Una strategia efficace per la generazione di sistemi di trascrizione binario tessuto-specifici in Drosophila genoma modificando

Developmental Biology

Your institution must subscribe to JoVE's Developmental Biology section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Qui, presentiamo un metodo per la generazione di sistemi di trascrizione binario tessuto-specifici in Drosophila , sostituendo il primo esone codifica dei geni con driver di trascrizione. Il metodo basato su CRISPR/Cas9 inserisce una sequenza di transactivator ai sensi del regolamento endogeno di un gene sostituito e di conseguenza facilita transctivator espressione esclusivamente in reticoli spatiotemporal gene-specifico.

Cite this Article

Copy Citation | Download Citations

Du, L., Zhou, A., Sohr, A., Roy, S. An Efficient Strategy for Generating Tissue-specific Binary Transcription Systems in Drosophila by Genome Editing. J. Vis. Exp. (139), e58268, doi:10.3791/58268 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Sistemi di trascrizione binario sono potenti strumenti genetici ampiamente usati per la visualizzazione e manipolazione cellulare destino e l'espressione genica in specifici gruppi di cellule o tessuti in organismi modello. Questi sistemi contengono due componenti distinte linee transgeniche. Un'autista linea esprime un attivatore trascrizionale sotto il controllo di promotori tessuto-specifici/Enhancer, un reporter/effettrici linea porticcioli e un gene bersaglio posizionato a valle per il sito di legame dell'attivatore di trascrizione. Animali che harboring entrambi i componenti inducono la transattivazione di tessuto-specifica di un'espressione di gene di destinazione. Spazio-temporale precisa espressione del gene in tessuti mirati è critica per interpretazione imparziale dell'attività del gene e delle cellule. Di conseguenza, lo sviluppo di un metodo per la generazione di linee di esclusivo cellula/tessuto-specifico driver è essenziale. Qui presentiamo un metodo per generare il sistema di espressione mirati altamente tessuto-specifica con l'ausilio di un "cluster regolarmente Interspaced breve palindromi Repeat/CRISPR-associated" (CRISPR/Cas)-base tecnica di editing genomico. In questo metodo, l'endonucleasi Cas9 è bersagliato da due chimerico guida RNAs (gRNA) a siti specifici nel primo esone codifica di un gene nel genoma della drosofila per creare rotture a doppio filamento (DSB). Successivamente, utilizzando un plasmide di donatore esogeno contenente la sequenza di transactivator, il macchinario di riparazione delle cellule-autonoma consente il ripristino diretto di omologia (HDR) del DSB, con conseguente eliminazione precisa e sostituzione dell'essone con il transactivator sequenza. Il transactivator bussò-in è espresso esclusivamente in cellule dove il cis-elementi regolatori del gene sostituito sono funzionali. Il protocollo dettagliato passo-passo qui presentato per la generazione di un driver binario trascrizionale espresso in Drosophila fgf/prive-producendo le cellule epiteliali/neuronali può essere adottato per qualsiasi espressione di gene - o tessuto-specifico.

Introduction

Casella degli strumenti genetico per espressione genica mirata è stato ben sviluppato in Drosophila, che lo rende uno dei migliori sistemi di modello per studiare la funzione dei geni coinvolti in un'ampia varietà di processi cellulari. Sistemi di espressione binaria, come il lievito Gal4/UAS (sequenza di attivazione a Monte), fu adottato per risultati di intrappolamento e gene tessuto-specifici enhancer in Drosophila modello genetico1 (Figura 1). Questo sistema ha facilitato lo sviluppo di un gran numero di tecniche come la regolazione spazio-temporale della sovraespressione genica, risultati, Ko in gruppi selezionati di cellule pure come ablazione delle cellule, cellule marcatura, tracciatura dal vivo di cellulari e molecolari processi in embrione e tessuti, lignaggio traccia e analisi di mosaico durante lo sviluppo. Un numero del sistema binario trascrizione, ad esempio il batterica LexA/LexAop system (Figura 1) e Neurospora Q-system, sono potenti strumenti genetici che ora sono ampiamente usati in Drosophila, oltre a l'originale sistema Gal4/UAS per gene bersaglio espressione1,2,3.

Qui, presentiamo un metodo per generare il sistema altamente affidabile tessuto-specifica espressione binaria impiegando una tecnica di modifica del genoma. I recenti progressi nella tecnologia di editing CRISPR/Cas9 genoma hanno permesso opportunità senza precedenti per apportare modifiche di genoma diretto in una vasta gamma di organismi. Rispetto ad altre tecniche di editing disponibili genoma, il sistema CRISPR/Cas9 è economico, efficiente e affidabile. Questa tecnologia utilizza componenti del sistema immunitario adattativo batterico: un'endonucleasi di Cas9 di Streptococcus pyogenes che crea una rotture a doppio filamento (DSB) e un RNA chimerico guida (gRNA), che guida il Cas9 a un sito particolare genoma per mirati DSB4. Le cellule contengono i macchinari per riparare il DSB utilizzando percorsi diversi. Non-omologa fine unirsi (NHEJ) conduce a piccoli inserimenti o eliminazioni di perturbare la funzione del gene, mentre riparazione omologia-diretto (HDR) introduce un definito diretto/desiderabile genomico knock-in/knock-out utilizzando un donatore HDR esogeno come modello. La strategia di sostituzione basato su HDR possa essere utilizzata in modo efficiente per generare un sistema altamente affidabile espressione binaria di tessuto-specifici, in grado di superare tutte le limitazioni dei metodi tradizionali enhancer trap. Descriviamo una procedura dettagliata per l'utilizzo di riparazione basato su CRISPR/Cas9 HDR nella generazione di una linea di driver binario trascrizione che si esprime sotto il controllo del regolamento endogeno trascrizionale e di un di Drosophila gene. In questo protocollo, dimostriamo la generazione di una linea di driver specifica per prive (bnl) gene codifica per una proteina di famiglia di FGF che regola la morfogenesi di ramificazione della via aerea tracheale epitelio5. In questo esempio, il primo esone codifica del gene di bnl è stato sostituito dalla sequenza di una sequenza di transactivator LexA batterica senza alterare qualsiasi endogeno cis-sequenze regolarici del gene di bnl . Mostriamo che la strategia generato una linea di driver di bnl-LexA che spatiotemporally controlla l'espressione di un gene del reporter posizionato a valle di LexAoperator (LexAop o LexO) esclusivamente in bnl- che esprimono le cellule epiteliali/mesenchymal/neuronali.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. progettare e costruire il gRNA vettore di espressione

  1. Per appunto sostituire una regione lungo definita di un esone, utilizzare una gRNA doppio approccio6, in cui ogni gRNA puoi indirizzare specificamente due estremità dell'area di interesse selezionata. Per ottenere un'accurata espressione spatiotemporal gene-specifico del driver, selezionare due siti di destinazione gRNA entro il primo esone codifica del gene.
  2. Per Drosophila melanogaster, selezionare i siti di destinazione gRNA utilizzando lo strumento ottimale Target Finder flyCRISPR (http://tools.flycrispr.molbio.wisc.edu/targetFinder/). Altri strumenti di progettazione CRISPR disponibile possono essere utilizzati anche, tra cui lo strumento ottimizzato CRISPR Design (http://crispr.mit.edu), FlyCas9 (https://shigen.nig.ac.jp/fly/nigfly/cas9) ed E-CRISP (www.e-crisp.org/E-CRISP).
    Nota: I seguenti protocolli di gRNA design e clonazione è stata adottata da metodi precedentemente descritti6,7.
    1. Copiare la sequenza effettiva nella casella fornita nello strumento online. Selezionare la più recente pubblicazione Drosophila melanogaster genoma annotazione versione, "r_6," nel menu a discesa per "Select genoma." La "Guida selezionare lunghezza del campo (nt)," l'input "20". Selezionare questa opzione per trovare "Tutti CRISPR obiettivi" e fare clic su "Trova CRISPR obiettivi".
    2. Valutare tutti i bersagli di gRNA candidato impostando "Massimo" per "Rigore" e "NGG solo" per "PAM". Provare a selezionare i siti di gRNA senza qualsiasi potenziale off-target o un numero minimo di possibili off-target. Utilizzare lo strumento di web descritto in Doench et al 2014 8 per selezionare gRNAs con un punteggio di "buona" attività potenziali.
    3. Contemporaneamente, assicurarsi che non ci sia nessun polimorfismo a singolo nucleotide negli obiettivi gRNA nel genoma della linea fly padre selezionato per iniezione (Ad es., nos-Cas9 sul cromosoma X, BL # 54591). Seguire il protocollo descritto in Gratz et al 20157 per estrarre il DNA genomico dalla linea di volo del padre. PCR amplificano, circa, 500 – 1.000 nt regioni utilizzando primers che fiancheggiano la sequenza di interesse e una polimerasi del DNA ad alta fedeltà; sequenza-verificare i prodotti PCR amplificati.
  3. Per la generazione di un vettore di espressione gRNA tandem, seguire un protocollo clonazione legatura-indipendente6 per introdurre due sequenze di protospacer in un vettore di espressione di RNA pCFD4. Si noti che un vettore di espressione migliorata multi-gRNA (pCFD5) è ora disponibile, dove entrambi i sgRNAs sono espressi dal forte U6:3 promotori9 (https://www.crisprflydesign.org). Utilizzare un metodo di assemblaggio di DNA per clonare il gRNAs nel vettore pCFD4.
    1. Progettare e ordinare i primer forward e reverse per introdurre due sequenze di protospacer la pCFD4 di vettore di espressione RNA (tabella 1A). Come descritto in precedenza6, il primer forward contiene la prima sequenza di protospacer fiancheggiata da regioni corrispondenti per il promotore U6-1 e gRNA core in pCFD4; il primer reverse contiene la sequenza inversa complemento del secondo protospacer fiancheggiato da regioni corrispondenti al nucleo gRNA e promotore di U6-3 in pCDF4.
    2. Risospendere primer a 100 μM con DNasi e RNAsi-libera doppia acqua distillata (ddH2O). Rendere un primer di concentrazione di 10 μM lavoro. Utilizzare pCFD4 plasmide come modello e impostare la reazione di PCR utilizzando una polimerasi ad alta fedeltà e impostazioni consigliate per PCR reazione6.
    3. Per clonare il prodotto amplificato in pCFD4, digerire pCFD4 plasmide con enzima BbsI impostando la seguente reazione: 2 – 5 μg di pCFD4 plasmide, 5 μL di tampone di digestione 10x, 1 μL di enzima BbsI e ddH2O per portare il volume finale di 50 μL. Mescolare il contenuto di reazione delicatamente toccando il tubo e raccogliendo tutte le goccioline sparse dalla parete del tubo verso il basso da un breve giro. Incubare a 37 ° C per 2 h, la miscela di reazione.
    4. Eseguire il prodotto PCR dal passaggio 2 e il digestato prodotto dal passaggio 3 su un gel di agarosio 1%. Eseguire l'elettroforesi per un tempo sufficiente separare completamente le bande di DNA. Taglio le corretta dimensioni bande di DNA sotto un trans-illuminatore UV prima di purificare i prodotti attesi utilizzando la colonna di gel di eluizione seguendo le istruzioni del fabbricante (Vedi Tabella materiali). Il prodotto PCR dovrebbe essere 600 bp e il plasmide linearizzato pCFD4 dovrebbe essere ~6.4 kb 6.
    5. Impostare la reazione di assemblaggio di DNA in un tubo di PCR, per le istruzioni del fabbricante (Vedi Tabella materiali).
    6. Trasformare 2 μL del prodotto Assemblea in batteri competenti (DH5α o ceppi simili con ΔrecA1, ΔendA1), piastra su ampicillina (100 μg/mL) contenente piatti agar della libbra (LB/Amp) e incubare a 37 ° C durante la notte. Si noti che il mix di assemblaggio del DNA potrebbe essere tossico per alcuni ceppi di batteri, ma diluire il mix di assemblaggio può ridurre la tossicità.
    7. Scegliete 3 – 4 colonie ampicillina-resistente dalla piastra incubate overnight, inoculare la Colonia in 3ml LB contenente 100 ampicillina μg/mL e crescere batteri inoculati in uno shaker di 37 ° C durante la notte. Estrarre il plasmide dai batteri durante la notte-coltivati utilizzando il kit di mini-preparazione del plasmide seguendo le istruzioni del fabbricante (Vedi Tabella materiali).
    8. Sequenza i plasmidi con il primer universale T3 alla schermata per i cloni corretti contenente l'inserimento di gRNA tandem. Stabilire uno stock di glicerolo di batteri trasformato con una sequenza-verificato pCFD4-gRNA in 20% glicerolo e conservare in un congelatore-80 ° C per un uso futuro.

2. progetta e costruisce il donatore HDR

  1. Per knock-in genomica di una sequenza Gal4 o LexA , progettare un donatore HDR doppio filamento contenente la sequenza di transactivator fiancheggiata da due braccia di omologia.
    1. Uso > 1,5 kb lasciato e braccia di omologia destra fiancheggiando il gRNA targeting site. Estesa omologia braccia aumentano l'efficienza di HDR durante il processo di riparazione 10.
    2. PCR amplificano le braccia di omologia dal DNA genomico (gDNA) estratti dalla linea di volo di padre selezionata per iniezione (Ad es., nos-Cas9 (sul cromosoma di X), BL # 54591). Usano un avviamento a caldo bozze Taq DNA polimerasi enzima adatto per lunga estensione di PCR (Vedi Tabella materiali). Sequenza-verificare.
  2. Per evitare di retargeting di gRNA al locus ingegnerizzati, progettare il donatore di sostituzione in modo che i siti di riconoscimento gRNA sono interrotti dalla sequenza esogena introdotta.
    Nota: per evitare di alterare gli elementi cis-regolatori putativi, selezionare sempre i siti di riconoscimento gRNA entro la regione di esone codificante.
  3. Per la generazione di una cassetta di ricambio, pianificare la strategia di DNA assieme per unire quattro segmenti: il 5' e 3' armi di omologia, la sequenza di DNA centrale transactivator esogeno e la clonazione linearizzato vettore backbone (ad es., pUC19 o altro comunemente usati vettori di clonazione). Indicazioni del produttore per l'assemblaggio di DNA (Vedi tabella materiali), progettare il primer adatto per il montaggio di ogni segmento e l'amplificazione di PCR. Risospendere primer a 100 μM con ddH2O. Make un primer di concentrazione di 10 μM lavoro. Utilizzare della polimerasi ad alta fedeltà per tutte le reazioni di PCR. Seguire il seguente protocollo:
    1. PCR amplificano una cassetta di espressione Gal4 o LexA da un vettore disponibile (per esempio, nls-LexA:p65; i plasmidi di espressione Gal4/LexA/QF2 ideali possono essere trovati e ottenuti da risorse comuni quali Addgene) utilizzando la Primer elencati nella tabella 1B.
      1. Per mantenere tutti i regolamenti trascrizionali e originali dell'essone sostituito sull'espressione di sequenza del DNA di transactivator, progettare la cassetta in modo che l'allele di genomica modificato esprimerebbe un mRNA chimerico della transactivator ed il gene. Preservare l'estremità 5' e 3' dell'essone mirato a mantenere qualsiasi segnale d'impionbatura.
      2. Incorporare una sequenza del peptide self-che fende T2A tra il residuo 5' dell'esone e la sequenza di transactivator per impedire la traduzione in una proteina chimerica di codifica. Aggiungere un codone di arresto traduzione dopo la sequenza di transactivator esogena (Figura 5).
    2. PCR amplificano le braccia di omologia dal DNA genomico (gDNA) estratti dalla linea di volo di padre selezionata per iniezione (Ad es., nos-Cas9 (sul cromosoma di X), BL # 54591) utilizzando i primers elencati nella tabella 1B. Utilizzare della polimerasi ad alta fedeltà per tutte le reazioni di PCR usando i sistemi come segue: 5 μL di tampone di reazione, 0,5 μL di dNTPs 10mm, 1.25 μL 10 μm: 5x Forward Primer, 1.25 μL 10 μm Reverse Primer, 0,5 μL di DNA del modello, 0.25 μL di polimerasi del DNA ad alta fedeltà , 16.25 μL di ddH2O.
    3. Utilizzare il vettore linearizzato clonazione come pUC19. Un numero di vettori di donatore è ora disponibile. Visualizzare un elenco completo presso il seguente sito Web-http://flycrispr.molbio.wisc.edu.
    4. Eseguire i prodotti PCR su un gel di agarosio 1%. Eseguire l'elettroforesi per un tempo sufficiente a garantire una netta separazione della banda desiderata dalle fasce non specifiche indesiderate (se presente). Gel-purificare i frammenti di DNA previsti. Misurare la concentrazione di ogni frammento di DNA purificato utilizzando uno spettrofotometro.
    5. Impostare la reazione di assemblaggio di DNA seguendo le istruzioni del fabbricante. Mescolare i frammenti di vettore e destinazione clonazione linearizzati dal passaggio 3 e passaggio 4 nella reazione seguente: 1 μL di lineare clonazione vettoriale (50 ng/μL), 2 – 3 volte eccesso di ogni frammento di destinazione, 10 μL di 2 x mix master Assemblea di DNA, portare il volume di reazione finale di 20 μL con ddH < C21 > 2O. Incubare il mix di reazione per 1 ora a 50 ° C.
    6. 2 μL del prodotto Assemblea si trasformano in batteri competenti, piastra su piastre di agar LB/Amp contenente 100 ampicillina μg/mL. Inoltre, aggiungere il X-Gal + IPTG sulla piastra per lo screening blu/bianco.
    7. Scegliete 3 – 4 colonie bianchi dalla piastra incubate overnight, inoculare la Colonia in 3ml LB contenente 100 ampicillina μg/mL e crescere a 37 ° C durante la notte in uno shaker. Manuale del plasmide estratto dai batteri durante la notte-coltivati utilizzando il kit di mini-prep plasmide seguendo il produttore (Vedi Tabella materiali).
    8. Schermo della Colonia positivo di PCR o restrizione digestione.
    9. Sequenza di verificare la regione di donatore HDR del plasmide finale. Salvare uno stock batterico trasformato con i cloni corretti in 20% glicerolo a-80 ° C per inoculazione futuro.

3. embrione iniezione, Vola genetica e Screening per l'Editing genomico

  1. Preparare l'alta vettore di espressione di purezza gRNA endotossina-libero, come pure il plasmide di donatore HDR utilizzando un plasmide maxiprep kit (Vedi Tabella materiali).
  2. Co-iniettare il plasmide di espressione gRNA (100 ng/μL) e il donatore di sostituzione (500 ng/μL) nella linea germinale di nos-Cas9 embrioni6. Nota: utilizziamo un servizio commerciale per iniezione, ma questa procedura può essere eseguita in laboratorio pure.
  3. Volare la genetica e screening (Figura 2 e Figura 3):
    1. Quando gli embrioni iniettati si sviluppano in adulti, attraversare ogni singolo G0 Vola bilanciatore mosche. Selezionare bilanciamento adatto per il cromosoma che contiene l'allele mirato.
    2. Anestetizzare la F1 prole da ogni G0 attraversare su un pad di CO2 e scegliere casualmente 10-20 maschi sotto un microscopio stereoscopico. Li attraversano individualmente per le femmine di bilanciamento come mostrato nella Figura 3.
    3. Quando il portello di larve di F2, scegliere il padre single di F1 da ogni croce ed estrarre gDNA utilizzando il singolo volare genomic DNA protocollo di preparazione:
      1. Preparare il tampone di estrazione gDNA: 10 mM Tris-Cl a pH 8.2, 1 mM EDTA, 25 mM NaCl, conservare a temperatura ambiente. Preparare 20 mg/mL soluzione di riserva di proteinasi K e conservare in freezer.
      2. Mettere ogni Mosca in una provetta da 1,5 mL micro-centrifuga ed etichettare la provetta. Tenere nel congelatore-80 ° C durante la notte.
      3. Preparare un volume di lavoro fresco di tampone di estrazione gDNA contenente 200 µ g/mL concentrazione finale di proteinasi K.
        Nota: Non utilizzare un vecchio buffer per questo passaggio.
      4. Schiacciare ogni Mosca per 10 – 15 s con un puntale contenente 50 μL di schiacciamento buffer senza erogazione del liquido. Dispensare il buffer rimanente nella provetta e mescolare bene. Incubare a 37 ° C per 20-30 min.
      5. Mettere i tubi in blocco di calore di 95 ° C per 1 – 2 min inattivare la proteinasi K.
      6. Rotazione verso il basso per 5 min a 10.000 x g. Memorizzare la preparazione a 4 ° C per ulteriori analisi PCR.
  4. Utilizzare lo stesso metodo per preparare gDNA da una Mosca di nos-Cas9 , che serve come controllo negativo. Eseguire schermi PCR basato su tre fasi per identificare il corretto "termina" HDR (Figura 2, Figura 5) utilizzando gDNA di ogni uomo di F1 come un modello5. Utilizzare 1 μL della preparazione di DNA nel seguente sistema di reazione di PCR: 10 μL di 2 x PCR Master Mix con tintura, 1 μL di ogni primer (10 μM), 1 μL della mascherina del DNA e 7 μL di ddH2O.
  5. Come mostrato in Figura 5A, eseguire PCR con primer fwd1 e rev1 alla schermata per l'esistenza dell'inserimento o la sostituzione; Eseguire PCR utilizzando primers fwd2 e rev2 per verificare l'inserimento o la sostituzione da 3' regione; Eseguire PCR utilizzando primers M13F e rev3 per controllare "termina in" HDR (tabella 1).
  6. Mantenere le linee di volare con il confermato HDR di estremità-out e stabilire equilibrate scorte della generazione F2. Outcross per le mosche di bilanciatore nuovamente per rimuovere eventuali mutazioni indesiderate su altri cromosomi.
  7. Preparare gDNA di alta qualità provenienti dalle scorte stabilite per l'amplificazione PCR lunga (> 800 – 1.000 nt) ampliconi con alta fedeltà Taq polimerasi e completamente sequenza verificare gli ampliconi ottenuti dalle regioni genomiche ingegnerizzate. In alternativa, utilizzare gDNA greggio estratto come descritto in precedenza per amplificare più brevi (< 800 nt), sovrapposizione di prodotti di PCR per sequenza-convalidare il genoma modificato. Per preparare il DNA genomic di Drosophila di buona qualità, utilizzare il seguente protocollo:
    1. Mettere circa 25 mosche adulte in una microcentrifuga da 1,5 mL e congelare nel congelatore a-20 ° C o da-80 ° C per almeno 1 ora.
    2. Aggiungere 250 µ l di soluzione A (pH 9.0 Tris HCl 0,1 M, EDTA 0,1 M, SDS 1%).
    3. Omogeneizzare le mosche usando l'omogeneizzazione pestelli in microcentrifuga e mettere il tubo sul ghiaccio.
    4. Incubare a 70 ° C per 30 min.
    5. Aggiungere 35 μL di KOAc (5 M), agitare e mescolare bene, ma fare non vortice.
    6. Incubare in ghiaccio per 30 min.
    7. Rotazione a 12.000 x g per 15 min.
    8. Con una micropipetta da 1 mL, attentamente trasferire solo il sovranatante chiaro ad un nuovo tubo, lasciando indietro qualsiasi precipitato o interfase.
    9. Aggiungere 150 μL di isopropanolo al supernatante. Mescolare delicatamente per inversione.
    10. Girare a 10.000 x g per 5 min.
    11. Con attenzione rimuovere il supernatante e lasciare il pellet nel tubo.
    12. Lavare la pallina con 1 mL 70% EtOH.
    13. Spin a 12.000 x g per 5 min.
    14. Eliminare il surnatante. Asciugare all'aria il pellet per 15-20 min. Non asciugare oltre il pellet.
    15. Dissolva la pallina in 100 μL di ddH2O.
    16. Utilizzare ad alta fedeltà della polimerasi di DNA adatta per lungo amplicone (> 800 bp) per amplificare la regione cura completa. Idealmente, prendere due iniettori fuori la cassetta inserita per amplificare la regione genomica. Gel di purificare il prodotto PCR, e come descritto in precedenza, la sequenza di verificare il prodotto con multipli sovrapposti gli iniettori.
  8. Convalidare i modelli di espressione spatiotemporal corretta da embrioni e tessuti dissecati delle linee volare derivati dal:
    1. Eseguire RT-PCR da RNA totale per verificare l'espressione del mRNA ibrido prodotto (tabella 1).
    2. Eseguire un'ibridazione in situ del prodotto mRNA dell'interesse in tessuti/embrione larvale per convalidare l'espressione.
    3. A schermo per i modelli accurati tessuto-specifici spatiotemporal espressione tra le linee di estremità-out sequenza-verificato, attraversare ciascuna delle righe modificate ottenuti per il driver di espressione binaria con il LexO- GFP o LexO- RFP (per LexA driver) linea (disponibile presso i centri di stock di Bloomington) e osservare la LexA o Gal4 guidato espressione del gene del reporter in tessuti larvali e adulti di embrione, microscopio a fluorescenza.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Questo protocollo è stato usato con successo per generare un sistema specifico di espressione binaria mirati reporter per bnl che esprimono le cellule5. Il cis-elementi regolatori (CREs) che controllano l'espressione complessa spatiotemporal bnl non sono caratterizzati. Pertanto, per raggiungere spatiotemporal espressione sotto il controllo della sequenza regolamentazione endogeno bnl , solo il primo esone codifica di bnl è stato progettato per essere sostituito con la sequenza del transactivator LexA batterica. È stata selezionata una cassetta migliorata nls-LexA::p65 conosciuta per offrire un'espressività ottima in drosofila .

La strategia di sostituzione finalizzata a generare un chimerico nls-LexA:p65-bnl mRNA sotto controllo post-trascrizionale e post-trascrizionali endogeno. Questo mRNA chimerico conteneva un intatto bnl 5' UTR, parte dell'estremità 5' e l'estremità 3' del modificato bnl codifica esone (primo esone) e il completo a valle bnl introni e gli esoni. Per preservare l'impionbatura di bnl RNA-specifico dell'essone sostituito, piccolo 5' e 3' estremità dell'essone codifica sostituito sono state mantenute. Tuttavia, per impedire la sintesi di una proteina chimerica di Bnl fusa a nls -LexA: p65, un T2A self-che fende sequenza del peptide è stato incorporato tra il residuo 5' bnl codifica regione e l'ATG di nls-LexA:p65. Inoltre, un codone di arresto di traduzione è stato aggiunto dopo la nls-LexA:p65 sequenza per evitare la co-traduzione di un tronco Bnl proteina5 (Figura 4 e Figura 5A).

Un donatore di ricambio contenente tutte queste caratteristiche è stato usato, che ha avuto il T2A-nls-LexA:p65 braccia di omologia di sequenza e 2 kb 5' - e 1,8 kb al 3' -. Armi lunghe omologia sono stati utilizzati per HDR efficiente e l'inserimento di un grande frammento di DNA presso il sito di riparazione (T2A-nls-LexA:p65 è 1.8 kb) (Figura 5A).

Due gRNAs sono stati utilizzati per creare DSBs alle posizioni definite per eliminare la maggior parte del primo esone codifica di bnl. Due gRNAs che ha trovato tutti i criteri descritti nella sezione 1.3 (sequenza di PAM ha sottolineato) erano:
gRNA1: TGTATCTGCGATGCCCCTCATGG
gRNA2: ATCCTTCAGATATTGCGGGATGG

Entrambi siti di riconoscimento gRNA sono stati interrotti nel donatore sostituzione di esogeno T2A-nls-LexA:p65 sequenza, che è il modo più semplice per evitare di retargeting di gRNAs al locus ingegnerizzati. Le sequenze di riconoscimento gRNA interrotte nel donatore di sostituzione (le sequenze esogene che hanno sconvolto il gRNA siti di riconoscimento in corsivo) erano:
gRNA1: TGTATCTGCG -GGCTCCGGCGAAGGAC...
gRNA2:... AAAAACTCGTTTAGA- CGGGATGG

Il vettore di espressione pCFD4 gRNA contenente questi gRNAs, insieme con il donatore di sostituzione, è stato co-iniettato nella linea germinale di nos-Cas9 embrioni. Successivamente, è stato seguito il protocollo descritto qui alla schermata per la prevista sostituzione (figura 5B, C). Circa il 67% di iniettato G0 animali erano fertili. E 56% del G0s fertile furono i fondatori, che ha dato origine alla progenie di HDR-positivi. Tra la progenie F1 controllata, circa il 23% risultavano positivi per successo HDR, e 73% del HDR positivo "estremità-out" (tabella 2). Poiché la prima codificazione essone di bnl è stato "eliminato", tutte le linee HDR sono state trovate per essere omozigotico mortale e le scorte sono stati mantenuti sopra bilanciatori.

La generazione di un mRNA chimerico LexA-bnl nelle cellule è stata convalidata da analisi di RT-PCR (Figura 5). Per verificare se l' ottenuti bnl-LexA linee erano espresse nel modello di espressione endogena bnl , ogni riga HDR "estremità-out" è stato attraversato LexO-mCherryCAAX mosche transgeniche5e il modello di espressione del reporter è stata esaminata la progenie embrioni e le larve. 42 su 46 linee ha mostrato l'espressione spatiotemporal accurato coerente con i modelli precedentemente segnalati bnl 5 (Figura 6). Quattro linee ha mostrato entrambi i modelli di espressione debole o non specifici. Prevediamo che queste linee potrebbero hanno accumulato le mutazioni, che abbiamo bisogno di verificare con analisi di sequenziamento approfondita. Insieme, questi risultati hanno confermato che la strategia di sostituzione essone HDR-mediata potrebbe essere impiegata con successo per generare un sistema di espressione binaria mirati per un gene. Lo strumento può essere utilizzato con successo per esprimere reporter o geni ectopici nei modelli spatiotemporal del gene di bnl .

Figure 1
Figura 1: schema di un sistema di trascrizione binario per espressione genica mirata. Un transactivator (GAL4 o LexA), espresso sotto il controllo di cis-elementi regolatori (CREs) di un gene, spinge un transgene effettore posto a valle delle sedi del legame di trascrizione specifici (UAS per Gal4 o LexAop per LexA). Clicca qui per visualizzare una versione più grande di questa figura.

Figure 2
Figura 2: una panoramica del flusso di lavoro per CRISPR/Cas9-mediata del genoma di editing per generare un sistema di trascrizione binario. È indicata la durata di tempo approssimativo necessaria a ogni passo. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 3
Figura 3: un'illustrazione di CRISPR screening e genetica croce schema per stabilire linee di volare genoma-modificato. In incroci genetici, R sta per l'allele modificato che è sul cromosoma 3rd . MKRS (MRS Tp (3; 3), M (3) 76A kar [1] [1] ry [2] Sb [1]), è un indicatore del cromosoma 3rd ; TM6B (In TM6B (3LR), Antp [Hu] e [1] Tb[1]) è un servizio di bilanciamento del cromosoma 3rd . Scorte volare genoma modificato vengono verificate mediante PCR amplificando le regioni di destinazione di interesse da parte del DNA genomic estratto dalle mosche generazione F2 o F3 e determinare i prodotti PCR di sequenza. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 4
Figura 4: generazione della cassetta sostituzione dall'Assemblea DNA. Un disegno schematico raffigurante l'amplificazione di PCR e l'assemblaggio di diversi prodotti di PCR (a, b e c) nel vettore di donatore (d) utilizzando un metodo di assemblaggio di DNA. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 5
Figura 5: Generazione di bnl-LexA da sostituzione di essone CRISPR/Cas9-mediata. (A) disegno raffigurante la strategia di CRISPR/Cas9 schematico mediata HDR per la sostituzione di essone in luogo del bnl . Casella - esone; linea-introne; donatore di sostituzione (pDonor -bnl:LexA) e due possibili esiti del HDR sono stati indicati. Il pDonor -bnl:LexA aveva le seguenti caratteristiche: (1)T2A-nls-LexA:p65 (~1.8kb) sequenza affiancato da 2 kb e kb 1,8 braccia lungo omologia (linee tratteggiate), (2) un peptide self-che fende T2A tra il residuo essone terminale bnl N e il NLS-LexA:p65e (3) un codone di arresto di traduzione (rosso *) dopo il nls-LexA:p65 sequenza. Il prodotto HDR mantenuto tutto il controllo post-trascrizionale e post-trascrizionali di bnle il LexA: proteina p65 dovrebbe essere prodotta nello stesso modello come endogeno Bnl. piccolo nero frecce indicano i siti di legame relativo (non in scala) dei primer PCR (tabella 1) utilizzato per la selezione di 3 fasi o convalida di RT-PCR. (B) gel dell'agarosi immagini che mostra i risultati dello screening PCR 3-passo. Prodotti della PCR amplificati da DNA genomic di quattro linee di HDR estremità-out successo sono mostrati; controllo negativo, il DNA genomico di nos-Cas9 linea parentale; controllo positivo, pDonor -bnl:LexA del plasmide; M, marcatore (SL2K DNA ladder). (C) un esempio del gel lo screening mostrando il prodotto previsto di PCR utilizzando primers M13F e rev3 per linee di estremità; 7-M8 e M9-6 sono due estremità-in linee; controlli positivi e negativi, come in B; M, marcatore (NEB 1 kb DNA ladder). (D) analisi di RT-PCR su RNA totale da bnl-LexA e il controllo di nos-Cas9 vola. Forward primer si lega a una regione specifica di LexA , reverse primer si lega ad una regione di esone a valle bnl ; ~ banda di amplificazione 440 bp (base-accoppiamenti) (*) è stata rilevata da RT-PCR su bnl-LexA mRNA, ma non dal controllo del RNA. M, 100 bp Marker (NEB). Adattato da figure 2 e S1 a Du et al. 20175. Clicca qui per visualizzare una versione più grande di questa figura.

Figure 6
Figura 6: Convalida dell'espressione tessuto-specifica e condizionale bnl-LexA in tessuti differenti. (A-D) espressione di bnl (rosso) in tessuti larvali differenti, con il btl che esprimono le cellule colorate in verde. (A, A') Fonte di bnl ala disco davanti il primordio aria sac crescente (ASP). (B, C) espressione di BNL in TR5 trasversa connettivo (TC) (B) e ramo dorsale TR2 (DB) (C). (D) espressione di bnl in dischi genitale. (E-J) Espressione dinamica bnl (rosso) durante il patterning embrionale ramo tracheale (verde); Piccole frecce, cinque fonti di bnl che circondano il placode trachea in fase 10. Genotipi: A-J; BTL-Gal4, sup- CD8GFP / +; bnl-LexA, LexO- CherryCAAX /+. (K-L ") Ipossiaindotto il profilo di espressione di bnl-LexA in dischi di ala e associati TR2 trachea metamero (TC, DB, tronco dorsale-DT). Genotipo: bnl-LexA, LexO -CherryCAAX / +. (K) controllo dischi da ex vivo coltivate organi senza CoCl2. Dischi di ala (L-L") (L, L') e trachea (DT, (L cm)) da organi colta ex vivo con CoCl2 indotta da ipossia. Stelle, ectopico espressione indotta da ipossia. Scala bar = 30 µm; 50 µm (K-L"). Adattato da Figura 3 a Du et al. 20175. Clicca qui per visualizzare una versione più grande di questa figura.

A. gRNA clonazione e sequenziamento
BNL-lexA gRNA fwd TATATAGGAAAGATATCCGGGTGAACTTCg TGTATCTGCGAT
GCCCCTCAGTTTTAGAGCTAGAAATAGCAAG
BNL-lexA gRNA rev ATTTTAACTTGCTATTTCTAGCTCTAAAAC TCCCGCAATATCTGAAGG
PRESSOcGACGTTAAATTGAAAATAGGTC
T3 primer utilizzati per il sequenziamento CAATTA ACCCTCACTAAAGG-3'
Nota: nucleotidi sottolineati temprano U6 promotore o gRNA core sul vettore di pCFD4, il g/c minuscola è stato aggiunto per aiutare la trascrizione promotore-dipendente U6
Costruzione di donatore B. HDR
BNL N-F_pUC19 AATTCGAGCTCGGTACtgtggtctttgaggctggaac
BNL-lexA-N-R tCCGcaagtCagtAGgctgccgcgtccttcgccggaGCC CGCAGATACAAGGCCC
C
lexA-F CTactGacttgCGGaGAtGTcGAaGAGAACCCtGGCCCt ATGCCACCCAA
GAAGAAGC
lexA-R CTAAACGAGTTTTTAAGCAAACTCACTC
BNL lexA-C Fwd TAAAAACTCGTTTAGACGGGATGGCGTTGTCAAC
BNL: C-R_pUC19 GCCAAGCTTGCATGCCtcgcataattgccgcctgg
Nota: nucleotidi nel capitale si sovrappongono con vettore pUC19 per Gibson Assembly, nucleotidi ha sottolineati erano sporgenza di sequenza per aggiunta di peptide T2A.
C. sequenziamento e HDR screening
BNL-lexA scr fwd1 GTGGCGCACGCCCAATAAAC
BNL-lexA scr rev1 GATCCCAGCCAATCTCCGTTG
BNL-lexA scr fwd2 CAACGGAGATTGGCTGGGATC
BNL-lexA scr rev2 CTGGCCAACTGTAGGGAAGTC
estremità-in controllo rev3 GCAATGTTATGCAATGCGTTGAC
BNL-lexA seq fwd3 CACTTGTCGCCCATATTGATACAATTG
Nota: Questi iniettori sono stati usati per la PCR di screening e sequenziamento, la posizione approssimata di siti di legame del primer sono mostrata in Figura 5A come fwd1-2 e rev1-3.
D. l'analisi di RT-PCR
RT-f GATATGGATTTCTCCGCTTTGCTG
RT-r CCATGCAGAGATACAGGCAAGTG

Tabella 1: primer usati in questo studio. (A) iniettori per la clonazione gRNA vettore di espressione e sequenziamento. (B) gli iniettori per la clonazione modello donatore HDR. (C) primer per lo screening e l'ordinamento dei prodotti HDR. (D) primer usati per la verifica di RT-PCR del prodotto di mRNA chimerico di LexA-bnl .

genotipo Tasso di trasmissione di HDR % (# HDR-rendenti G0 / # fertile G0) # HDR-positivi F1/n # totale F1 controllato (%) # "estremità-out" HDR / # HDR totale (%)
BNL-LexA 56 (15/27) 23 (60/259) 73 (46/60)

Tabella 2: l'efficienza di CRISPR/Cas9-mediata HDR. Il tasso di trasmissione HDR è calcolato come il n # di HDR-rendenti G0 / # di totale G0 fertile. Successo HDR % viene calcolato come il n # di HDR-positivi F1 / # di F1 totale proiettato. "Estremità-out" % viene calcolato come il n # di "estremità-out" HDR / # di totale positivo HDR.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Tradizionalmente, trappole del rinforzatore di Drosophila sono stati generati da due diversi metodi. Uno dei modi include l'inserimento casuale di un driver (es., Gal4) sequenza del genoma di recepimento (ad es., trasposizione elemento P)1 . In alternativa, le sequenze di driver possono essere posizionate sotto il controllo trascrizionale di una regione enhancer/promotore presunto in un costrutto di plasmide, che sarebbe poi integrato in una sede ectopica del genoma3,11. Sebbene questi metodi hanno generato una grande piscina di Gal4 o LexA enhancer trap per Drosophila, hanno diverse limitazioni. L'inserimento casuale di P-elemento-mediato nel genoma può interrompere l'attività regolatoria di critica cis-sequenze regolatrici. A causa del recepimento casuale nel genoma, espressione di transactivator potrebbe segnalare di più geni vicini. D'altra parte, una conoscenza preventiva delle sequenze cis-regolatori di un gene è necessaria per un costrutto di plasmide enhancer-trappola. C'è anche un limite alla lunghezza di una sequenza che può essere clonata e testata in un costrutto di plasmide. Isolando e clonazione solo un frammento parziale di DNA fuori dal contesto genomico endogeno potrebbe non riprodurre un pattern di espressione di gene-specifico completa. Per esempio, la linea di bnl-Gal4 (NP2211), che è stata generata mediante l'inserimento di P-elemento di una trap di enhancer Gal4 elemento precedendo il gene di bnl , non riprodurre completamente i modelli di espressione di gene-specifico nell'embrione5 . Pertanto, in tali contesti, le tecniche di repurposing, come HACK (omologia assistita CRISPR knock-in), che può convertire il Gal4 esistenti linee in un altro LexA o Q-sistema basato driver linea12 potrebbe non essere molto utile. Per superare queste limitazioni, qui, abbiamo descritto un metodo efficiente e alternativo per la generazione di sistemi di espressione binaria di editing genomico. In questo metodo, il primo esone codifica di un gene viene scambiato con il transactivator (ad es., LexA o Gal4) sequenza di modo che l'espressione del driver trascrizione esclusivamente imita i modelli spazio-temporale dell'espressione genica. Anche se la strategia e i protocolli descritti qui sono stati ottimizzati per bnl -espressione, il metodo può essere facilmente adottato per altri geni.

Un sito di inserimento all'interno della regione genica mirata la determinazione è la fase più critica in questa strategia sperimentale. Il metodo che abbiamo presentato è stato progettato per conservare tutto l'originale trascrizionale nonché ai regolamenti post-trascrizionali del gene bnl 5. Di conseguenza, abbiamo programmato di eliminare la maggior parte del primo esone codifica del gene di bnl e sostituirlo con la cassetta di LexA . La sostituzione è stata progettata in modo tale che l'allele modificato esprime un ibrido LexA-bnl mRNA da endogeno trascrizione e traduzione avviare il sito di bnl pur mantenendo tutte le regioni introniche. Tuttavia, l'ibrido mRNA è stato progettato per produrre solo LexA proteina, ma non di Bnl. Abbiamo mostrato che la strategia con successo avesse generato un bnl-LexA /LexO-basato sistema di trascrizione e che il sistema potrebbe segnalare con precisione i modelli di espressione dinamica, spatiotemporal bnl (Figura 5),5 . Una limitazione di questo processo è la letalità omozigotica nelle linee della drosofila se il gene bersaglio è essenziale per la sopravvivenza. Ulteriormente, l'uso di una strategia di gRNA dual può aumentare la possibilità di editing fuori bersaglio. Una strategia alternativa può essere impiegata per evitare questi problemi. In questa strategia, una cassetta di LexA o Gal4 possa essere posizionata destra presso il sito di inizio ATG del gene sostituito e un T2A self-che fende sequenza del peptide può essere collocato tra la cassetta di LexA/Gal4 e l'inizio dell'essone codifica intatto di il gene dell'obiettivo. Questa strategia dovrebbe produrre un mRNA chimerico che può essere tradotto in entrambi il transctivator e il prodotto del gene funzionale. Tale disegno può ridurre la probabilità di letalità omozigoti. In questa strategia, una gRNA singolo è sufficiente per l'editing genomico. Tuttavia, in presenza di due copie dei geni funzionali, espressione delle varianti proteine transgeniche guidato dal driver Gal4/LexA (ad es., bnl-LexA guidato espressione di LexO- Bnl: GFP fusioni, o proteine di Bnl con le eliminazioni) non fornirà informazioni della funzionalità delle proteine variante.

Una limitazione della strategia modifica del genoma è il laborioso processo di targeting e di modifica di un singolo gene alla volta. Tuttavia, la semplicità e l'efficienza del metodo di modifica del genoma CRISPR/Cas9-mediata hanno rivoluzionato la mirati genomico knock-in e knock-out e la tecnologia di sostituzione che può facilmente essere adottata in qualsiasi laboratorio standard impostato. Negli ultimi anni, i ricercatori di Drosophila hanno sviluppato conveniente kit di strumenti per l'editing genomico che possono essere impiegati per espandere il set di strumenti genetici essenziali per la comprensione di processi biologici fondamentali7,13 . Il genoma di editing e processi descritti qui di screening è relativamente veloce e dura circa due mesi in confronto ad altri sostituzione basati su ricombinazione omologa. Per risultati editing genomico riusciti ed efficaci, è importante seguire alcuni passaggi tecnicamente critiche: 1) ogni gRNA è selezionata per il massimo rigore e attività senza potenziale fuori bersaglio; 2) il donatore HDR contiene ~1.5 kb omologia braccia che fiancheggiano il gRNA targeting siti. Braccia più lunghe di omologia (1.8 – 2 kb) vengono utilizzate per aumentare l'efficienza di HDR quando un grande frammento di DNA esogeno deve essere inserito; 3) il donatore HDR è progettato per essere gratuita dei siti di riconoscimento gRNA per evitare di retargeting di gRNA al locus ingegnerizzati; e 4) un infallibile piano elaborato e coordinamento della tempistica degli incroci genetici con screening basato su PCR a 3 fasi per selezionare una linea HDR "estremità-out".

A differenza di recepimento casuale o costrutti enhancer clonato, la strategia e i protocolli che abbiamo descritto qui garantisce la generazione di un sistema binario della trascrizione gene-specifico si rivolgono in esclusiva. Dato che l'espressione del driver sostituisce un esone del gene nativo, espressione di gene-specifico del driver è anche versatile e si prevede di imitare i modelli di espressione genica sotto tutte le condizioni inerenti allo sviluppo, metaboliche e fisiologiche5. Espressione genica/cellula-specifico è i criteri più desiderabili di tutte le linee di driver binario quando vengono utilizzati in varie cellule e metodi di biologia inerente allo sviluppo. Per esempio, espressione di gene-specifico di geni reporter da un driver di trascrizione facilita analisi affidabile lineage delle cellule che esprimono il gene bersaglio. Permette inoltre di imaging dal vivo e l'inseguimento dell'espressione spazio-temporale, la migrazione e la riorganizzazione delle cellule durante lo sviluppo. Per studiare gli eventi cellulari e molecolari durante la morfogenesi dei tessuti, Gal4 o LexA guidato sovraespressione/risultati dei vari transgeni e RNAi-mediata del gene knock-down a specifici insiemi di celle sono essenziali. Sistema altamente specifico mirato espressione fornisce un imparziale analisi e interpretazione dei risultati. Di conseguenza, CRISPR/Cas9-base di targeting di un esone del gene e la sua sostituzione con una sequenza di transactivator fornisce un'alternativa migliore per la generazione di sistemi di espressione del gene bersaglio altamente specifici.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Gli autori non hanno conflitti di interesse a divulgare.

Acknowledgments

Ringraziamo il Dr. F. porta, Dr. K. o ' Connor-Giles e Dr. S. Feng per discussioni sulla strategia CRISPR; Dr. T.B. Kornberg e il centro di Stock di Bloomington per reagenti; Funzione di imaging UMD; e finanziamenti da NIH: R00HL114867 e R35GM124878 a SR.

Materials

Name Company Catalog Number Comments
X-Gal/IPTG Gentrox (Genesee Scientific) 18-218 cloning
LB-Agar BD Difco BD 244520 cloning
Tris-HCl Sigma Aldrich T3253 Molecular Biology
EDTA Sigma Aldrich E1161 Molecular Biology
NaCl Sigma Aldrich S7653 Molecular Biology
UltraPure DNase/RNase-Free Water ThermoFisher Scientific 10977-023 Molecular Biology
10% SDS Sigma Aldrich 71736 Molecular Biology
KOAc Fisher-Scientific P1190 Molecular Biology
EtOH Fisher-Scientific 04-355-451 Molecular Biology
GeneJET Miniprep ThermoFisher Scientific K0503 Miniprep
PureLink HiPure Plasmid Maxipep kits ThermoFisher Scientific K210006 Maxiprep
BbsI NEB R0539S Restriction enzyme
Primers IDT-DNA PCR
pCFD4 Kornberg Lab DNA template and vector for gRNA
KAPA HiFi Hot Start- (Kapa Biosystems) Kapa biosystems KK2601 PCR
Q5-high fidelity Taq NEB NEB #M0491 PCR
Gibson Assembly Master Mix NEB NEB #E2611 DNA assembly
pBPnlsLexA:p65Uw Addgene DNA template for LexA amplification
Proteinase K ThermoFisher Scientific 25530049 Molecular Biology
2x PCR PreMix, with dye (red) Sydlab MB067-EQ2R Molecular Biology
Gel elution kit Zymo Research (Genesee Scientific) 11-300 Molecular Biology
TRI reagent Sigma-Aldrich Molecular Biology
Direct-zol RNA purification kits Zymo Research (Genesee Scientific) 11-330 Molecular Biology
OneTaq One-Step RT-PCR Kit NEB E5315S Molecular Biology
lexO-CherryCAAX Kornberg Lab Fly line
UAS-CD8:GFP Kornberg lab Fly line
btl-Gal4 Kornberg lab Fly line
MKRS/TB6B Kornberg lab Fly line
Confocal Microscope SP5X Leica Imaging expression pattern
CO2 station Genesee Scientific 59-122WCU fly pushing
Stereo microscope Olympus SZ-61 fly pushing
Microtube homogenizing pestles Fisher-Scientific 03-421-217 genomic DNA isolation
NanoDrop spectrophotometer ThermoFisher Scientific ND-1000 DNA quantification

DOWNLOAD MATERIALS LIST

References

  1. Brand, A. H., Perrimon, N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 118, (2), 401-415 (1993).
  2. Lai, S. -L., Lee, T. Genetic mosaic with dual binary transcriptional systems in Drosophila. Nature Neuroscience. 9, (5), 703-709 (2006).
  3. Potter, C. J., Tasic, B., Russler, E. V., Liang, L., Luo, L. The Q system: a repressible binary system for transgene expression, lineage tracing, and mosaic analysis. Cell. 141, (3), 536-548 (2010).
  4. Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., Charpentier, E. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science. 337, (6096), 816-821 (2012).
  5. Du, L., Zhou, A., Patel, A., Rao, M., Anderson, K., Roy, S. Generation of a targeted expression system for branchless and characterization of novel cellular expression patterns of the gene in Drosophila. Developmental Biology. 427, (1), 35-48 (2017).
  6. Port, F., Chen, H. -M., Lee, T., Bullock, S. L. Optimized CRISPR/Cas tools for efficient germline and somatic genome engineering in Drosophila. Proceedings of the National Academy of Sciences of the United States of America. 111, (29), E2967-E2976 (2014).
  7. Gratz, S. J., Rubinstein, C. D., Harrison, M. M., Wildonger, J., O'Connor-Giles, K. M. CRISPR-Cas9 Genome Editing in Drosophila. Current Protocols in Molecular Biology. 111, (1), 31.2.1-20 (2015).
  8. Doench, J. G., Hartenian, E., et al. Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nature Biotechnology. 32, (12), 1262-1267 (2014).
  9. Port, F., Bullock, S. L. Augmenting CRISPR applications in Drosophila with tRNA-flanked sgRNAs. Nature Methods. 13, (10), 852-854 (2016).
  10. Beumer, K. J., Trautman, J. K., Mukherjee, K., Carroll, D. Donor DNA Utilization During Gene Targeting with Zinc-Finger Nucleases. G3. 3, (4), Bethesda, Md. 657-664 (2013).
  11. Pfeiffer, B. D., Ngo, T. -T. B., et al. Refinement of tools for targeted gene expression in Drosophila. Genetics. 186, (2), 735-755 (2010).
  12. Lin, C. -C., Potter, C. J. Editing Transgenic DNA Components by Inducible Gene Replacement in Drosophila melanogaster. Genetics. 203, (4), 1613-1628 (2016).
  13. Li, W., Köster, J., et al. Quality control, modeling, and visualization of CRISPR screens with MAGeCK-VISPR. Genome Biology. 16, (1), 281 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics