-, uno C→A, uno T→A e quattro C→A varianti. Cinque di queste varianti si sono presentati all'interno di una stringa di omopolimero, suggerendo che loro incorporazione nell'assembly potrebbe essere stato il risultato di errore di sequenziamento e bassa copertura complessiva. Gli altri possono essere stati il risultato della variazione di aplotipo del cloroplasto, errore di sequenziamento o deaminazione della citosina, o una combinazione di questi fattori. TK686-R aveva un C→T, un G→T e un A→G. Le varianti C→T e G→T sono state trovate in un omopolimero come sopra. In definitiva, genoma identico cloroplasto completo sono stati identificati da entrambi i set di lettura. Un genoma del cloroplasto singola da TK686 è stato annotato utilizzando verdeggiante21 e rispetto agli altri membri della tribù Andropogoneae. Tutte le caratteristiche standard del cloroplasto sono state annotate: i 8 rRNAs, 38 tRNAs e 84 geni codificanti proteine. Il genoma del cloroplasto completa è disponibile da GenBank (MF170217) e verdeggiante27.

Potenziali bias dal reamplification delle librerie inoltre è stato determinato attraverso la stima della percentuale di GC e contenuto totale stimato trasposoni. Percentuale GC è stata stimata utilizzando un script personalizzato24. Differenze nel contenuto di GC dei due campioni erano trascurabili, con 49,7% GC in TK686 e 51,2% GC in TK686-R. Composizione del trasposone è stata stimata utilizzando Transposome28. Per entrambe le librerie, 100.000 letture erano casualmente subsampled e composizione trasposone è stata stimata utilizzando un'identità delle percentuali di 90, una copertura di frazione di 0,55, una dimensione di cluster di 100, e impostata il riferimento di ripetere erba RepBase 21.1029. Questo è stato ripetuto 100 volte per eseguire l'avvio automatico sulla stima del trasposone da questi set di dati. Percentuali del genoma totale per sottofamiglie principali dei trasposoni sono stati estratti dall'output di Transposome, e la media e la deviazione standard di questi per la replica di 100 sono stati stimati. Tutti gli script utilizzati per generare queste uscite sono disponibili nel repository di Github di M. R. McKain trasposoni30, e tutti i risultati sono stati depositati in Driade (doi:10.5061/dryad.r8t2m). Utilizzando le due sottofamiglie di trasposoni più prevalente come indicatori (terminale lungoCopia e Gypsy ripetere retrotrasposoni), i risultati erano quasi identici con Copia al 33,52 ± 4,00% e 31,68 ± 2.94% e Gypsy a ± 24.83 2,72% e ± 24.00 2,35% in TK686 e TK686-R, rispettivamente (tabella 3). I risultati del test indicano che il passo di reamplification di questo protocollo non ha creato il bias di sequenziamento significativo per metriche di genoma ad alto livello. Tuttavia, dovrebbe essere notato che questo singolo esempio potrebbe non essere pienamente rappresentativo di tutte le librerie reamplified. Questo singolo test dimostra che il passo di reamplification non era intrinsecamente polarizzazione metriche di genoma in TK686/TK686-R. Bias introdotto non pregiudicherebbe l'assemblaggio di un dato sufficiente copertura del sequenziamento del genoma di cloroplasto, ma è consigliabile che, come presentato in questo studio con TK686/TK686-R, vengono condotti esperimenti lignaggi di destinazione per verificare che il bias non è che si verificano durante gli studi che studiano diversità elemento trasponibile.

Figure 1
Figura 1: immagini di gel di agarosio di A) B) finale sequenziamento librerie da dieci esemplari e isolamento del DNA. Per ogni corsia, è stato usato 3 µ l di DNA o libreria. (A) DNA è stato degradato in tutti gli isolamenti di erbario visto dallo striscio generale. Librerie di sequenziamento finale (B) raffigurano una banda primaria di 300-500 coppie di basi con una distribuzione più ampia di 200-1.000 paia di basi; quest'ultimo è più prevalente nelle librerie riamplificate. Corsie per entrambi (A) e (B) sono state identificate dal campione e può essere paragonato ai risultati in tabella 2. Dimensioni di scala è stato raffigurato in coppie di basi (bp). Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2 : Trama circolare del Schizachyrium scoparium (TK686) il genoma cloroplasto con annotazione. Il genoma completamente assemblato dal sequenziamento shotgun di erbario-derivati del DNA hanno esibito una lunghezza totale di 139.296 coppie di basi (bp), una regione di grande singola copia (LSC) di 81.401 bp, una regione di ripetizione invertita (IR) di 22.669 bp e una regione piccola copia singola (SSC) di 12.557 BP. Tutti i geni di proteina-codificazione standard, tRNA e rRNA per i membri della tribù Andropogoneae sono stati identificati nell'annotazione. Clicca qui per visualizzare una versione più grande di questa figura.

Tabella 2: Risultati di preparazione di estrazione e Biblioteca del DNA per dieci campioni di erbario e quattro biblioteche riamplificati. Il totale DNA a doppio filamento in vari passi nel protocollo può essere dimostrata come variabile qualità, soprattutto quando filtrata per dimensione. Per favore clicca qui per scaricare questa tabella.

Tabella 3: sequenziamento statistiche per TK686 e il TK686R reamplified. Reamplification non influenza l'incidenza complessiva di contaminazione fungina genoma, stima contenuto GC, stima composizione trasposoni o la capacità di assemblare genomi interi cloroplasto. Per favore clicca qui per scaricare questa tabella.

Supplementare tabella 1: risultati di preparazione di estrazione e raccolta del DNA per quaranta campioni di erbario aggiuntive, incluse le librerie riamplificate venti. Totale DNA a doppio filamento in vari passi nel protocollo può essere dimostrata come variabile qualità, soprattutto quando filtrata per dimensione. Per favore clicca qui per scaricare questa tabella.

Supplementare figura 1: immagini di gel di agarosio di quaranta ulteriori isolamenti di DNA da campioni di erbario. Entrambi (A) e (B) raffigurano venti isolamenti di DNA separati e dimostrare la degradazione caratteristica del DNA erbario-derivato. Per ogni corsia, 3 µ l di DNA è stato usato. Corsie per entrambi (A) e (B) sono state identificate dal campione e può essere paragonato ai risultati in supplementare nella tabella 1. Dimensioni di scala sono raffigurato in coppie di basi (bp). Bianco macchie sull'immagine sono dovuti a manufatti in gel riproduttore d'immagini che non potrebbero essere rimossi con la pulizia. Per favore clicca qui per scaricare questa figura.

Supplementare nella figura 2: immagini di gel di agarosio delle quaranta raccolte ulteriori sequenziamento DNA derivato erbario. Per ogni corsia, è stato usato 3 µ l di biblioteca. Librerie di sequenziamento finale si trovano in entrambi (A) e (B) con una dimensione media di 300-500 coppie di basi. Secondarie bande visto in alcuni campioni amplificati suggeriscono "bubbling" delle biblioteche. Corsie per entrambi (A) e (B) sono identificati da campione e può essere paragonato ai risultati in supplementare nella tabella 1. Dimensioni di scala sono raffigurato in coppie di basi (bp). Per favore clicca qui per scaricare questa figura.

Supplementare nella figura 3: immagine di gel di agarosio di rimozione del bendaggio secondario con un passo di ulteriori unico ciclo PCR. Per favore clicca qui per scaricare questa figura.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Il protocollo presentato qui è un metodo completo e robusto per isolamento del DNA e sequenziamento preparazione libreria dagli esemplari di piante essiccate. La consistenza del metodo e minima necessità di modificarla basata su esemplare qualità rendono esso scalabile per progetti di grande erbario di sequenziamento. L'inclusione di un passo opzionale reamplification per librerie di basso rendimento permette l'inclusione di bassa qualità, quantità di basso, rara o storicamente importanti campioni che altrimenti non sarebbe adatti per il sequenziamento.

Importanza di rendimento iniziale del DNA
DNA erbario-derivato è spesso degradato in conseguenza di conservazione dei campioni iniziali11, con il DNA degli esemplari meno di 300 anni vecchia essendo come degradata come DNA isolato dai resti di animali che sono diverse centinaia di migliaia di anni31 , 32. di conseguenza, ottimizzazione del rendimento del DNA iniziale è fondamentale nell'ottenere abbastanza dsDNA di alta qualità per la preparazione di biblioteca di sequenziamento di successo. Per una specie di erba, un rendimento ottimo si ottiene attraverso l'uso combinato di sabbia sterilizzata e azoto liquido nella rettifica iniziale passo, fornendo una più completa distruzione delle pareti cellulari e rilascio degli acidi nucleici. Questo approccio aumenta dsDNA più desiderabile e indesiderabili frammenti più piccoli (Figura 1, supplementare nella figura 1, tabella 2, supplementare tabella 1). Fasi di lavaggio successivi tallone isolare e arricchiscono di frammenti di una dimensione appropriata per sequenziamento (300-500 coppie di basi), riducendo notevolmente il recupero ma anche arricchendo per frammenti più lunghi (tabella 2, supplementare tabella 1). Modifiche alla procedura di isolamento del DNA iniziale possono essere necessari basato sul lignaggio campionato al fine di ridurre gli effetti dei metaboliti secondari sulla lavorazione a valle18.

Ottimizzazione di libreria adattatori
La concentrazione di adattatori utilizzati per la legatura ha un effetto diretto sulla quantità di dimero adattatore nelle librerie finite. Adattatore dimeri derivano da auto-legatura adattatore quando campione insufficiente è presente e contaminano l'ordinamento viene eseguito33. Il dsDNA totale relativamente basso disponibile da campioni di erbario necessita diluizione di adattatori prima della legatura. Gli adattatori possono essere diluiti 50 dalla concentrazione stock di 15 µM (Vedi Sezione protocollo) preparazione di alto-rendimento biblioteca facilitando senza la necessità di misurare individualmente e di diluire adattatore per ogni campione (tabella 2, tabella supplementare 1). anche se la saturazione di adattatori poteva diminuire, in linea di principio, resa complessiva biblioteca, è improbabile che i campioni di erbario produrrà dsDNA in tale eccesso dell'adattatore.

Variazione in passaggi di pulizia per rendimenti più elevati Bead
Selezione della dimensione in preparazione delle librerie di sequenziamento di solito è fatto dopo la legatura adattatore, che permette per l'amplificazione di frammenti principalmente all'interno della gamma di dimensione desiderata; Questo viene fatto rimuovendo frammenti che sono grandi e piccole rispetto alle dimensioni di destinazione. La bassa quantità di dsDNA erbario-derivati per la preparazione di biblioteca è aggravata dopo la selezione della dimensione in questa fase, con conseguente dsDNA totale troppo bassa e, in definitiva, bassa resa nella raccolta finale. Effettuando un passo cordone-pulizia standard usando le perle di volume 90% dopo la legatura, più totale dsDNA rimane per arricchimento al passaggio di amplificazione. Estremamente piccoli frammenti di DNA vengono preferenzialmente rimossi usando le perle di volume del 90%. Selezione dimensione sono condotto nel passaggio finale sulla libreria amplificato, che assicura l'arricchimento di dimensioni del frammento desiderato. Volumi totali di perline possono essere regolati per selezionare l'intervallo desiderato, anche se i volumi in due fasi di 25 µ l e 6 µ l di perline sono ottimizzati per recuperare le librerie di 400-500 paia di basi inserti all'interno di questo protocollo (Figura 1B, complementare figura 2).

Esempio di salvataggio attraverso Reamplification di librerie
Nonostante consigliate di isolamento del DNA e preparazione di biblioteca, concentrazioni finali delle librerie di sequenziamento possono essere insufficiente per la sequenziazione di ulteriormente. La natura distruttiva del campionamento e spesso limitato materiale di consumo da campioni di erbario non consente sempre ripetendo isolamento del DNA. Da reamplifying la libreria fino a 12 ulteriori cicli PCR, anche eccezionalmente scarsa librerie possono essere salvate. Una coppia di primer standard è usata per l'amplificazione, che è compatibile con entrambi i protocolli doppia o singola raccolta indicizzata. Una preoccupazione primaria per reamplification è l'introduzione di parzialità, spesso attraverso la riduzione in porzioni di GC-rich del genoma20. Utilizzando una polimerasi ad alta fedeltà (Vedi Tabella materiali), questi potenziali pregiudizi potenzialmente sono evitati. Questo è dimostrato attraverso la minima variazione del contenuto di GC delle librerie sequenziate TK686 e TK686-R (tabella 3). Come una seconda verifica, il contenuto di trasposoni di TK686 e di TK686-R era stimato e ha mostrato nessuna differenza distinguibile (tabella 3). Infine, il genoma del cloroplasto intero di questa adesione è stato assemblato da TK686 e TK686-R, che ha provocato le sequenze identiche dopo attento esame della variazione di SNP tra le due assemblee (Figura 2, tabella 3). Queste prove suggeriscono che genomica metriche standard, ad esempio contenuto di GC e composizione di trasposoni e la capacità di montare i genomi completi cloroplasto, non possono essere influenzati dalla reamplification. Questo apre la possibilità di incorporare erbario esemplari pensiero per essere troppo degradate o carente in materiale in phylogenomic studi senza preoccupazione per bias introdotto attraverso PCR. Queste librerie reamplified potrebbero essere utilizzate anche per sequenza cattura34, anche se sarebbe necessario verificare se la chiamata di SNP è prevenuto. Si raccomanda che il test su piccola scala di bias essere condotte con ogni progetto per verificare che bias non è stato introdotto in librerie di sequenziamento.

Limitazioni ed eventuali modifiche
Anche se questo protocollo ha lavorato su centinaia di campioni di erbario, mal conservato tessuti potrebbe comunque non riuscire in qualsiasi fase. È, tuttavia, estremamente rara per le librerie mancato da tessuti con successo estrazioni di DNA, soprattutto dopo il salvataggio libreria attraverso reamplification. La procedura di selezione di dimensioni sono modificabili per diversi frammenti di dimensioni di destinazione o per ridurre la vasta gamma di frammenti visto in alcune librerie finale. Come con tutti i protocolli di estrazione vegetale, procedura potrebbe essere necessario rimuovere lineage-specifici composti secondari che possono ostacolare il protocollo generale. Come presentato, questo protocollo fornisce un metodo standard per la preparazione di DNA alto-rendimento e isolamento biblioteca per gli esemplari di erbario di erba e attraverso la verifica e la sperimentazione è probabile che sia modificabile per altri lignaggi di pianta.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori dichiarano che non hanno nessun interessi concorrenti.

Acknowledgments

Ringraziamo Taylor AuBuchon-Elder, Jordan Teisher e Kristina Zudock per assistenza negli esemplari di erbario di campionamento e il giardino botanico del Missouri per l'accesso agli esemplari di erbario per campionamento distruttivo. Questo lavoro è stato supporto da una sovvenzione della National Science Foundation (DEB-1457748).

Materials

Name Company Catalog Number Comments
Veriti Thermal Cycler Applied Biosystems 4452300 96 well 
Gel Imaging System Azure Biosystems c300
Microfuge 20 Series Beckman Coulter B30137
Digital Dry Bath Benchmark Scientific BSH1001
Electrophoresis System EasyCast B2
PURELAB flex 2 (Ultra pure water) ELGA  89204-092
DNA LoBind Tube  Eppendorf 30108078 2 ml
Mini centrifuge Fisher Scientific 12-006-901
Vortex-Genie 2 Fisher Scientific 12-812
Mortar Fisher Scientific S02591 porcelain
Pestle fisher Scientific S02595 porcelain
Centrifuge tubes fisher Scientific 21-403-161
Microwave Kenmore 405.7309231
Qubit Assay Tubes Invitrogen Q32856
0.2 ml Strip tube and Cap for PCR VWR 20170-004
Qubit 2.0 Fluorometer Invitrogen Q32866
Balance Mettler Toledo PM2000
Liquid Nitrogen Short-term Storage Nalgene F9401
Magnetic-Ring Stand  ThermoFisher Scientific  AM10050 96 well 
Water Bath VWR 89032-210
Hot Plate Stirrers VWR 97042-754
Liquid Nitrogen Airgas UN1977
1 X TE Buffer Ambion AM9849 pH 8.0
CTAB AMRESCO 0833-500G
2-MERCAPTOETHANOL AMRESCO 0482-200ML
Ribonuclease A AMRESCO E866-5ML 10 mg/ml solution
Agencourt AMPure XP Beckman Coulter A63882
Sodium Chloride bio WORLD 705744
Isopropyl Alcohol bio WORLD 40970004-1
Nuclease Free water bio WORLD 42300012-2
Isoamyl Alcohol Fisher Scientific A393-500
Sodium Acetate Trihydrate Fisher Scientific s608-500
LE Agarose GeneMate E-3120-500
100bp PLUS DNA Ladder Gold Biotechnology D003-500
EDTA, Disodium Salt IBI Scientific IB70182
Qubit dsDNA HS Assay Kit Life Technologies Q32854
TRIS MP Biomedicals 103133 ultra pure
Gel Loading Dye Purple (6 X) New England BioLabs B7024S
NEBNext dsDNA Fragmentase New England BioLabs M0348L
NEBNext Ultra II DNA Library Prep Kit for Illumina  New England BioLabs E7645L
NEBNext Multiplex Oligos for Illumina New England BioLabs E7600S Dual Index Primers Set 1
NEBNext Q5 Hot Start HiFi PCR Master Mix New England BioLabs M0543L
Mag-Bind RXNPure Plus Omega bio-tek M1386-02
GelRed 10000 X Pheonix Research 41003-1
Phenol solution SIGMA Life Science P4557-400ml
PVP40 SIGMA-Aldrich PVP40-50G
Chloroform VWR EM8.22265.2500
Ethanol Koptec V1016 200 Proof
Silica sand VWR 14808-60-7
Reamplification primers Integrated DNA Technologies see text
Sequencher v.5.0.1 GeneCodes

DOWNLOAD MATERIALS LIST

References

  1. Savolainen, V., Cuénoud, P., Spichiger, R., Martinez, M. D. P., Crèvecoeur, M., Manen, J. F. The use of herbarium specimens in DNA phylogenetics: Evaluation and improvement. Plant Syst Evo. 197, (1-4), 87-98 (1995).
  2. Zedane, L., Hong-Wa, C., Murienne, J., Jeziorski, C., Baldwin, B. G., Besnard, G. Museomics illuminate the history of an extinct, paleoendemic plant lineage (Hesperelaea, Oleaceae) known from an 1875 collection from Guadalupe Island, Mexico. Bio J Linn Soc. 117, (1), 44-57 (2016).
  3. Teisher, J. K., McKain, M. R., Schaal, B. A., Kellogg, E. A. Polyphyly of Arundinoideae (Poaceae) and Evolution of the Twisted Geniculate Lemma Awn. Ann Bot. (2017).
  4. Cozzolino, S., Cafasso, D., Pellegrino, G., Musacchio, A., Widmer, A. Genetic variation in time and space: the use of herbarium specimens to reconstruct patterns of genetic variation in the endangered orchid Anacamptis palustris. Conserv Gen. 8, (3), 629-639 (2007).
  5. Wandeler, P., Hoeck, P. E. A., Keller, L. F. Back to the future: museum specimens in population genetics. Tre Eco & Evo. 22, (12), 634-642 (2007).
  6. Rivers, M. C., Taylor, L., Brummitt, N. A., Meagher, T. R., Roberts, D. L., Lughadha, E. N. How many herbarium specimens are needed to detect threatened species? Bio Conserv. 144, (10), 2541-2547 (2011).
  7. Saltonstall, K. Cryptic invasion by a non-native genotype of the common reed, Phragmites australis, into North America. PNAS USA. 99, (4), 2445-2449 (2002).
  8. Besnard, G., et al. From museums to genomics: old herbarium specimens shed light on a C3 to C4 transition. J Exp Bot. 65, (22), 6711-6721 (2014).
  9. Särkinen, T., Staats, M., Richardson, J. E., Cowan, R. S., Bakker, F. T. How to open the treasure chest? Optimising DNA extraction from herbarium specimens. PLoS ONE. 7, (8), e43808 (2012).
  10. Harris, S. A. DNA analysis of tropical plant species: An assessment of different drying methods. Plant Syst Evo. 188, (1-2), 57-64 (1994).
  11. Staats, M., et al. DNA damage in plant herbarium tissue. PLoS ONE. 6, (12), e28448 (2011).
  12. Bakker, F. T., et al. Herbarium genomics: plastome sequence assembly from a range of herbarium specimens using an Iterative Organelle Genome Assembly pipeline. Bio J of the Linn Soc. 117, (1), 33-43 (2016).
  13. Camacho, F. J., Gernandt, D. S., Liston, A., Stone, J. K., Klein, A. S. Endophytic fungal DNA, the source of contamination in spruce needle DNA. Mol Eco. 6, (10), 983-987 (1997).
  14. Hofreiter, M., Jaenicke, V., Serre, D., Von Haeseler, A., Pääbo, S. DNA sequences from multiple amplifications reveal artifacts induced by cytosine deamination in ancient DNA. Nucl Acids Res. 29, (23), 4793-4799 (2001).
  15. Staats, M., et al. Genomic treasure troves: Complete genome sequencing of herbarium and insect museum specimens. PLoS ONE. 8, (7), e69189 (2013).
  16. Bakker, F. T. Herbarium genomics: skimming and plastomics from archival specimens. Webbia. 72, (1), 35-45 (2017).
  17. Doyle, J. J., Doyle, J. L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem Bul. 19, 11-15 (1987).
  18. Allen, G. C., Flores-Vergara, M. A., Krasynanski, S., Kumar, S., Thompson, W. F. A modified protocol for rapid DNA isolation from plant tissue using cetryltrimethylammonium bromide. Nat Prot. 1, 2320-2325 (2006).
  19. Twyford, A. D., Ness, R. D. Strategies for complete plastid genome seqeuncing. Mol Eco Resour. (2016).
  20. Aird, D., et al. Analyzing and minimizing PCR amplification bias in Illumina sequencing libraries. Genome Bio. 12, (2), R18 (2011).
  21. Bolger, A. M., Lohse, M., Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinf. 30, 2114-2120 (2014).
  22. Grigoriev, I. V., et al. MycoCosm portal: gearing up for 1000 fungal genomes. Nucl Acids Res. 42, (1), D699-D704 (2014).
  23. Langmead, B., Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat Meth. 9, (4), 357-359 (2012).
  24. McKain, M. R. Herbarium Genomics. Github Repository https://github.com/mrmckain/ (2017).
  25. McKain, M. R., Wilson, M. A. Fast-Plast: Rapid de novo assembly and finishing for whole chloroplast genomes. Github Repository https://github.com/mrmckain/ (2017).
  26. McKain, M. R., McNeal, J. R., Kellar, P. R., Eguiarte, L. E., Pires, J. C., Leebens-Mack, J. Timing of rapid diversification and convergent origins of active pollination within Agavoideae (Asparagaceae). Am J Bot. 103, (10), 1717-1729 (2016).
  27. McKain, M. R., Hartsock, R. H., Wohl, M. M., Kellogg, E. A. Verdant: automated annotation, alignment, and phylogenetic analysis of whole chloroplast genomes. Bioinf. (2016).
  28. Staton, S. E., Burke, J. M. Transposome: A toolkit for annotation of transposable element families from unassembled sequence reads. Bioinf. 31, (11), 1827-1829 (2015).
  29. Bao, W., Kojima, K. K., Kohany, O. Repbase Update, a database of repetitive elements in eukaryotic genomes. Mobile DNA. 6, (1), 11 (2015).
  30. McKain, M. R. Transposons. Github Repository https://github.com/mrmckain/ (2017).
  31. Weiß, C. L., et al. Temporal patterns of damage and decay kinetics of DNA retrieved from plant herbarium specimens. Royal Soc Open Sci. 3, (6), 160239 (2016).
  32. Sawyer, S., Krause, J., Guschanski, K., Savolainen, V., Pääbo, S. Temporal patterns of nucleotide misincorporations and DNA fragmentation in ancient DNA. PLoS ONE. 7, (3), e34131 (2012).
  33. Head, S. R., et al. Library construction for next-generation sequencing: overviews and challenges. BioTechniques. 56, (2), 61-64 (2014).
  34. Grover, C. E., Salmon, A., Wendel, J. F. Targeted sequence capture as a powerful tool for evolutionary analysis. Am J Bot. 99, 312-319 (2012).

Comments

1 Comment

  1. Thanks for this video!

    Reply
    Posted by: Anony m.
    August 25, 2018 - 10:13 AM

Post a Question / Comment / Request

You must be signed in to post a comment. Please or create an account.

Usage Statistics