Infödda kromatin Immunoprecipitation använder murina hjärnan tumören Neurospheres

Cancer Research

Your institution must subscribe to JoVE's Cancer Research section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Epigenetiska mekanismer är ofta förändrade i gliom. Kromatin immunoprecipitation kunde användas för att studera konsekvenserna av genetiska förändringar i gliom som uppstår genom ändringar i Histon ändringar som reglerar kromatin struktur och gen transkription. Det här protokollet beskriver infödda kromatin immunoprecipitation på murina hjärnan tumören neurospheres.

Cite this Article

Copy Citation | Download Citations

Mendez, F. M., Núñez, F. J., Zorrilla-Veloz, R. I., Lowenstein, P. R., Castro, M. G. Native Chromatin Immunoprecipitation Using Murine Brain Tumor Neurospheres. J. Vis. Exp. (131), e57016, doi:10.3791/57016 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Epigenetiska förändringar kan vara inblandade i utvecklingen och utvecklingen av gliom. Förändringar i metylering och acetylering av initiativtagare och regulatoriska regioner av onkogener och tumör dämpning kan leda till förändringar i genuttryck och spelar en viktig roll i patogenesen av hjärntumörer. Infödda kromatin immunoprecipitation (ChIP) är en populär teknik som tillåter att upptäcka ändringar eller andra proteiner som tätt bundna till DNA. I motsats till tvärbunden ChIP, i native ChIP, behandlas celler inte med formaldehyd kovalent länka protein till DNA. Detta är fördelaktigt eftersom ibland crosslinking kan fixa proteiner som endast kortvarigt interagera med DNA och har inte funktionell betydelse i genreglering. Dessutom höjs generellt antikroppar mot ofixerade peptider. Därför ökar antikropp specificitet hos infödda ChIP. Det är dock viktigt att komma ihåg att infödda ChIP är endast tillämplig på studera histoner eller andra proteiner som binder hårt till DNA. Det här protokollet beskriver den infödda kromatin immunoprecipitation på murina hjärnan tumören neurospheres.

Introduction

Epigenetiska händelser är frekventerar i gliom och sannolikt en viktig roll i tumör patogenes. Faktiskt i pediatric höggradigt gliom förekommer mutationer i gener som kodar Histon varianter H3.3 och H3.1 ofta1. Mutationerna påverka Histon ändringar och har stora epigenetiska konsekvenser2,3. Hos ungdomar till vuxen spektrum uppstå återkommande mutationer i isocitrate-dehydrogenas gen 1/2 (IDH1/2), en mutation som hämmar α-KG beroende Histon och DNA de-methylasaes, och genetiska förändringar i andra kromatin tillsynsmyndigheter såsom ATRX och DAXX 4. det är därför av avgörande betydelse att studera hur mutationer som påverkar epigenetiska regulatorer alter kromatinstruktur och reglerande Histon ändringar, som i sin tur har en dramatisk påverkan på tumörcellerna transkriptom.

Kromatin immunoprecipitation (ChIP) är ett kraftfullt verktyg som används för att utvärdera effekterna av epigenetiska förändringar i genomet5,6,7. I native ChIP, kromatin är smälta med micrococcal nuclease (MNase), immunoprecipitated med en antikropp mot proteinet av intresse, och sedan DNA renas från immunoprecipitated kromatin komplexa6. Celler är inte fasta under förfarandet så denna teknik gäller endast för studier av proteiner som samverkar tätt med DNA6. Avsaknad av cross-linking hjälpmedel antikropp specificitet eftersom antikroppar oftast invändningar mot ofixerade peptider eller proteiner7. Dessutom, eftersom det finns ingen tvärbindande steg, minskar detta risken för fastställande övergående protein-DNA samspel som är icke-specifika och inte reglerande7,8. ChIP kan användas för att identifiera anrikningen av Histon ändringar i en viss genomisk region. Här, detalj vi ett protokoll för utför infödda ChIP i neurospheres (NS) genereras från genetiskt modifierade musmodeller av gliom.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

Alla metoderna som beskrivs här har godkänts av den institutionella djur vård och användning kommittén (IACUC) från University of Michigan.

1. generering av hjärntumör NS och odlingsskålar villkor.

  1. Förbereda neurala stamceller Medium (NSC) med Dulbeccos modifierade Eagle Medium/F12B27 tillägg (1 x), N2 tillägg (1 x) och en antimikrobiell reagens. Komplettera NSC medium användning med humant rekombinant endotel tillväxtfaktor (EGF) och basic-fibroblast tillväxtfaktor (FGF) med en slutlig koncentration på 20 ng/mL varje dag.
  2. Inducera hjärnan tumören i musen använder Törnrosa transposon systemet där plasmider kodning onkgener eller shRNA inriktning tumör dämpning injiceras in i laterala ventriklarna i nyfödda för att generera spontana hjärnan tumörer9. Välj en mus med en stor tumör, vilket bekräftas med Mareld imaging.
    Obs: Mer detaljerad information om Sleeping Beauty Transposon System och plasmid konstruktioner används kan hittas i Calinescu o.a. 9.
    1. För att bild möss, injicera 100 µL av 30 mg/mL luciferin lösningen intraperitonealt med en 26 gauge nål.
    2. 5 min efter injektion av luciferin, söva djuret med en anestesi kammare med syre/isofluran flöde anges till 2% isofluran.
    3. När djuren bedövas (oftast 2-3 min), placera djuren i Mareld kammaren med syre isofluran inställd på 2% isofluran. Om djuren kommer att vara under narkos längre än 5 min, använda en oftalmologiska salva för att förhindra torrhet medan under narkos.
    4. Bild på möss med en in-vivo optisk imaging system med följande parametrar: automatisk exponering, stora binning och bländaren f = 1. Parametern att anser att det är en stor tumör är en Mareld > 106 fotoner/s/cm2/sr.
  3. Avliva musen med en överdos av isofluran inandning narkos i en sluten kammare, kontrollera av tå nypa att djuret är sövd, och halshugga musen.
  4. Extrahera hjärnan och dissekera det som tidigare beskrivits i Calinescu o.a. 9.
  5. Placera hjärnan i ett 10 cm petriskål. Använd en fluorescerande dissekera Mikroskop inställd på rätt fluorescerande kanal och 0.3 X förstoring, identifiera, om tumören inducerad uttrycker en fluorescerande protein, annars tumör massa av skillnaderna i vävnad färg och konsistens. Använd skalpell och pincett för att separera tumörvävnad från normala hjärnan.
  6. Finhacka tumören i små bitar i petriskål. Placera dissekerade tumören i ett 1,5 mL rör med 300 µL av NSC medium.
  7. Använd en disponibel plast pellets mortelstöt som passar till väggarna i en konisk mikrocentrifug rör till försiktigt homogenisera tumören. Tillsätt 1 mL av cell avlossning medium och inkubera provet för 5 min vid 37 ° C.
    Obs: Användning av en mortel kan döda vissa celler. Om läsaren vill maximera cellviabiliteten, utelämnas användning av en mortelstöt.
  8. Passera cellsuspensionen från steg 1,7 genom en 70 µm cell sil och tvätta silen med 25 mL av NSC medium.
  9. Centrifugera suspensionen vid 300 x g under 5 minuter i rumstemperatur, Dekantera supernatanten och resuspendera pelleten i 6 mL NSC medium.
  10. Plåt tumör cellsuspensionen från steg 1,9 i en kolv med T-25 i kultur och kultur det vid 37 ° C i en vävnadskultur inkubator med en atmosfär av 95% luft och 5% CO2. Vanligtvis efter 3 dagar blir det en blandning av några döda celler, klibbade celler och vissa celler som bildar NS som flyter i mediet.
  11. Överföra cellsuspensionen i en 15 mL koniska rör, samla endast de celler som sjunker till botten med hjälp av en mikropipett och åter tallrik dem på en T-75 vävnadsodling kolv.
  12. Upprätthålla cellerna på relativt hög densitet (1-3 X 106 celler i en T-25). Passagen cellerna när de är konfluenta.
    Obs: Konfluens bestäms av storleken på kulorna. Svart centrerar av stora områden menar att det finns döda celler i mitten och indikera att cellerna bör vara passaged omedelbart.
  13. Lägg till tillväxtfaktorer (EGF och basic-FGF; 20 ng/mL vardera) alla tre dagar. Ändra mediet när cellerna inte konfluenta och medelstora svängar ljus orange.
  14. För att ändra mediet, samla gamla medium och centrifugera det 300 x g i rumstemperatur i 5 min och resuspendera cellpelleten i NSC medium kompletteras med fonden och FGF vid den koncentration som anges i steg 1,1.
    Obs: Om sfärernas är på mitten av-till hög konfluens, men inte redo att vara överförda (sfär storlek är liten med en diameter < 100 µm), sedan pelleten kan delas in i två kolvar.
  15. För att passage cellerna, Centrifugera cellerna vid 300 x g under 5 minuter i rumstemperatur, Dekantera supernatanten och inkubera cellerna i cell avlossning medium för 5 min vid 37 ° C.
    1. Tillsätt 5 mL av balanserad saltlösning till utspädd avlossning medium och centrifugera det 300 x g under 5 minuter i rumstemperatur.
    2. Dekantera supernatanten, Återsuspendera cellpelleten i 18 mL NSC medium och dela upp suspensionen lika i tre T-25 kolvar.
  16. För att frysa alikvoter av celler, separera celler som i steg 1.15 och frysa cellerna i 1 mL portioner av 90% fetalt bovint serum med 10% dimetyl sulfoxid. Långsamt svalna cellerna genom att placera cellerna på is i 10 min och sedan hålla cellerna-20 ° C i 30 min, och -80 ° C för 1 dag. Nästa dag, överföra cellerna till en behållare för lagring av flytande kväve.

2. inbyggda ChIP

  1. Kromatin förberedelse
    1. Efter att beståndet av härledda NS, kultur NS i en T-75 i 15 mL av NSC medium vid 37 ° C i en vävnadskultur inkubator med en atmosfär av 95% luft och 5% CO2 tills NS blir konfluenta. En konfluenta T-75 plattan kommer att ge 3-5 X 106 celler.
    2. När cellerna blir konfluenta, Centrifugera NS 300 x g i 5 min, Dekantera supernatanten och tillsätt 1 mL av cell dissociation medium. Inkubera cellerna vid 37 ° C i 5 min. Tillsätt 5 mL av medium och räkna cellerna med hjälp av en hemocytometer10.
      Obs: 1 x 106 celler behövs per immunoprecipitation (IP) reaktion. Observera att före immun serum eller IgG kontroll också måste vara inkluderade11.
    3. Centrifugera NS i en 1,5 mL mikrocentrifug rör vid 300 x g i 5 min, Dekantera supernatanten och resuspendera NS pelleten med 1 mL av balanserad saltlösning och överför till låg protein bindande 1,5 mL mikrocentrifugrör.
    4. Centrifugera NS 300 x g i 5 min, Dekantera supernatanten och slamma cellpelleten i 95 µL matsmältningen buffert (50 mM Tris-HCl, pH 8,0, 1 mM CaCl2, 0,2% polyetylenglykol octylphenyl eter) per 1 x 106 celler kompletteras med proteashämmare hämmare cocktail på en hög koncentration (1: 100). Omedelbart Pipettera cellerna upp och ner för att förhindra klumpar och undvika att skapa eventuella bubblor.
    5. Återsuspendera MNase i 50% glycerol att göra 1 mg/mL lösning (1,15 enheter/µL, lagras vid-20 ° C) som kommer att betecknas som ”1 x” lager. Göra en ”0,1 x” lager genom att göra en andra 1:9 utspädning med 50% glycerol (t.ex., 900 µL av ”1 x” MNase och 100 µL av 50% glycerol) och lagra den på-20 ° C.
    6. Blanda 5 µL av ”0,1 x” MNase och 145 µL av matsmältningen buffert. Hålla enzymet på is alla gånger. Tillsätt 5 µL utspädda MNase i matsmältningen buffert per 1 x 106 celler. Snärta röret till blanda och placera röret i 37 ° C block för exakt 12 min. processen proverna en samtidigt för att säkerställa en korrekt inkubationstiden på 12 min.
    7. Tillsätt 10 µL 10 x MNase stoppa buffert (110 mM Tris-HCl, pH 8,0, 55 mM EDTA) per 1 x 106 celler. Proverna måste hållas på is från denna punkt och framåt.
    8. Tillsätt 110 µL ”2 x RIPA buffert” (280 mM NaCl, 1,8% polyeten octylphenyl glykoleter, 0,2% sodium dodecyl sulfate (SDS), 0,2% Na-deoxicholat, 5 mM etylenglykol-bis(β-aminoethyl ether)-N, N, N', N'-tetraacetic acid (EGTA); lagras vid 4 ° C) kompletteras med proteashämmare cocktail vid hög koncentration (1: 100) per 1 x 106 celler. Snärta röret att blanda.
    9. Centrifugera rören i 15 min i en microfuge vid 4 ° C och 1700 x g. överför supernatanten till en nya regelbundna 1,5 mL mikrocentrifugrör (låg protein bindande mikrocentrifugrör behövs inte längre) och lagra dem på isen. Kassera pelleten.
  2. Immunoprecipitation (IP)
    1. Blanda Protein A och Protein G magnetiska pärlor i förhållandet 1:1. För varje IP, förbereda 25 µL av pärlor.
    2. Tvätta pärlorna genom att tillsätta 1 mL RIPA bufferten (10 mM Tris pH 8,0, 1 mM EDTA, 140 mM NaCl, 1% polyetylenglykol octylphenyl eter, 0,1% SDS, 0,1% Na-deoxicholat; lagras vid 4 ° C) kompletteras med proteashämmare vid låg koncentration (1: 1000).
    3. Använda en magnet pärlor att separera från tvättlösningen och häll tvättlösningen (cirka 1 minut). Utför tvättningen två gånger.
    4. Återsuspendering pärlor för att den ursprungliga volymen med RIPA bufferten kompletteras med proteashämmare (1: 1000).
    5. Om nödvändigt, utspädd reservera kromatinet använder RIPA bufferten kompletteras med proteashämmare (1: 1000) så att varje IP har en volym på 100-200 µL. 10% av volymen används per IP av kromatin för input.
      Obs: till exempel om du använder 200 µL per IP 20 µL utspädda kromatin bör reserveras för input. För totalt fyra IPs, ska totala kromatin volym spädas till 820 µL.
    6. Förbereda input. Tillsätt 100 µL av TE buffert (10 mM Tris-HCl pH 8,0, 1 mM EDTA) kompletteras med proteinas K (0,5 mg/mL) till ingången och inkubera ingången vid 55 ° C för 1 h.
      Obs: Steg 2.2.6-2.2.7 kan utföras tillsammans med steg 2.3.4 och 2.4.1.
    7. Rena indata med hjälp av en PCR-rening kit efter tillverkarens anvisningar och eluera i 50 µL eluering buffert i kit.
    8. Mätning av koncentrationen av ingången med en microvolume spektrofotometer och registrera resultaten i en anteckningsbok. Tomt med eluering buffert från kit.
      Obs: I mus neurospheres använde vi cirka 6 µg av DNA för varje IP.
    9. Kör in på en 1% gel eller lasta 1 µL på en DNA-Bioanalyzer med standardinställningarna. Förvara resten för användning som indata i efterföljande program.
    10. Tillsätt 10 µL av tvättade protein A & G magnetiska pärlor för varje IP och inkubera IP för 1 h vid 4 ° C.
      Obs: Lägg till exempel till 30 µL av protein A & G magnetiska pärlor för tre IPs.
    11. Placera proverna på en magnet och låt pärlor att separera. Dela kromatin genom att överföra det tidigare fastställda beloppet till en ny 1,5 mL tub.
    12. Lägg till antikroppen och Linda mössor med plast paraffin film att undvika avdunstning. Inkubera proverna övernattning på 4 ° C med rotation vid 20 rpm.
      Obs: Koncentration bör bestämmas empiriskt följa tillverkarens rekommendationer.
    13. Nästa dag, snurra rören med en mini centrifug vid rumstemperatur, 2000 x g, för 10 s. Tillsätt 10 µL av pärlor till varje IP och inkubera IP i 3 h vid 4 ° C med rotation vid 20 rpm.
  3. IP-tvättar och Protein matsmältningen
    1. Tillsätt 150 µL av RIPA bufferten kompletteras med proteashämmare vid låg koncentration (1: 1000) till varje IP och inkubera IP vid 4 ° C med rotation vid 20 rpm för 5 min. plats provet på en magnetisk stå och magnetiska pärlor för att separera. Använd en Pipettera för att avlägsna supernatanten. Upprepa detta tep fem tvättar.
    2. Tillsätt 150 µL LiCl buffert (250 mM LiCl, 10 mM Tris pH 8,0, 1 mM EDTA, 0,5% NP-40, 0,5% Na-deoxicholat; förvaras vid 4 ° C) kompletteras med proteashämmare vid låg koncentration (1: 1000) till varje IP och inkubera IP vid 4 ° C med rotation vid 20 rpm för 5 min. plats provet på en magnetisk stå och låta magnetiska pärlor att separera. Använd en Pipettera för att avlägsna supernatanten.
    3. Tillsätt 150 µL kallt TE (ingen proteashämmare) och inkubera provet vid 4 ° C med rotation vid 20 rpm för 5 min. plats provet på en magnetisk stå och magnetiska pärlor att separera. Använd en Pipettera för att avlägsna supernatanten.
    4. Efter det sista tvätt, Slamma provet i 100 µL av TE buffert kompletteras med proteinas K (0,5 mg/mL) och inkubera provet vid 55 ° C för 1 h.
  4. DNA-rening och ChIP kvantitativa Real-Time PCR (qPCR)
    1. Rena immunoprecipitated DNA med hjälp av en PCR-rening kit. Efter tillsats av DNA bindande buffert från kit till varje prov, placera röret på en magnet och vänta tills magnetiska pärlor samlade, sedan överföra supernatanten till kolumnen rensning. Följ tillverkarens anvisningar och eluera i 50 µL eluering buffert i kit.
    2. Kontrollera om IP är framgångsrika genom att utföra en qPCR. Primers bör helst utformas för positiva och negativa kontrollen regioner.
      Obs: till exempel för en IP-adress utförs med H3K4me3 och H3K27me3, de följande proverna bör köras på qPCR: H3K4me3, H3K27me3 och IgG ChIP DNA, ingång DNA, och en ingen mall kontroll (NTC) använda primers för regioner för att berikas med H3K4me3 (positiv kontroll) och regioner att berikas med H3K4me3 (negativ kontroll); jämväl, för H3K27me3.
    3. Följ standard protokoll för att utföra qPCR12. Kort, utföra en qPCR med SYBR green master mix, 0,5 µL 10 µM arbetande koncentration av varje framåt och bakåt primer och 2 µL av ChIP eller ingående DNA. Läs plattor med ett realtid PCR-system. Primer sekvenser finns i tabell 2. Gapdh primer sekvenser från Hwang et al. var används13.
    4. Analysera ChIP data i förhållande till input, dvs procent input metod (% IP)14. Beräkna den procentuella ingång med följande formler:
      Justerade input = genomsnittliga ct (ingång)-Logga2(DF)
      där DF är utspädningsfaktorn för start indata och
      DF = totala volymen av IP / volym av indata
      % IP = 100 × 2 ^ (justerat input - Ct (IP))
      där är Ct tröskelvärdesfaktorn.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

En schematisk representation av tumör NS genereras från en hjärntumör där hjärnan tumörceller är Katushka positivt presenteras i figur 1. Figur 2 är en schematisk representation av den hela ChIP tekniken. Figur 3 visar representativa resultaten av kromatin från hjärntumör NS rötas med MNase för 12 min, vilket ger en majoritet av mono, di- och tri-nucleosomes. Efter ChIP, en qPCR kan utföras på ChIP och ingång DNA prover. Figur 4 visar representativa ChIP qPCR data från en qPCR glyceraldehyd-3-fosfat dehydrogenas (Gapdh). GAPDH är en städning-gen som är berikad med H3K4me3, en modifiering som är associerad med aktiva transkription. Resultaten visar att Gapdh är berikad med H3k4me3 och inte är berikad med H3K27me3 som är en ändring som är associerad med regioner av bortträngda kromatin.

Figure 1
Figur 1: Schematisk av tumör NS genereras från en Katushka positiva hjärntumör. Ett ljust fält och fluorescerande bild av en hjärna som skördas från en mus som nått slutpunkten stadiet. Tumör området avgränsas av den streckade linjen och är positivt för fluorescerande reportern, Katushka. Tumören är sedan isolerade och tumörvävnad samlas i en 1,5 mL tub. Cellerna är sedan skiljas och odlade i NSC medium och tumör NS form. Klicka här för att se en större version av denna siffra.

Figure 2
Figur 2: en schematisk representation av arbetsflödet för infödda ChIP. Tumör NS är odlade och expanderat. Varje IP utförs med 1 X 106 celler. Kromatin är fragmenterad med hjälp av MNase matsmältning för att erhålla mono, di- och tri-nucleosomes. Kromatinet inkuberas med en antikropp som är specifik för en Histon modifiering eller DNA-associerade protein av intresse. Antikropp-DNA ligger immunoprecipitated med magnetiska protein A/G pärlor. Slutligen, protein rötas och DNA renas för att erhålla endast DNA berikad med Histon modifiering eller DNA-associerade protein av intresse. Klicka här för att se en större version av denna siffra.

Figure 3
Figur 3: kromatin fragmentering av MNase. Kromatin var beredd från hjärntumör NS genom tillsats MNase och inkubation vid 37 ° C för exakt 12 min. representativa DNA resultat från Bioanalyzer analys ingående prov visar att majoriteten av DNA har splittrats i mono-, di- och tri- nucleosomes. Lane 1 är stegen i baspar (BP). Klicka här för att se en större version av denna siffra.

Figure 4
Figur 4: representant ChIP qPCR data presenteras som procent input. qPCR utfördes med IgG, H3K4me3 och H3K27me3 ChIP DNA använder primers glyceraldehyd-3-fosfat dehydrogenas (Gapdh). Representativa resultat visar att Gapdh, en städning gen, endast är berikad med H3K4me3 modifiering, associerade med aktiva transkription, och inte H3K27me3 modifiering, associerade med bortträngda kromatin. Det här diagrammet representerar resultaten av två biologiska experiment kör med tre replikera brunnar varje. Felstaplar representera standardavvikelsen för medelvärdet (SEM). Klicka här för att se en större version av denna siffra.

Gene Forward primer Reverse primer
GAPDH TCCCCTCCCCCTATCAGTTC GACCCGCCTCATTTTTGAAA

Tabell 1: Primers används för ChIP qPCR experiment. I denna tabell finns sekvenserna för primers används för Gapdh.

genomsnittliga Ct (ingång) Standardavvikelse Justerade Input
24.265 0,071 20.943
Procent input
Prov Råa medelvärdet Ct Standardavvikelse Procent input = 100 * 2 ^ (justerat input-Ct(IP))
IgG 32.23 0.112 0,04
H3K4me3 22.148 0.128 43.37
H3k27me3 32.79 0,519 0,027
NTC obestämd obestämd obestämd

Tabell 2: prov beräkning av procent inmatningsmetod för ChIP qPCR analys. Prov beräkning av procent ingång för ChIP utförs med 10% börjar ingång; DF = 10. Siffrorna i denna tabell illustrerar en biologiska experiment med 3 replikera brunnar kör för varje prov raw värden.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Det protokoll som presenteras här gör det möjligt för användaren att utföra infödda ChIP på NS härrör från genetiskt modifierade hjärntumörer. I motsats till bryggbindningen ChIP, begränsas detta protokoll för studier av proteiner som förknippar tätt med DNA6. Antalet celler som används kan ändras vid behov och protokollet kan skalas upp. Vi använde 1 X 106 celler per IP, men inhemska ChIP kan också utföras med så lite som 4 x 104 celler5. I detta protokoll analyserade vi ChIP DNA via qPCR; emellertid kan detta protokoll också kombineras med nästa generations sekvensering att studera protein-DNA-interaktion på en genome bred nivå. Vi har använt detta ChIP protokoll framgångsrikt för att analysera effekten av gliom onkogener på nedfall av Histon ändringar inom vissa områden av tumör celler genomet.

Det finns några kritiska steg när du utför infödda ChIP. Först, matsmältningen villkoren för varje celltyp empiriskt bestämmas. Majoriteten av kromatinet bör vara mono-nucleosomes (150 bp) med några di - och tri-nukleosomens toppar (figur 3). Våra protokoll resultat i mer än 70% mono-, di- eller tri-nukleosomens toppar, förblir dock några osmält DNA. Om protokollet kommer att användas för ChIP-seq, kommer ytterligare steg att behöva ta bort osmält DNA. Det är dessutom viktigt att komma ihåg att varje sats av MNase köpt kan skilja sig åt i aktivitet och kräver därför optimering av matsmältningen villkor. För det andra, kvaliteten på ett ChIP beror på specificitet antikropp används11. En hög kvalitet ChIP antikropp bör ha hög reaktivitet mot det avsedda målet och låg arg reactivity med andra DNA-associerade proteiner eller inaktivera target Histon ändringar11. Av denna anledning rekommenderar vi att du testar antikropp specificitet med hjälp av en peptid bindande test. KODA riktlinjer föreslår att en tiofaldig berikning bör observeras för modifiering av intresse i förhållande till andra ändringar11. Det är också viktigt att utföra nödvändig kontroll immunoprecipations, dvs., före immun eller IgG kontroll. När dessa överväganden är uppfyllda, är infödda ChIP data en stark tillförlitlig metod att studera epigenetiska mekanismer regleras av protein-DNA interaktioner.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Författarna har något att avslöja.

Acknowledgements

Detta arbete stöds av nationella institut för hälsa och nationella institutet för neurologiska sjukdomar & Stroke (NIH/NINDS) bidrag R37-NS094804, R01-NS074387, R21-NS091555 till M.G.C.; NIH/NINDS beviljar R01-NS076991, R01-NS082311 och R01-NS096756 till P.R.L.; NIH/NINDS R01-EB022563; Avdelningen för neurokirurgi; Leah's Happy Hearts och Tchad men grunden till M.G.C. och P.R.L. RNA biomedicin Grant F046166 till M.G.C. F.M.M. stöds av en F31 NIH/NINDS-F31NS103500. R.I.Z.-V. stöds av NIH NIGMS bevilja 5T34GM007821-37.

Materials

Name Company Catalog Number Comments
Agilent 2100 Bioanalyzer Agilent G2946-90004 bioanalyzer
AccuSpin Micro 17R, refrigerated Fisher Scientific 13-100-676
C57BL/6 Taconic B6-f C57BL/6 mouse
Calcium Chloride Aldrich 22350-6 buffer reagent
D-Luciferin, Potassium Salt Goldbio LuckK-1g
DiaMag1.5 magnetic rack Diagenode B04000003 for magnetic bead washes
DiaMag Rotator EU Diagenode B05000001 rotator
DMEM/F-12 Gibco 11330-057 NSC component
Dynabeads Protein A Thermo Fisher Scientific 10001D protein A magnetic beads
Dynabeads Protein G Thermo Fisher Scientific 10003D protein G magnetic beads
EGF PeproTech AF-100-15 prepare 20 μg/mL stock in 0.1% BSA and aliquot.
Ethylenediaminetetraacetic acid (EDTA) Sigma E-4884 buffer reagent
ethylene glycol-bis(β-aminoethyl ether)-N,N,N',N'-tetraacetic acid) (EGTA) Sigma E-4378 buffer reagent
Fast SYBR Green Master Mix Applied Biosystems 4385612 qPCR reagent
Fetal Bovine Serum Gibco 10437028 for freezing cells
FGF PeproTech 100-18b Prepare 20 μg/mL stock in 0.1% BSA and aliquot.
Forceps Fine Science Tools 11008-13 for dissection of tumor
Glycerol, MB Grade EMD- Millipore 356352
H3K4me3 Abcam Ab8580
H3K27me3 Millipore 07-449
HBSS Gibco 14175-103 balanced salt solution
Fluriso VETone 501017 inhalation anesthetic
Ivis Spectrum Perkin-Elmer 124262 in vivo optical imaging system
Hyqtase HyClon SV3003001 cell detachment media
Lithium Chloride Sigma L8895 buffer reagent
Low binding microtubes Corning Costar CLS3207 low protein binding microcentrifuge tube
Microcentrifuge tube Fisher 21-402-903 regular microcentrifuge tube
Micrococcal Nuclease Thermo Fisher Scientific, Affymetrix 70196Y each batch may differ; purchase sufficient amount for experiments and aliquot.
N2 Gibco 17502-048 NSC component
Normal Rabbit IgG Millipore 12-372
Normocin Invivogen NOL-36-063 anti-microbial agent, use at 0.1 mg/mL.
NP-40 (Igepal CA-630) Sigma 18896-50ML buffer reagent
Kimble Kontes Pellet Pestle Fisher Scientific K749515-0000
Protease Inhibitor Cocktail Sigma-Aldrich P8340 aliquot and store at -20 °C.
Protinase K Sigma-Aldrich P2308 make 10 mg/mL stock in water; aliquot and store at -20 °C.
QIAquick PCR Purification Kit Qiagen 28104 DNA purification kit
Scalpel Fine Science Tools 10007-16 for dissection of tumor
Sodium Chloride VWR 0241-5KG buffer reagent
Sodium Deoxycholate Sigma-Aldrich D670-25G buffer reagent
Sodium Dodecyl sulfate (SDS) Sigma L-4390 buffer reagent
Tris Base Thermo Fisher Scientific Bp152-1 buffer reagent
Triton X-100 Thermo Fisher Scientific BP 151-500 polyethylene glycol octylphenyl ether
Standard Mini Centrifuge Fisherbrand 12-006-901 standard mini centrifuge
SZX16 microscope Olympus SZX16 flourescent dissecting microscope
ViiA 7 Real-Time PCR System with Fast 96-Well Block Applied Biosystems 4453535
Nanodrop One Thermo-Fisher Scientific ND-ONEC-W

DOWNLOAD MATERIALS LIST

References

  1. Schwartzentruber, J., et al. Driver mutations in histone H3.3 and chromatin remodelling genes in paediatric glioblastoma. Nature. 482, (7384), 226-231 (2012).
  2. Bjerke, L., et al. Histone H3.3. mutations drive pediatric glioblastoma through upregulation of MYCN. Cancer Discov. 3, (5), 512-519 (2013).
  3. Bender, S., et al. Reduced H3K27me3 and DNA hypomethylation are major drivers of gene expression in K27M mutant pediatric high-grade gliomas. Cancer Cell. 24, (5), 660-672 (2013).
  4. Maleszewska, M., Kaminska, B. Is glioblastoma an epigenetic malignancy? Cancers (Basel). 5, (3), 1120-1139 (2013).
  5. Gilfillan, G. D., et al. Limitations and possibilities of low cell number ChIP-seq. BMC Genomics. 13, 645 (2012).
  6. Thorne, A. W., Myers, F. A., Hebbes, T. R. Native chromatin immunoprecipitation. Methods Mol Biol. 287, 21-44 (2004).
  7. Turner, B. Mapping Protein/DNA Interactions by Cross-Linking. (2001).
  8. Tseng, Z., Wu, T., Liu, Y., Zhong, M., Xiao, A. Using native chromatin immunoprecipitation to interrogate histone variant protein deposition in embryonic stem cells. Methods Mol Biol. 1176, 11-22 (2014).
  9. Calinescu, A. A., et al. Transposon mediumted integration of plasmid DNA into the subventricular zone of neonatal mice to generate novel models of glioblastoma. J Vis Exp. (96), (2015).
  10. Sambrook, J., Russell, D. W. Estimation of cell number by hemocytometry counting. CSH Protoc. 2006, (1), (2006).
  11. Landt, S. G., et al. ChIP-seq guidelines and practices of the ENCODE and modENCODE consortia. Genome Res. 22, (9), 1813-1831 (2012).
  12. Kubista, M., et al. The real-time polymerase chain reaction. Mol Aspects Med. 27, (2-3), 95-125 (2006).
  13. Hwang, W. W., et al. Distinct and separable roles for EZH2 in neurogenic astroglia. Elife. 3, e02439 (2014).
  14. Haring, M., et al. Chromatin immunoprecipitation: optimization, quantitative analysis and data normalization. Plant Methods. 3, 11 (2007).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics