RNA rullegardinmenyen prosedyre å identifisere RNA mål av en lenge ikke-koding

Genetics
 

Summary

Denne RNA rullegardin metoden kan identifisere RNA mål for en lenge ikke-koding RNA (lncRNA). Basert på hybridization av hjemmelaget, designet anti-følelse DNA oligonucleotide sonder gjelder for denne lncRNA i riktig fast vev eller cellen linje, kan det effektivt fange av alle RNA målene for lncRNA.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Torres, M., Becquet, D., Guillen, S., Boyer, B., Moreno, M., Blanchard, M. P., Franc, J. L., François-Bellan, A. M. RNA Pull-down Procedure to Identify RNA Targets of a Long Non-coding RNA. J. Vis. Exp. (134), e57379, doi:10.3791/57379 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Lenge ikke-koding RNA (lncRNA), som er sekvenser av mer enn 200 nukleotider uten definerte lesing ramme, tilhører den regulatoriske ikke-koding RNAS familie. Selv om deres biologiske funksjoner forblir hovedsakelig ukjent, disse lncRNAs har stadig økt og det anslås nå at mennesker kan ha mer enn 10.000 slik transkripsjoner. Noen av disse er kjent for å være involvert i viktige forskrifter veier av genuttrykk som finner sted på transcriptional nivå, men også i forskjellige trinn av RNA co- og post-transcriptional modning. I sistnevnte tilfeller har RNAs som er rettet av lncRNA identifiseres. Det er derfor det er nyttig å utvikle en metode aktiverer identifisering av RNAs forbundet direkte eller indirekte med en lncRNA rundt.

Denne protokollen, som ble inspirert av tidligere publiserte protokoller slik at isolering av en lncRNA sammen med sine tilknyttede chromatin sekvenser, ble å tillate isolering av tilknyttede RNAs. Vi bestemt at to trinn er avgjørende for effektiviteten av denne protokollen. Først er utformingen av bestemte anti-følelse DNA oligonucleotide sonder kunne hybridize å lncRNA rundt. Dette lncRNA sekundære strukturen var spådd av bioinformatikk og anti-følelse oligonucleotide sonder ble utformet med en sterk affinitet til regioner som viser en lav sannsynlighet for interne base sammenkobling. Andre avgjørende trinn i prosedyren er avhengig av etappe, den stabiliserende forholdene i vev eller kulturperler celler å bevare nettverket mellom alle molekylær partnere. Sammen med høy gjennomstrømning RNA sekvensering, gir denne RNA rullegardin protokollen det hele RNA interactome av en lncRNA av interesse.

Introduction

Det overordnede målet med metoden beskrevet her er å identifisere RNA molekylær partnere av en lang noncoding (lncRNA). LncRNA tilsvarer sekvenser av mer enn 200 nukleotider uten definerte lesing ramme. Noen av dem har vist seg å være involvert i gene expression regulering, ikke bare på transcriptional nivå, men også i forskjellige trinn av RNA co- og post-transcriptional modning. I sistnevnte tilfeller er molekylære partnere av lncRNA RNAs som identifiseres. En metode aktiverer identifisering av RNAs forbundet direkte eller indirekte med en lncRNA rundt vil deretter være viktig å utvikle.

Tidligere publisert metoder, slik som Chromatin isolasjon av RNA rensing (kvitre)1,2 og fange hybridisering analyse av RNA mål (diagram)3,4, tillater høy gjennomstrømming oppdagelsen av RNA-bundet proteiner og genomisk bindende områder av en bestemt lncRNA. I disse to metodene, lncRNA rundt ble først hybridiserte å biotinylated utfyllende oligonucleotides, og anlegget var så isolert bruker streptavidin perler. Hovedforskjellen mellom disse to teknikker er knyttet til design av sonder som er rettet mot lncRNAs. Kvitre, strategien inspirert av RNA fisk, besto av utforme en pool av kort komplementære DNA oligonucleotide sonder til flis hele lengden av lncRNA. Derimot i DIAGRAMMET tilpasset forfatterne RNase H kartlegging analysen på lncRNAs å undersøke områder tilgjengelig for hybridisering.

Fremgangsmåten foreslått her design anti-følelse DNA biotinylated oligonucleotide sonder bruker bioinformatikk modellering av lncRNA sekundær5 for å velge sonder med en sterk affinitet til regioner som viser en lav sannsynlighet for intern basere sammenkobling. Denne prosedyren har fordelen av å være billigere enn de som er basert på bassenger med fliser oligonucleotide sonder2 og mindre tidkrevende enn de basert på RNAse-H følsomhet4.

Det er en voksende mengde bevis for post-transcriptional gene regulering av lncRNAs6, er det veldig nyttig å utvikle en tilnærming slik at erobringen av RNAs som mål for en lncRNA. Videre skal brukes for de fleste programmer, var tilnærming optimalisert både i kulturperler celler og vev ekstrakter.

Protocol

Alle prosedyrer ble utført i strengt samsvar med det europeiske fellesskap og bruk av forsøksdyr (86/609/EØF og 2010/63/UE) og under en lisensen gitt D. Becquet (Préfecture des Bouches-du-Rhône, godkjenning nr. 13-002).

1. sonde Design

  1. Bruker den primære sekvensen av lncRNA rundt, generere sekundære strukturen på "RNAstructure Webserver"5.
    Merk: På dette nettstedet forskjellige algoritmer kan brukes. Tre prediksjon verktøy som gir best resultater for sonden design er: "Fold" (laveste fri energi struktur), "MaxExpect" (svært sannsynlig base parene) og "Probnot" (sannsynlige base parene inkludert pseudoknots). Disse tre analyser kan utføres og forhold. Andre webservere, for eksempel den Wien RNA websuite7, kan også brukes.
    1. Velg områdene som viser en lav sannsynlighet for interne base sammenkoblingen og utforme anti-følelse oligonucleotide sonder 25 baser med en sterk affinitet for disse regionene.
      Merk: Disse sonder GC innholdet skal bestå mellom 40 og 60%. Bruker en justering søkeverktøy (Blast), må du kontrollere at valgte anti-følelse oligonucleotide sonder ikke gjenkjenner nukleotid sekvenser i andre RNA uttrykt i valgte cellen systemet.
  2. Utforme også en uspesifisert DNA oligonucleotide sonde 25 baser som viser ingen affinitet for lncRNA av interesse eller for andre RNA sekvenser i genomet av interesse.
  3. Bestille sonder med biotin på 3-slutten.
    Merk: For å redusere den steric hindring, avstanden mellom oligonucleotide og Biotin har økes med en triethyleneglycerol for avstand. For et optimalt resultat, og kunne vurdere spesifisiteten av resultatene av rullegardinmenyen, er det anbefalt å design 3 forskjellige anti-følelse oligonucleotide prober og eksperimentelt sammenligne effektiviteten.

2. cross-linking

  1. Kultivert celle cross-linking
    1. Kultur i GH4C1 sommatolactotroph hypofysen celler i Ham F10 medium med 15% hest serum og 2% fosterets kalv serum. Vokse cellene til samløpet i 78,5 cm2 kultur plater. Dette tilsvarer ca 1 x 107 celler.
    2. Fjerne celle kultur medium fra en confluent GH4C1 78,5 cm2 kultur plate, så skyll med 1 x middels volumet av fosfat bufret saltvann (PBS)
    3. Fastsette cellene med en 1% paraformaldehyde løsning i PBS (10 mL for en 78,5 cm2 retter); Denne løsningen må være nylaget fra en 4% paraformaldehyde lagerløsning. Link under omrøring for 10 min ved romtemperatur (RT).
      Advarsel: Paraformaldehyde (PFA) er giftige, og må håndteres med forsiktighet.
    4. Slukke handlingen paraformaldehyde ved å legge til 1/10 volumet av glysin 1,25 M (1 mL per 10 mL paraformaldehyde løsning); agitere 5 min på RT.
    5. Kast media av aspirasjon og skyll to ganger (5 min) med 1 X middels volumet på PBS.
    6. Legge til et volum på PBS tilsvarer 1/10 av volumet av media, samle celler med cellen skraper og deretter overføre til en sentrifuge rør.
    7. Spinne 510 g på 4 ° C i 5 minutter.
    8. Fjerne nedbryting så mye som mulig.
    9. Lagre pellets på ubestemt tid etter behov på-80 ° C.
  2. Vev Cross-linking
    1. Sette 5 mg nylig fått musen hypofysen vev i en løsning av 1% paraformaldehyde fortynnet i PBS (ca 10 x volumet av vev), agitere for 10 min på RT.
    2. Slukke handlingen paraformaldehyde ved å legge en 1,25 M glysin løsning (1 mL per 10 mL paraformaldehyde løsning) og rist 5 min på RT.
    3. Forkaste media av aspirasjon og skyll to ganger med PBS (ca 10 x volumet av vev). Fjerne nedbryting så mye som mulig.
    4. Lagre krysskoblet vev på ubestemt tid på-80 ° C.

3. cellen eller vev Lysis

  1. Forberede lyseringsbuffer (50 mM Tris-HCl pH 7.0, 10 mM EDTA, 1% SDS supplert med 200 U/mL av en RNAse hemmer løsning og en cocktail av proteaser hemmer 5 µL/mL).
  2. For å få lysed prøver uten forutgående tining, å suspendere celle pellets eller krysskoblet vev med denne bufferen (ca 1 mL per 100 mg av cellen pellets eller vev). Cellen pellets fra 1 x 107 celler gi opphav til et lysed utvalg som inneholder omtrent 20 mg av protein.
    Merk: Avhengig av vevet brukes, et skritt mekanisk avbrudd bør legges. I dette tilfellet er det viktig å unngå oppvarming av prøvene under denne ekstra trinn.

4. sonication

  1. Optimalisering av sonication
    1. Programmet sonicator med 2 til 5 serie av 30 s ON og 30 s av.
    2. Utføre tester for å optimalisere sonication forhold på utvannet lysed samples (fortynningsfaktoren ½ eller ¼ tilsvarer ca 10 eller 5 mg protein). Stedet fortynnet lysed prøver i vannbad 4 ° C og starte sonication serien.
    3. Rense RNAs enten en RNA rensing kit eller med en RNA isolasjon reagens (f.eksTrizol).
    4. Laste totaliteten av renset på en 1% agarose gel geleelektroforese TBE buffer, kontrollere lengden på RNA fragmenter. Dette lengde bør variere mellom 200 og 800 bp.
      Merk: Avhengig RNA fragment, anti-følelse oligonucleotide sonder effektivitet kan variere. Det anbefales da å kontrollere effektiviteten av sonder under ulike forhold av sonication.
  2. Sonication lysed prøvene
    1. Sted lysed prøver tilsvarer 20 mg av proteiner (innhentet etter trinn 3.2) i 4 ° C vann bad og starte sonication serien som optimalisert i trinn 4.1.
    2. Umiddelbart etter sonication, sentrifuge for 5 min på 12.000 g på 4 ° C. Overføre supernatants i nye sentrifuger rør.
      Merk: For å sikre homogenitet, Repliker supernatants kan samles og distribueres på dette trinnet.

5. RNA rullegardin

  1. Dag 1-hybridisering trinn
    1. Legge til 2 mengder hybridisering buffer (50 mM Tris-HCl pH 7.0, 750 mM NaCl, 1 mM EDTA, 1% SDS, 15% Formamide lagt bevisst) til supernatants samlet etter sonication trinn. Vortex.
    2. Overføring 20 µL av hvert utvalg i en sentrifuge tube (innspill prøvene) og lagre på 20 ° C.
    3. Legg 100 pmol av biotinylated oligonucleotide sonder (spesifikke eller ikke-spesifikk, se tabell 1) til hvert utvalg. Inkuber 4 til 6 h under moderat agitasjon på et rør rotator på RT.
    4. Legge til 50 µL av magnetiske streptavidin perler supplert med 200 U/mL av en RNAse hemmer løsning og en cocktail av proteaser hemmer 5 µL/mL.
    5. Ruge over natten under moderat agitasjon på røret rotator på RT.
  2. Dag 2-RNA isolasjon trinn
    1. Bruke magnetiske støtte skille perler fra celle lysate, forkaste nedbryting og vaske perler med 900 µL av vaskebuffer (SDS 0,5%, SSC 2 x). Gjenta ispedd 5 ganger 5 minutter omrøring på rotator på RT.
    2. Etter siste vask, Dekanter en siste gang og legge 95 µL av Proteinease K buffer (10 mM Tris-HCl pH 7.0, 100 mM NaCl, 1 mM EDTA, 0,5% SDS) og 5 µL av proteinasen-K (20 mg/mL) til prøvene.
    3. På is, tine innspill prøvene (20 μL) og legge 75 µL av Proteinease K buffer og 5 µL av proteinasen-K (20 mg/mL).
    4. Inkuber alle prøver med proteinasen K for 45 min ved 50 ° C deretter 10 minutter til 95 ° C.
    5. Chill prøven på is 3 min før skille perlene fra RNAs med magnetiske støtte. Holde nedbryting og kaste perler.
    6. Rens RNAs med en RNA rensing kit, som skal omfatte en DNA fordøyelsen trinn. Lagre RNAs på-80 ° C.
    7. Utføre omvendt transkripsjon qPCR (RT-qPCR) med en RT kit etterfulgt av qPCR ved hjelp av bestemte primere (tabell 1).
    8. Konstruere to DNA bibliotek tilsvarer to RNA bassengene med hver av de spesifikke Neat1 sonder (tabell 1). Utføre sekvensering på et neste generasjons sekvensering system.

Representative Results

Flere studier har vist at lncRNAs spiller en viktig rolle i nesten alle viktige biologiske prosesser og at denne rollen er oppnås gjennom kontroll av genuttrykk forekommer både i transcriptional og de post-transcriptional nivåene viser i dette siste tilfelle at RNAs kan være målet for lncRNAs6.

LncRNA kjernefysiske beriket rikelig transkripsjon 1 (Neat1) er involvert i ulike neuropathologies som frontotemporal demens, amyotrofisk lateral sklerose eller epilepsi8,9,10, og er også misregulated i ulike kreftformer11,12.

Denne lncRNA kalles også å være den strukturelle bestanddelen av bestemte kjernefysiske organer, paraspeckles, og å være involvert i post-transcriptional circadian regulering av gene expression13. Paraspeckles som finnes i hver cellekjernen og dannes rundt ikke bare Neat1, som er nødvendig for dannelsen deres, men også rundt flere RNA bindende proteiner (RBP)14, er faktisk kjent for å kunne beholde RNA mål innen kjernen15 . Dannelsen av paraspeckles oppnås gjennom foreningen av de ulike komponentene. Denne formasjonen ble vist å vise en circadian rytmisk mønster kjører en rytmisk kjernefysiske oppbevaring av RNA mål13. Kjernefysisk oppbevaring av RNA mål av paraspeckles kan oppstå ved binding til RBP, eller direkte gjennom RNA/RNA foreningen, men omfanget av RNAs målrettet av paraspeckles måtte bestemmes. Å identifisere RNA rettet direkte eller indirekte av Neat1, en RNA rullegardin protokollen ble utformet som isolasjon og identifikasjon av alle Neat1 RNA mål i kulturperler celler så vel som i vevsprøver (se figur 1 for en grafisk presentasjon av teknikken).

Protokollen ble også brukt til identifisering av RNA mål for en en annen lncRNA metastasering forbundet lunge Adenocarcinoma transkripsjon 1 (Malat1). Malat1 er en svært bevart og uttrykt lncRNA funnet i kjernefysiske flekker med flere RNA skjøting faktorer. Malat1 er kjent for å være involvert i reguleringen blitt flere begynnende pre-mRNA16,17.

Spesifikke (SO) og ikke-spesifikk oligonucleotide (NSO) sonder ble generert med sonde utformingen strategi beskrevet her. Denne strategien er avhengig av valg av områder som viser en lav sannsynlighet for indre bunnen sammenkoblingen som spådd av sekundær strukturen i lncRNA og utformingen av bestemte sonder med en sterk affinitet for disse regionene. Som et representativt resultat av disse bioinformatikk spådommer, et bilde av spådd sekundære strukturen av en rekke Neat1 (nukleotider 1,480 til 2000) sammen med plasseringen av to utformet slik sonder er gitt i figur 2.

Designet sonder var rettet til rotte Neat1 eller Malat1 for GH4C1 kultivert celler og mus Neat1 for hypofysen vev ekstrakter (tabell 1). Relativ anriking i Neat1 eller Malat1 ble beregnet for uspesifikke og spesifikke sonder i forhold til innspill prøvene. Figur 3 viser effektiviteten av bestemt sonder til rullegardinmenyen Neat1 i rotte GH4C1 hypofysen celle linje (figur 3A) og musen hypofysen vev trekker ut (figur 3B). Når du bruker sonde design protokollen for å generere bestemte oligonucleotide (så) sonder mot Malat1, forkastet en effektiv sonde ble innhentet mens en annen var ikke effektiv nok og ble (figur 4A).

Etter en RNA rullegardin prosedyren etterfulgt av RT-qPCR eksperimenter, en RNAs vurderes med bestemte primer (tabell 1) ble vist å være forbundet med Neat1 eller Malat1 i GH4C1 ekstrakter. RNAs tilknyttet Neat1 i GH4C1 celle ekstrakter ble også vist å være assosiert med Neat1 i hypofysen vev ekstrakter. Faktisk, etter Neat1 RNA rullegardinmenyen, Malat1 ble funnet å bli målrettet av Neat1 både i GH4C1 celle linjen og hypofysen musen vev ekstrakter (figur 5A). Gjensidige, var Neat1 betydelig beriket etter Malat1 RNA rullegardinmenyen utført med en bestemt sonde i GH4C1 celler (figur 4B). Ved å markere det nære forholdet mellom de to lncRNAs, disse resultatene er konsistente med rollen som potensiell co-regulatory av Neat1 og Malat1 foreslått av Malat1 knockout mus som viser variasjoner i Neat1 RNA uttrykk18, 19. utskrifter av to viktigste hypofysen hormoner, veksthormon (Gh) (figur 5B) og prolaktin (Prl) (figur 5C) var betydelig beriket etter Neat1 RNA rullegardinmenyen med bestemte sonder i både GH4C1 celler og hypofysen ekstrakter, antyder en mulig regulering av to hormoner av Neat1. Når du sammenligner to bestemte sonder brukes, viste det seg at effektiviteten kan variere avhengig av RNA målet vurdert (figur 5B og figur 5C). Disse resultatene markere nødvendigheten av å utforme flere spesifikke sonder for å velge de viser ikke bare den beste effektiviteten i anriking av rullegardinmenyen lncRNA, men også beste effektiviteten i anriking av sine RNA mål.

Metoden RNA rullegardinmenyen kan også bli etterfulgt av RNA høy gjennomstrømming sekvensering å få en omfattende liste over RNA mål for en lncRNA rundt13. En RNA-seq analyse på GH4C1 hypofysen cellene etter Neat1 RNA rullegardin bruker to bestemte sonder beskrevet ovenfor ble utført. Det bør bemerkes at en negativ kontroll med en NSO kan også bli utsatt for RNA-seq analyse, Hvis nivået av RNA gjenopprettet etter RNA rullegardinmenyen med NSO er tilstrekkelig for å tillate bygging av biblioteker. Dette var ikke tilfellet i tidligere erfaring13. Biblioteker som ble generert etter bruk av bestemte sonder ble analysert ved hjelp Tophat/mansjettknapper rørledning20 og bare utskrifter med verdier av fragment per kilobase per million av tilordnede leser (FPKM) høyere enn 1 tatt i betraktning. Listene oppnådd med to bestemte sonder mot Neat1 (tabell 1) var korslagt for å vurdere spesifisiteten av resultatene. 4,268 gener fant knyttet til paraspeckles, som representerte 28% av uttrykt utskrifter i GH4C1 celler13. I samsvar med resultatene qPCR analyse (Figur 5A-C), utskrifter av Gh Prl og Malat1 ble funnet for å være knyttet til Neat1. Metoden RNA rullegardin har derfor vist seg for å være et effektivt verktøy til å utforske samspillet mellom lncRNAs og sine RNA mål.

Figure 1
Figur 1: grafisk representasjon av det trekke ned prosedyren. På den første dagen, var eller vev krysskoblet med paraformaldehyde, lysed og sonicated før hybridisering trinn som ble utført ved å legge biotinylated bestemt sonder. Magnetiske streptavidin perler ble deretter lagt til skille bestemt materiale fra resten av cellen lysate. På den andre dagen, ble perler isolert av en magnet og vasket flere ganger. En de-crosslinking trinn tillatt utvinning av RNAs som ble renset og brukt for RT-qPCR eller RNA-seq analyse. Klikk her for å se en større versjon av dette tallet.

Figure 2
Figur 2: sekundær strukturen til en Neat1 sekvens (nucleotide 1,480 til 2000) som spådd av bioinformatikk ressurs (RNAstructure webserver, laveste fri energi struktur). Strukturen er farget i henhold til graden av sannsynligheten for base sammenkobling. De to oligonucleotides sonder (SO1 og SO2) i rødt er plassert langs Neat1 RNA strukturen. Klikk her for å se en større versjon av dette tallet.

Figure 3
Figur 3: qPCR validering av Neat1 berikelse versus inndata. qPCR validering av Neat1 berikelse versus inndata etter Neat1 RNA trekke ned av to forskjellige bestemt sonder (SO1-rn og SO2-rn for GH4C1 celler og SO1-mm og SO2-mm hypofysen vev) sammenlignet med en uspesifisert (NSO-rn for GH4C1 celler og NSO mm for hypofysen vev) GH4C1 rotten celler (A) og mus hypofysen ekstrakter vev (B). Resultatene er gjennomsnittlig ± SEM fått 3 til 10 eksperimenter. Klikk her for å se en større versjon av dette tallet.

Figure 5

Figur 4: qPCR validering av Malat1 og Neat1 berikelse versus inndata etter Malat1 RNA trekke ned. qPCR validering av Malat1 (A) og Neat1 (B) berikelse versus inndata etter Malat1 RNA trekke ned av to forskjellige bestemt sonder (SO3-rn og SO4-rn) sammenlignet med en uspesifikk en (NSO-rn) i GH4C1 rotten celler. Resultatene er gjennomsnittlig ± SEM innhentet i 3 eksperimenter. Klikk her for å se en større versjon av dette tallet.

Figure 4
Figur 5: qPCR validering av Malat1, Gh, Prl berikelse versus inndata etter Neat1 RNA trekke ned. qPCR validering av Malat1 (A), Gh (B) Prl (C) berikelse versus inndata etter Neat1 RNA trekke ned bruker forskjellige bestemt sonder i forhold til en uspesifisert i GH4C1 rotten celler og mus hypofysen vev ekstrakter. Resultatene er gjennomsnittlig ± SEM fått 3 til 8 eksperimenter. Klikk her for å se en større versjon av dette tallet.

SONDEN NAVN Sekvenser
NSO-Rn TAAAATACCATTTGATGTTTGAAATTAT
SO1-Rn CTCCACCATCATCAATCCTCTGGAC
SO2-Rn GCCTTCCCACATTTAAAAACACAAC
SO3-Rn AACTCGTGGCTCAAGTGAGGTGACA
SO4-Rn AAGACTCTCAGGCTCCTGCTCATTC
NSO mm GTTTGTGGTTTAACAGTGGGAAGGC
SO1 mm GCCTTCCCACTGTTAAACCACAAAC
SO2-mm CTCACCCGCACCCCGACTCCTTCAA
qPCR PRIMER:
Rattus norvegicus
Neat1 AAGGCACGAGTTAGCCGCAAAT
TGTGCACAGTCAGACCTGTCATTC
Malat1 GAAGGCGTGTACTGCTATGCTGTT
TCTCCTGAGGTGACTGTGAACCAA
Gh1 CCGCGTCTATGAGAAACTGAAGGA
GGTTTGCTTGAGGATCTGCCCAAT
PRL TGAACCTGATCCTCAGTTTGGT
AGCTGCTTGTTTTGTTCCTCAA
Mus musculus
Neat1 TGGGCCCTGGGTCATCTTACTAGATA
CACAGCTGTTCCAATGAGCGATCT
Gh1 CTCGGACCGTGTCTATGAGAAACTGA
TTTGCTTGAGGATCTGCCCAACAC
PRL TGAACCTGATCCTCAGTTTGGT
AGCTGCTTGTTTTGTTCCTCAA

Tabell 1: Sekvenser av DNA oligonucleotide prober og qPCR primere

Discussion

Lang noncoding RNAs (lncRNAs) av deres antall og mangfold representerer et stort felt av forskning og de fleste av sine roller er fortsatt å bli oppdaget. Mange av disse lncRNAs har en kjernefysisk lokalisering og blant dem, noen er innblandet i regulatoriske veier av genuttrykk gjennom transcriptional eller posttranscriptional mekanismer. En av de gjeldende utfordringene i dette feltet er å forstå relevansen av de lncRNAs post-transcriptional behandling av RNAs. For dette formålet må RNAs målrettet av lncRNAs identifiseres. Inspirert av tidligere studier fokuserte på sammenslutning av lncRNAs med chromatin, vi utviklet en prosedyre som gjør identifisering av RNAs med en lncRNA. Suksessen til denne protokollen, kalt RNA rullegardinmenyen, er hovedsakelig avhengig to avgjørende skritt, nemlig utformingen av anti-følelse DNA oligonucleotide sonder som måtte spesielt og utelukkende hybridize med lncRNA rundt og forholdene av vev eller cellen fiksering som har å opprettholde dataintegriteten nettverket mellom alle molekylær partnere.

Tidligere publisert protokollene for passordgodkjenning prosedyrer for å isolere et lncRNA sammen med sine tilknyttede chromatin sekvenser (kvitre1,2, diagram3,4). Disse protokollene, var ulike strategier ansatt design anti-følelse DNA biotinylated oligonucleotide sonder. I prosedyren ved å kvitre brukt forfatterne en pool av DNA biotinylated oligonucleotide sonder omfatter hele lengden av lncRNA rundt etter utelukkelse av alle redundante og uspesifikk sonder1,2. I DIAGRAMMET protokollen, forfatterne identifisert områder av lncRNA som er mer tilgjengelig for hybridisering og designet fange oligonucleotides som er rettet mot disse regionene. Disse områdene ble valgt basert på deres RNase-H følsomhet. Faktisk bruker for RNAse-H for å hydrolyze RNAs på nettsteder av RNA-DNA binding, oligonucleotides som hybridize på tilgjengelige områder i lncRNA produsere RNA-DNA hybrider og føre til enzymatisk spalting av lncRNA. Forfatterne valgt tre av disse kandidat fange oligonucleotides og brukte dem i en cocktail3,4.

Prosedyren vi pleide å design anti-følelse DNA biotinylated oligonucleotide sonder var nær som brukes i DIAGRAMMET protokollen, men hybridisering tilgjengelige regionene i den ønskede lncRNA ble ikke valgt basert på deres RNAse-H følsomhet, men Ifølge deres lave sannsynligheten for interne base sammenkobling som bestemmes av bioinformatikk modellering av lncRNA sekundær struktur. Det må være merket at ulike sekundære strukturer vil bli spådd ved hjelp av ulike algoritmer, og sonder velges bør være de som hybridize til tilgjengelig sekvenser av lncRNA i det største antallet sekundære strukturer spådd. De samme resultatene ble oppnådd med enten en cocktail av tre designet, bestemte sonder eller en enkelt sonde individuelt. Dette bedt om bruk av to separate, bestemte sonder og hensynet til positive resultater som de som er felles for disse to sonder. Til slutt, det anbefales derfor begynnelsen av utviklingen av metoden for et optimalt resultat og kunne vurdere spesifisiteten av resultatene av rullegardinmenyen, utforme 3 forskjellige anti-følelse oligonucleotide prober og deretter sammenligne eksperimentelt deres effektivitet, spesielt siden sonden effektivitet kan endres av celle lysate forberedelse. Likevel prosedyren for sonden design basert på bioinformatics modellering av lncRNA sekundær strukturen vi brukte forble billigere enn basert på bassenger med fliser oligonucleotide sonder2, og dette var mindre tidkrevende enn metoden basert på RNAse-H følsomhet4.

En negativ kontroll bør også utføres med som negative fange oligonucleotide enten den forstand DNA biotinylated oligonucleotide sonder eller eggerøre oligonucleotide sonder eller oligonucleotides rettet mot en urelaterte RNA. På grunn av naturlige antisense utskrifter lncRNAs, kan bruk av fornuftig oligonucleotide sonder noen ganger være utilstrekkelig. Uansett oligonucleotide proben valgt for kontrollen negative, er det nødvendig å kontrollere av eksplosjon som det ikke hybridize med en kjent RNA og husk at denne oligonucleotide kan hybridize til en fortsatt un kommenterte lncRNA.

I celle lysates disse RNA rullegardin forsøk ble innhentet fra 106 til 107 celler når du arbeider med kulturperler celler, og fra 1 til 10 mg når du arbeider med vev. Utarbeidelse av celle lysates må tilpasses etter hvilken vev eller cellen brukes to hovedtrinn som må optimaliseres: nemlig cross-linking trinnet som tillater dannelse av kovalente bindinger mellom lncRNA og molekylære partnere, og sonication trinn som reduserer viskositeten av shredding chromatin.

Målet med cross-linking trinnet er å sikre at alle RNA mål forblir lukket for lncRNA ved å indusere dannelsen av et nettverk mellom alle molekylær partnere. En paraformaldehyde behandling trinnet som vil danne kovalente bindinger mellom lncRNA og partnere kan nettverket skal reticulated. I DIAGRAMMET protokollen, ble det foreslått hvis arbeider med kjernefysiske lncRNA, for å utføre en første behandling med paraformaldehyde på hele cellen lysate og en annen behandling på isolerte nukleinsyre brøkdel3,4. Vi observerte at dette supplerende trinnet redusert effektiviteten av sonder, sannsynligvis ved å redusere lncRNA tilgjengelighet i cellene. Dermed graden av reticulation av paraformaldehyde har å tar hensyn til cellen eller vev type brukt, lokalisering av lncRNA rundt, og effektiviteten av designet sonder.

Mens lysing cellene, chromatin er utgitt i den lysate og øker sin viskositet; Det er da nødvendig å makulere chromatin av sonication å øke flyt av prøvene og herav Letter tilgjengeligheten av oligonucleotide sonder til lncRNA av interesse. Sonication vil imidlertid også makulere RNAs utdraget med lncRNA rundt. Det er viktig å minimere sonication tiden slik at mens det effektivt reduserer viskositeten av den lysate, det også tillater obtainment av fragmenter med lengde består mellom 200-800 bp. oppmerksom på at sonication tiden vil være svært avhengig både-antallet og typen vev eller kulturperler celler som brukes.

Avslutningsvis gjør fremgangsmåten beskrevet her på 2-3 dager fangst av RNA mål for en ønsket lncRNA. Sammen med RT-qPCR, kan disse metodene jakt etter en bestemt association og regulering av et mRNA av den ønskede lncRNA som en kandidat. En genomet-bred tilnærming, kan RNA rullegardin eksperimenter analyseres av høy gjennomstrømming RNA-sekvensering tillate henting av alle RNAs knyttet til den ønskede lncRNA. Hva en analytisk strategi, skal RNA rullegardin prosedyren gi nye betydelige kunnskaper om RNA regulering av lncRNAs.

Disclosures

Forfatterne ikke avsløre.

Acknowledgments

Dette arbeidet ble støttet av Aix-Marseille-universitetet og CNRS og finansiert av en bevilgning fra Pfizer laboratorier.

Materials

Name Company Catalog Number Comments
Bioruptor Plus Diagenode B01020001 Sonicator
Dynabeads My One Thermo-Fisher 65001 Magnetic streptavidin beads
Formamide Thermo-Fisher 15515-026
Gel electrophoresis apparatus Advance Mupid-One Gel electrophoresis apparatus
Proteinase K Sigma P2308
RNA XS purification kit Macherey-Nagel 740902 RNA purificationkit
RNAseOUT Thermo-Fisher 10777-019 RNAse inhibitor
Trizol Thermo-Fisher 15596018 RNA purification
Tube Rotator Stuart SB2 Eppendorf tube rotator
RNA to DNA Thermo-Fisher 4387405 Reverse transcription kit
iTaq Universal SYBR Green Supermix BioRad 1725124 qPCR reagent
Applied 7500 Fast Thermo-Fisher 4351107 qPCR apparatus
Illumina TruSeq Stranded mRNA Sample Preparation kit Illumina 20020594 DNA library construction kit
Illumina NextSeq 500 Illumina SY-415-1002 NGS system

DOWNLOAD MATERIALS LIST

References

  1. Chu, C., Qu, K., Zhong, F. L., Artandi, S. E., Chang, H. Y. Genomic maps of long noncoding RNA occupancy reveal principles of RNA-chromatin interactions. Mol Cell. 667-678 (2011).
  2. Chu, C., Quinn, J., Chang, H. Y. Chromatin isolation by RNA purification (ChIRP). J Vis Exp. e3912 (2012).
  3. Simon, M. D., Wang, C. I., Kharchenko, P. V., West, J. A., Chapman, B. A., Alekseyenko, A. A., Borowsky, M. L., Kuroda, M. I., Kingston, R. E. The genomic binding sites of a noncoding RNA. Proc Natl Acad Sci U S A. 20497-20502 (2011).
  4. Simon, M. D. Capture hybridization analysis of RNA targets (CHART). Curr Protoc Mol Biol. Unit 21.25 (2013).
  5. Reuter, J. S., Mathews, D. H. RNAstructure: software for RNA secondary structure prediction and analysis. BMC Bioinformatics. 11, 129 (2010).
  6. Sun, X., Haider Ali, M. S. S., Moran, M. The role of interactions of long non-coding RNAs and heterogeneous nuclear ribonucleoproteins in regulating cellular functions. Biochem J. 2925-2935 (2017).
  7. Gruber, A. R., Lorenz, R., Bernhart, S. H., Neuböck, R., Hofacker, I. L. The Vienna RNA websuite. Nucleic Acids Res. W70-W74 (2008).
  8. Tollervey, J. R., Curk, T., Rogelj, B., Briese, M., Cereda, M., Kayikci, M., König, J., Hortobágyi, T., Nishimura, A. L., Zupunski, V., Patani, R., Chandran, S., Rot, G., Zupan, B., Shaw, C. E., Ule, J. Characterizing the RNA targets and position-dependent splicing regulation by TDP-43. Nat Neurosci. 452-458 (2011).
  9. Riva, P., Ratti, A., Venturin, M. The long non-coding RNAs in neurodegenerative diseases: novel mechanisms of pathogenesis. Curr Alzheimer Res. (27338628), (2016).
  10. Barry, G., Briggs, J. A., Hwang, D. W., Nayler, S. P., Fortuna, P. R., Jonkhout, N., Dachet, F., Maag, J. L., Mestdagh, P., Singh, E. M., Avesson, L., Kaczorowski, D. C., Ozturk, E., Jones, N. C., Vetter, I., Arriola-Martinez, L., Hu, J., Franco, G. R., Warn, V. M., Gong, A., Dinger, M. E., Rigo, F., Lipovich, L., Morris, M. J., O'Brien, T. J., Lee, D. S., Loeb, J. A., Blackshaw, S., Mattick, J. S., Wolvetang, E. J. The long non-coding RNA NEAT1 is responsive to neuronal activity and is associated with hyperexcitability states. Sci Rep. 40127 (2017).
  11. Adriaens, C., Standaert, L., Barra, J., Latil, M., Verfaillie, A., Kalev, P., Boeckx, B., Wijnhoven, P. W., Radaelli, E., Vermi, W., Leucci, E., Lapouge, G., Beck, B., van den Oord, J., Nakagawa, S., Hirose, T., Sablina, A. A., Lambrechts, D., Aerts, S., Blanpain, C., Marine, J. C. p53 induces formation of NEAT1 lncRNA-containing paraspeckles that modulate replication stress response and chemosensitivity. Nat Med. (2016).
  12. Fang, J., Qiao, F., Tu, J., Xu, J., Ding, F., Liu, Y., Akuo, B. A., Hu, J., Shao, S. High expression of long non-coding RNA NEAT1 indicates poor prognosis of human cancer. Oncotarget. (2017).
  13. Torres, M., Becquet, D., Blanchard, M. P., Guillen, S., Boyer, B., Moreno, M., Franc, J. L., François-Bellan, A. M. Circadian RNA expression elicited by 3'-UTR IRAlu-paraspeckle associated elements. Elife. (2016).
  14. Fox, A. H., Lamond, A. I. Paraspeckles. Cold Spring Harbor Perspectives in Biology. Available from: http://cshperspectives.cshlp.org/content/2/7/a000687.long (2010).
  15. Chen, L. L., DeCerbo, J. N., Carmichael, G. G. Alu element-mediated gene silencing. EMBO J. 1694-1705 (2008).
  16. Tripathi, V., Ellis, J. D., Shen, Z., Song, D. Y., Pan, Q., Watt, A. T., Freier, S. M., Bennett, C. F., Sharma, A., Bubulya, P. A., Blencowe, B. J., Prasanth, S. G., Prasanth, K. V. The nuclear-retained noncoding RNA MALAT1 regulates alternative splicing by modulating SR splicing factor phosphorylation. Mol Cell. 925-938 (2010).
  17. Engreitz, J. M., Sirokman, K., McDonel, P., Shishkin, A. A., Surka, C., Russell, P., Grossman, S. R., Chow, A. Y., Guttman, M., Lander, E. S. RNA-RNA Interactions Enable Specific Targeting of Noncoding RNAs to Nascent Pre-mRNAs and Chromatin Sites. Cell. 188-199 (2014).
  18. Nakagawa, S., Ip, J. Y., Shioi, G., Tripathi, V., Zong, X., Hirose, T., Prasanth, K. V. Malat1 is not an essential component of nuclear speckles in mice. RNA. (2012).
  19. Zhang, B., Arun, G., Mao, Y. S., Lazar, Z., Hung, G., Bhattacharjee, G., Xiao, X., Booth, C. J., Wu, J., Zhang, C., Spector, D. L. The lncRNA Malat1 is dispensable for mouse development but its transcription plays a cis-regulatory role in the adult. Cell Rep. 111-123 (2012).
  20. Trapnell, C., Roberts, A., Goff, L., Pertea, G., Kim, D., Kelley, D. R., Pimentel, H., Salzberg, S. L., Rinn, J. L., Pachter, L. Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat Protoc. 562-578 (2012).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics