एन के क्रिस्टल संरचना-टर्मिनल डोमेन के Ryanodine रिसेप्टर से Plutella xylostella

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

इस आलेख में, हम प्रोटीन अभिव्यक्ति, शुद्धि, क्रिस्टलीकरण और diamondback मोठ (Plutella xylostella) से ryanodine रिसेप्टर के एन-टर्मिनल डोमेन की संरचना निर्धारण के प्रोटोकॉल का वर्णन ।

Cite this Article

Copy Citation | Download Citations

Nayak, B. C., Wang, J., Lin, L., He, W., You, M., Yuchi, Z. Crystal Structure of the N-terminal Domain of Ryanodine Receptor from Plutella xylostella. J. Vis. Exp. (141), e58568, doi:10.3791/58568 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

कीट ryanodine रिसेप्टर्स लक्ष्यीकरण (RyRs) शक्तिशाली और कुशल कीटनाशकों का विकास कृषि कीट नियंत्रण के क्षेत्र में बहुत रुचि की गई है । तारीख करने के लिए, कई diamide कीट RyRs लक्ष्यीकरण कीटनाशकों वाणिज्यिक किया गया है, जो २,०००,०००,००० अमेरिकी डॉलर के वार्षिक राजस्व उत्पंन । लेकिन RyR की कार्रवाई के मोड की समझ-लक्ष्यीकरण कीटनाशकों कीट RyR के बारे में संरचनात्मक जानकारी की कमी से सीमित है । इस बदले में कीट में कीटनाशक प्रतिरोध के विकास की समझ को प्रतिबंधित करता है । diamondback कीट (DBM) एक विनाशकारी कीट है जो दुनियाभर में cruciferous फसलों को नष्ट कर रहा है, जिसे diamide कीटनाशकों के प्रतिरोध को दिखाने के लिए भी सूचित किया गया है । इसलिए, यह महान व्यावहारिक महत्व का है उपंयास DBM RyR लक्ष्यीकरण कीटनाशकों का विकास, विशेष रूप से एक पारंपरिक diamide बंधन साइट से अलग क्षेत्र लक्ष्यीकरण । यहाँ, हम DBM से RyR के एन-टर्मिनल डोमेन को संरचनात्मक रूप से चिह्नित करने के लिए एक प्रोटोकॉल प्रस्तुत करते हैं. एक्स-रे क्रिस्टल संरचना २.८४ Å, जो एक बीटा-trefoil तह आकृति और एक पार्श्व अल्फा कुण्डली से पता चलता है की एक संकल्प पर आणविक प्रतिस्थापन द्वारा हल किया गया था । इस प्रोटोकॉल अभिव्यक्ति, शुद्धि और अंय डोमेन या सामांय में प्रोटीन के संरचनात्मक लक्षण वर्णन के लिए अनुकूलित किया जा सकता है ।

Introduction

Ryanodine रिसेप्टर्स (RyRs) विशिष्ट आयन चैनल हैं, जो मांसपेशी कोशिकाओं में sarcoplasmic जालिका (एसआर) झिल्ली भर में सीए2 + आयनों के permeation मध्यस्थता. इसलिए, वे उत्तेजना संकुचन युग्मन प्रक्रिया में एक महत्वपूर्ण भूमिका निभाते हैं । अपने कार्यात्मक रूप में, RyR > 2 एमडीए के एक आणविक जन के साथ एक होमो-tetramer के रूप में इक्ट्ठा, प्रत्येक उपइकाई के साथ ~ ५००० एमिनो एसिड अवशेषों के शामिल । स्तनधारियों में, तीन isoforms हैं: RyR1-कंकाल की मांसपेशी प्रकार, RyR2-कार्डियक मांसपेशी प्रकार और RyR3-बैरे विभिन्न ऊतकों में व्यक्त1.

कीड़ों में RyR का केवल एक प्रकार है, जो मांसपेशियों और तंत्रिका ऊतक2में व्यक्त किया जाता है । कीट RyR के बारे में ४७%3की एक अनुक्रम पहचान के साथ स्तनधारी RyR2 के लिए और अधिक समान है । Lepidoptera और Coleoptera की RyR लक्ष्यीकरण Diamide कीटनाशकों को विकसित और बायर (flubendiamide), ड्यूपॉंट (chlorantraniliprole) और Syngenta (cyantraniliprole) जैसी प्रमुख कंपनियों द्वारा विपणन किया गया है । अपनी अपेक्षाकृत हाल ही में प्रक्षेपण के बाद से, diamide कीटनाशक कीटनाशकों के सबसे तेजी से बढ़ते वर्ग में से एक बन गए हैं । वर्तमान में, इन तीन कीटनाशकों की बिक्री सालाना २००९ (Agranova) के बाद से ५०% से अधिक की वृद्धि दर के साथ २,०००,०००,००० अमेरिकी डॉलर को पार कर गया है ।

हाल के अध्ययनों से इन कीटनाशकों के उपयोग की कुछ पीढ़ियों के बाद कीड़ों में प्रतिरोध के विकास की सूचना दी है4,5,6,7,8। diamondback कीट (DBM), Plutella xylostella (G4946E, I4790M) और टमाटर लीफ़माइनर, तूता एब्सोल्युटा (G4903E, I4746M) में इसी स्थिति से RyRs के transmembrane डोमेन में प्रतिरोध उत्परिवर्तनों बताते है कि इस क्षेत्र diamide कीटनाशक बाध्यकारी में शामिल किया जा सकता है के रूप में इस क्षेत्र के चैनल4,8,9के गेटिंग के लिए महत्वपूर्ण माना जाता है । इस क्षेत्र में व्यापक अनुसंधान के बावजूद diamide कीटनाशकों के सटीक आणविक तंत्र मायावी बने रहते हैं. इसके अलावा, यह स्पष्ट नहीं है कि प्रतिरोध उत्परिवर्तनों diamides सीधे या allosterically के साथ बातचीत को प्रभावित करता है ।

इससे पहले के अध्ययनों ने स्तनधारी प्रजातियों से कई RyR डोमेन की संरचना और पूर्ण लंबाई की संरचना स्तनधारी RyR1 और RyR2 द्वारा एक्स-रे क्रि और क्रायो-इलेक्ट्रॉन माइक्रोस्कोपी, क्रमशः10,11, 12,13,14,15,16,17,18,19,20,21 . लेकिन अभी तक, कीट RyR की कोई संरचना की सूचना दी है, जो हमें रिसेप्टर समारोह की आणविक जटिलताओं को समझने के साथ ही कीटनाशक कार्रवाई और कीटनाशक प्रतिरोध के विकास के आणविक तंत्र को प्रतिबंधित करता है ।

इस पांडुलिपि में, हम diamondback कीट, एक विनाशकारी cruciferous फसलों दुनिया भर में22से संक्रमित कीट से ryanodine रिसेप्टर के एन टर्मिनल β-trefoil डोमेन के संरचनात्मक लक्षण वर्णन के लिए एक सामान्यीकृत प्रोटोकॉल प्रस्तुत करते हैं । निर्माण प्रकाशित खरगोश RyR1 NTD क्रिस्टल संरचनाओं23,24और क्रायो-EM संरचनात्मक मॉडल के अनुसार डिजाइन किया गया था16,17,18,19, 20 , 21. यह पहली उच्च संकल्प संरचना कीट RyR, जो चैनल गेटिंग के लिए तंत्र का पता चलता है और प्रजातियों के विकास के लिए एक महत्वपूर्ण टेंपलेट-संरचना आधारित दवा डिजाइन का उपयोग विशेष कीटनाशकों के लिए रिपोर्ट प्रदान करता है । संरचना elucidation के लिए, हम एक्स-रे क्रि, जो निकट परमाणु संकल्प पर प्रोटीन संरचना दृढ़ संकल्प के लिए ' सोने के मानक ' के रूप में माना जाता है कार्यरत हैं । हालांकि सघन प्रक्रिया अप्रत्याशित और गहन श्रम है, यह कदम दर कदम प्रोटोकॉल शोधकर्ताओं को व्यक्त करने में मदद करेगा, शुद्ध और कीट RyR या सामांय में किसी भी अंय प्रोटीन के अंय डोमेन की विशेषता ।

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. जीन क्लोनिंग, प्रोटीन अभिव्यक्ति, और शुद्धि

  1. पीसीआर बढ़ाना डीएनए हित के प्रोटीन के लिए इसी (अवशेषों DBM RyR के 1-205, Genbank एसीसी. no. AFW97408) और पीईटी में क्लोन-28a-एचएमटी वेक्टर द्वारा बंधाव-स्वतंत्र क्लोनिंग (एलआईसी)25। इस वेक्टर में एन-टर्मिनस 15 पर एक histidine टैग, MBP टैग और एक टेव टीज़ेड क्लीवेज साइट शामिलहै ।
    1. एलआईसी-संगत 5 ' एक्सटेंशन के साथ लक्ष्य जीन के प्रवर्धन के लिए एलआईसी प्राइमरों डिजाइन:
      फॉरवर्ड एलआईसी प्राइमर:
      5 ' TACTTCCAATCCAATGCAATGGCGGAAGCGGAAGGGG 3 '
      रिवर्स एलआईसी प्राइमर:
      5 ' TTATCCACTTCCAATGTTATTATATGCCGGTCCCGTACGGC 3 '
    2. रिएक्शन घटकों (५० μL) का मिश्रण: डीएनए टेम्पलेट्स के 1 μL (१०० एनजी/μL), 1 μL के फॉरवर्ड प्राइमरी (10 माइक्रोन), रिवर्स प्राइमर के 1 μL (10 माइक्रोन), डीएनए μL के ०.५ पोलीमरेज़ (नेब), 10x प्रतिक्रिया बफर के 5 μL, μL के 1 dNTP (25 मिमी) , ४०.५ μL के RNase इव ddH2हे.
      1. एक पीसीआर मशीन में रिएक्शन मिक्सचर लगाएं और म् प्रोग्राम चलाएं ।
      2. 3 मिनट के लिए ९५ ° c पर मशीन, और फिर (९५ ° c के लिए 30 s, ५८ ° c के लिए 15 एस, ७२ ° c 1 मिनट के लिए) के 30 चक्र चलाते हैं । 5 मिनट के लिए ७२ ° c पर मशीन और फिर 4 डिग्री सेल्सियस पर पकड़ ।
      3. एक 2% agarose जेल पर पूरी प्रतिक्रिया मिश्रण (५० μL) भागो और एक जेल निष्कर्षण किट के साथ निकालें । निर्माता के प्रोटोकॉल का पालन करें ।
    3. बंधाव-स्वतंत्र क्लोनिंग (एलआईसी)
      1. SspI पाचन (६० μL) निष्पादित करें: वेक्टर डीएनए के 20 μL (५० एनजी/μL), 6 10x प्रतिक्रिया बफर के μL, 4 μL की गई SspI, और 30 μL के ddH2ओ. के लिए ३७ डिग्री सेल्सियस पर मशीन 3 एच. भागो 1% agarose जेल पर पूरी प्रतिक्रिया मिश्रण चलाने के लिए और एक जेल निष्कर्षण किट के साथ निकालें । निर्माता के प्रोटोकॉल का पालन करें ।
      2. टी-4 डीएनए पोलीमरेज़ उपचार वेक्टर और डालें डीएनए का प्रदर्शन । निंनलिखित का मिश्रण: 5 वेक्टर के μL या डालें डीएनए (५० एनजी/μL), 2 μL के 10x टी-4 डीएनए पोलीमरेज़ बफर, 1 μL के dGTP (25 मिमी) सदिश के लिए या 1 μL के dCTP (25 मिमी) डीएनए डालने के लिए, μL के 1 डीटीटी (१०० मिमी), टी-4 डीएनए μL के ०.४ पोलीमरेज़ (एलआईसी योग्य) , और ddH2ओ के ९.६ μL ४० min. Heat-निष्क्रिय एंजाइम के लिए ७५ डिग्री सेल्सियस पर 20 मिनट के लिए कमरे के तापमान पर मशीन प्रतिक्रियाओं ।
        नोट: एलआईसी वेक्टर और सम्मिलित डीएनए अलग प्रतिक्रियाओं में इलाज किया जाना चाहिए.
      3. एलआईसी एनीलिंग प्रतिक्रिया प्रदर्शन. -टी-4-इलाज सम्मिलित डीएनए, टी-4 के 2 μL-इलाज एलआईसी वेक्टर डीएनए के 2 μL: निम्नलिखित का मिश्रण । 10 मिनट के लिए कमरे के तापमान पर रिएक्शन की मशीन ।
  2. इस रिकॉमबिनेंट प्लाज्मिड के साथ BL21 (DE3) ई. कोलाई कोशिकाओं को रूपांतरित करे ।
    1. गल सक्षम कोशिकाओं (माइक्रो-केंद्रापसारक ट्यूब में ५० μL) बर्फ पर ।
    2. ट्यूब में प्लाज्मिड के लगभग 1 μL (५० एनजी) जोड़ें । धीरे से ट्यूब 2-3 बार फ़्लिक करके कोशिकाओं और डीएनए को मिलाएं । 20 मिनट के लिए बर्फ पर ट्यूब प्लेस ।
    3. गर्मी सदमे में ४२ ° c के लिए ४० s. बर्फ पर ट्यूब फिर से प्लेस 2 मिनट के लिए । कमरे का तापमान पौंड मीडिया ट्यूब के लिए 1 मिलीलीटर जोड़ें ।
    4. ४५ मिनट के लिए ३७ डिग्री सेल्सियस पर २५० rpm शेखर में मिश्रण ट्यूब प्लेस । प्रसार 150-200 µ एल चयन प्लेट्स पर मिश्रण की । प्लेट पलटना और ३७ डिग्री सेल्सियस पर रात भर गर्मी ।
  3. एक ही कॉलोनी और संस्कृति उठाओ १०० मिलीलीटर 2YT में कोशिकाओं ५० µ g/एमएल कनमीसिन युक्त ३७ ° c रातोंरात । अगली सुबह, inoculate 1 L 2YT मध्यम से युक्त ५० µ g/एमएल कनमीसिन के साथ 10 रात की संस्कृति और ३७ डिग्री सेल्सियस में मशीन की गर्मी ° c में २५० rpm पर, जब तक कि आयुध डिपो६०० ~ ०.६ तक पहुंचता है । तदुपरांत ०.४ मिमी के अंतिम एकाग्रता के लिए IPTG के साथ संस्कृति प्रेरित और 30 डिग्री सेल्सियस पर एक और 5 एच के लिए हो जाना ।
  4. फसल के लिए ८,००० x g पर 10 मिनट के लिए 4 डिग्री सेल्सियस, कोशिकाओं को इकट्ठा और ४० मिलीलीटर lysis बफर (10 मिमी HEPES पीएच ७.४, २५० मिमी KCl, 10 मिमी β-mercaptoethanol में हर 10 जी कोशिकाओं resuspend, 25 μg/एमएल lysozyme, 25 μg/ , 1 मिमी PMSF) ।
    1. sonication द्वारा यह ६५% आयाम पर 1 एस के साथ 8 मिनट के लिए और 1 एस बंद बाधित । 4 डिग्री सेल्सियस पर 30 मिनट के लिए ४०,००० x g पर केंद्रापसारक द्वारा सेल मलबे निकालें । ०.२२ माइक्रोन फिल्टर के माध्यम से गुजर रहा है और नमूना पाश में लोड करके supernatant फ़िल्टर.
  5. फ्यूजन प्रोटीन को शुद्ध करें, टैग को सट कर फिर से लक्ष्य प्रोटीन को शुद्ध करे ।
    1. फ्यूजन प्रोटीन को शुद्ध करें Ni-ंत् column (बाइंडिंग बफ़र: 10 mm HEPES ph ७.४, २५० mm KCl; रेफरेंस बफर: 10 एमएम HEPES पीएच ७.४, २५० एमएम KCl, ५०० एमएम imidazole) और एक शुद्धिकरण प्रणाली द्वारा शुद्ध, 20 – 250 एमएम imidazole के रेखीय ढाल के साथ ।
    2. 4 डिग्री सेल्सियस पर रातोंरात टेव (1:50 अनुपात) के साथ eluted लक्ष्य प्रोटीन सट ।
    3. amylose राल कॉलम (बाध्यकारी बफर: 10 मिमी HEPES पीएच ७.४, २५० mm KCl; रेफरेंस बफर: 10 मिमी HEPES पीएच ७.४, २५० मिमी KCl, 10 मिमी माल्टोज़) और Ni-ंत् स्तंभ का उपयोग करके दरार प्रतिक्रिया मिश्रण शुद्ध टैग और टेव को हटाने के लिए । लक्ष्य प्रोटीन इन दो स्तंभों के प्रवाह-माध्यम अंश में होगा ।
    4. Dialyze डायलिसिस बफर के खिलाफ नमूना (10 मिमी Tris-एचसीएल पीएच ८.८, ५० मिमी KCl, 10 मिमी β-mercaptoethanol नमक एकाग्रता को कम करने के लिए. आयनों exchange स्तंभ (बाइंडिंग बफ़र पर नमूना शुद्ध: 10 मिमी Tris-एचसीएल पीएच ८.८, 10 मिमी β-mercaptoethanol; रेफरेंस बफर: 10 मिमी Tris-एचसीएल पीएच ८.८, 1 एम KCl, 10 मिमी β-mercaptoethanol) के एक रैखिक ढाल द्वारा 20 – 500 मिमी KCl में रेफरेंस बफर.
    5. शुद्धिकरण की प्रक्रिया में एक अंतिम कदम के रूप में, केंद्रापसारक (10 केडीए MWCO) का उपयोग कर प्रोटीन ध्यान केंद्रित है और एक Superdex २०० 26/600 जेल-निस्पंदन कॉलम में सजातीयता की जांच करने के लिए सुई ।
  6. इसे 15% एसडीएस पृष्ठ पर चलाकर प्रोटीन की शुद्धता की जांच करें ।
    नोट: सभी कॉलम 2 मिलीलीटर/मिनट की एक बाध्यकारी प्रवाह दर के साथ एक प्रोटीन शोधन प्रणाली पर चल रहे हैं, और एक रेफरेंस फ्लो दर 4 एमएल/मिनट के अलावा जेल-निस्पंदन पर 1 एमएल/

2. प्रोटीन तैयारी और क्रिस्टलीकरण

  1. 10 मिलीग्राम/एमएल के लिए शुद्ध प्रोटीन का नमूना ध्यान केंद्रित (10 केडीए MWCO) और बफर एक्सचेंज के लिए क्रिस्टलीकरण बफर पर भंडारण से पहले-८० ° c ।
  2. क्रिस्टलीकरण स्क्रीनिंग प्रदर्शन (1:1 अनुपात, प्रोटीन के २०० nL और जलाशय बफर के २०० nL) में बैठे ड्रॉप वाष्प प्रसार विधि द्वारा २९५ K पर कई क्रिस्टलीकरण किट के साथ एक स्वचालित तरल हैंडलिंग रोबोट प्रणाली का उपयोग कर एक ९६-अच्छी तरह से प्रारूप में ।
    नोट: हम आणविक आयामों और Hampton अनुसंधान और Gryphon स्वचालित तरल हैंडलिंग प्रणाली से किट का इस्तेमाल किया ।
  3. ९६-अच्छी तरह से क्रिस्टलीकरण प्लेट सील वाष्पीकरण को रोकने के लिए और जलाशय बफर के साथ प्रोटीन ड्रॉप के equilibration सक्षम करें । फिर 18 डिग्री सेल्सियस पर क्रिस्टल मशीन में प्लेटें रखें ।
  4. ९६ की जांच करें-अच्छी तरह से समय पर प्लेटों क्रिस्टल गठन और विकास की निगरानी के लिए एक प्रकाश माइक्रोस्कोप का उपयोग कर ।
  5. नमक क्रिस्टल से प्रोटीन क्रिस्टल अंतर, एक प्रोटीन डाई का उपयोग करें । लक्ष्य ड्रॉप करने के लिए डाई के 1 µ एल जोड़ें । के बारे में 1 ज और माइक्रोस्कोप के तहत निरीक्षण के लिए रुको । प्रोटीन क्रिस्टल नीले रंग बंद हो जाएगा ।
  6. सकारात्मक क्रिस्टलीकरण शर्तों (१.५ एम अमोनियम सल्फेट, ०.१ एम Tris पीएच ८.०) का उपयोग करने के लिए आगे 24 अच्छी तरह से प्लेटों में लटका छोड़ वाष्प-प्रसार विधि का उपयोग क्रिस्टल का अनुकूलन करने के लिए ।
    1. ७.० से ८.५ ०.५ पीएच इकाई अंतराल के साथ हर कदम पीएच ऑप्टिमाइज़ करें । १.२ मीटर से १.७ मीटर के लिए ०.१ मीटर अंतराल हर कदम के साथ अमोनियम सल्फेट की एकाग्रता का अनुकूलन । (हमारे मामले में सबसे अच्छी हालत बड़ी थाली के आकार का क्रिस्टल का उत्पादन ०.१ मीटर HEPES पीएच ७.० और १.६ एम अमोनियम सल्फेट था)

3. क्रिस्टल बढ़ते, एक्स-रे डेटा संग्रह, और संरचना निर्धारण

  1. एक cryoloop में क्रिस्टल माउंट और फ्लैश-तरल नाइट्रोजन में ठंडा जलाशय समाधान का उपयोग 20% ग्लिसरॉल क्रायो-रक्षा के रूप में युक्त । भंडारण और परिवहन के लिए unipuck में क्रिस्टल प्लेस ।
  2. पूर्व स्क्रीन प्रोटीन क्रिस्टल का उपयोग कर एक Rigaku घर में एक्स-रे diffractor । सिंक्रोट्रॉन सुविधाओं पर डेटा संग्रह के लिए उच्चतम प्रस्तावों के साथ सबसे अच्छा लोगों को चुनें (हमारे डेटासेट शंघाई सिंक्रोट्रॉन विकिरण सुविधा पर BL17U1 से एकत्र किया गया था).
    1. beamline नियंत्रण सॉफ्टवेयर का प्रयोग करें26 BluIce माउंट और स्वत: या मैनुअल केंद्रीकरण समारोह द्वारा क्रिस्टल केंद्र । शुरू कोण, जोखिम समय, डिटेक्टर दूरी, फ्रेम चौड़ाई और संख्या सहित डेटा संग्रह रणनीति, निर्धारित करने के लिए परीक्षण जोखिम प्रदर्शन करते हैं ।
    2. डेटासेट इकट्ठा तदनुसार (हम 1 एस जोखिम समय, 1 ° फ्रेम चौड़ाई और ३५० मिमी की डिटेक्टर दूरी के साथ १८० फ्रेम एकत्र) ।
  3. HKL2000 suite27का उपयोग करके डेटासेट को इंडेक् स, एकीकृत और स्केल करें । पहले चोटी खोज समारोह बाहर ले विवर्तन धब्बे खोजने के लिए, और फिर धब्बे सूचकांक और सही अंतरिक्ष समूह का चयन करें । पीक एकीकरण के बाद, dataset उचित त्रुटि मॉडल के साथ स्केल करें और आउटपुट. sca फ़ाइल सहेजें ।
  4. आणविक प्रतिस्थापन द्वारा चरण समस्या हल29PHENIX में phaser28 का उपयोग कर ।
    1. 30Xtriage द्वारा असममित इकाई में प्रोटीन अणुओं की संभव प्रतिलिपि संख्या की गणना.
    2. उचित संरचना उच्च अनुक्रम पहचान और लक्ष्य प्रोटीन के रूप में संरचनात्मक समानता के लिए देखो के लिए साहित्य से ज्ञात संरचनाओं का उपयोग कर या Phyre231 जैसे संरचना की भविष्यवाणी सर्वर द्वारा उत्पंन मॉडल (हम खरगोश RyR1 NTD के रूप में इस्तेमाल एक खोज मॉडल, PDB आईडी 2XOA) ।
    3. विवर्तन डेटा फ़ाइल का उपयोग कर phaser भागो, टेम्पलेट संरचना फ़ाइल और प्रोटीन अनुक्रम फ़ाइल समाधान खोजने के लिए.
  5. प्रदर्शन३२ PHENIX29 में प्रारंभिक मॉडल से उत्पादन फ़ाइल का उपयोग कर बनाने के लिए और अनुक्रम फ़ाइल लक्ष्य प्रोटीन से ।
  6. मैंयुअल रूप से संशोधित प्रयोगात्मक इलेक्ट्रॉन कूट३३ का उपयोग घनत्व में संरचना का निर्माण और चलने चक्र में phenix. refine३४ का उपयोग कर परिष्कृत करें ।
  7. PHENIX18में मांयता उपकरण का उपयोग कर अंतिम मॉडल को मांय करें ।

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

शोधन

DBM RyR का एन-टर्मिनल डोमेन एक hexahistidine टैग, एक MBP टैग और एक टेव को छेड़ो दरार साइट के साथ एक फ्यूजन प्रोटीन के रूप में व्यक्त किया गया था । हम एक उच्च शुद्ध प्रोटीन, क्रिस्टलीकरण उद्देश्य के लिए उपयुक्त प्राप्त करने के लिए एक पांच कदम शुद्धिकरण की रणनीति के बाद । सबसे पहले, फ्यूजन प्रोटीन नी-ंत् कॉलम (HisTrap HP) द्वारा सेल lysate के घुलनशील अंश से शुद्ध किया गया था । अगले, फ्यूजन प्रोटीन टेव को चिढ़ाने दरार और hexahistidine-MBP moiety के अधीन था amylose राल नी द्वारा पीछा कॉलम-ंत् कॉलम द्वारा हटा दिया गया था । इसके अलावा, प्रोटीन आयनों एक्सचेंज कॉलम (क्यू Sepharose एचपी) और अंत में जेल द्वारा शुद्ध किया गया निस्पंदन कॉलम (Superdex २०० 26/600) । 1 एल बैक्टीरियल संस्कृति 2YT मीडिया का उपयोग करने से शुद्ध प्रोटीन की अंतिम उपज ~ 4 मिलीग्राम था । शुद्ध प्रोटीन एसडीएस पर एक एकल बैंड-पृष्ठ पर दिखाया ~ 21 केडीए (चित्रा 1). जेल से रेफरेंस वॉल्यूम-छानने का कॉलम शुद्ध RyR NTD एक मोनोमर (चित्रा 1) होने की पुष्टि की ।

Crystallization

९६ में प्रारंभिक क्रिस्टलीकरण स्क्रीनिंग-अच्छी तरह से प्लेटें कई स्थितियों में क्रिस्टल उपज । इन शर्तों को क्रिस्टल अनुकूलन के लिए 24 अच्छी तरह से प्लेटों में चयनित किया गया । सबसे इष्टतम हालत जहां उच्च गुणवत्ता प्लेट आकार क्रिस्टल का गठन किया गया ०.१ एम HEPES पीएच ७.० और १.६ मीटर अमोनियम सल्फेट (चित्रा 2) था ।

संरचना निर्धारण

क्रिस्टल प्राप्त २.८४ beamline BL17U1 पर शंघाई सिंक्रोट्रॉन विकिरण सुविधा पर Å diffracted था । क्रिस्टल अंतरिक्ष में अनुक्रमित किया गया समूह पी6 इकाई के साथ1 -सेल मानकों a = १७०.१३, b = १७०.१३, c = ५१.७६३ Å, α = β = ९०.०० °, γ = १२० °. संरचना निर्धारण के लिए, आणविक प्रतिस्थापन PHENIX में एक खोज मॉडल के रूप में खरगोश RyR1 NTD का उपयोग कर नियोजित किया गया था । इसके अलावा संरचना के शोधन के लिए PHENIX में किया गया था एक अंतिम आरकाम औरनि: शुल्क आर २१.६३ और २४.५२%, क्रमशः । डेटा संग्रह और शोधन सांख्यिकी तालिका 1में सूचीबद्ध होते हैं । 1-205 (PDB ID 5Y9V) के अवशेषों को कवर करने वाले DBM RyR NTD की सुलझी हुई संरचना चित्रा 3में दिखाई गई है.

Figure 1
चित्रा 1: एसडीएस-पृष्ठ और जेल निस्पंदन वर्णलेख DBM RyR NTD३५के शुद्धिकरण का प्रतिनिधित्व । एसडीएस पृष्ठ (15%) इनसेट में पांच कदम शुद्धिकरण की रणनीति के बाद एक एकल बैंड के रूप में DBM RyR NTD शुद्ध दिखाता है । बाएं लेन मानक प्रोटीन मार्कर (प्रधानमंत्री) से पता चलता है । जेल छानने का वर्णलेख एक Superdex २०० 26/600 कॉलम का उपयोग प्राप्त २४० मिलीलीटर, जो प्रोटीन के monomeric रूप से मेल खाती है पर रेफरेंस पीक से पता चलता है । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

Figure 2
चित्र 2. DBM RyR NTD३५का क्रिस्टलीकरण. DBM RyR NTD के क्रिस्टल वाष्प-प्रसार विधि द्वारा उत्पादित के रूप में एक प्रकाश माइक्रोस्कोप के नीचे देखा । क्रिस्टलीकरण की हालत ०.१ मीटर HEPES पीएच ७.० और १.६ मीटर अमोनियम सल्फेट की थी । स्केल बार = २०० µm. कृपया इस आंकड़े का एक बड़ा संस्करण देखने के लिए यहां क्लिक करें

Figure 3
चित्रा 3: DBM RyR NTD की संरचना (PDB ID 5Y9V)३५दो विचारों से दिखाए गए प्रोटीन की संरचना का हल । द्वितीयक संरचना तत्व लेबल किए गए हैं । β किस्में बैंगनी में दिखाया गया है । α कुंडल और एक 310 कुंडलित नीले रंग में दिखाए जाते हैं । छोरों सफेद में दिखाया जाता है । Nt और सीटी क्रमशः प्रोटीन के एन-टर्मिनल और सी-टर्मिनल का प्रतिनिधित्व करते हैं । कृपया यहां क्लिक करें इस आंकड़े का एक बड़ा संस्करण को देखने के लिए ।

तालिका 1: DBM RyR NTD क्रिस्टल३५के लिए डेटा संग्रहण और परिशोधन सांख्यिकी. कृपया यहां क्लिक करें इस तालिका डाउनलोड करने के लिए ।

Subscription Required. Please recommend JoVE to your librarian.

Discussion

इस पत्र में, हम इस प्रक्रिया का वर्णन करने के लिए recombinantly एक्सप्रेस, शुद्ध, सघन और DBM RyR NTD की संरचना का निर्धारण । क्रिस्टलीकरण के लिए, एक महत्वपूर्ण आवश्यकता के लिए उच्च घुलनशीलता, पवित्रता और एकरूपता के साथ प्रोटीन प्राप्त है । हमारे प्रोटोकॉल में, हम पालतू 28a-एचएमटी वेक्टर का उपयोग करने के रूप में यह एक hexahistidine टैग और MBP टैग, दोनों जिनमें से एक उच्च गुना शुद्धता प्राप्त करने के लिए शुद्धि के लिए उपयोग किया जा सकता है चुना है । इसके अतिरिक्त, MBP टैग एड्स लक्ष्य प्रोटीन के घुलनशीलता में । हम लगातार पांच कदम जो प्रोटीन है कि अत्यधिक शुद्ध और क्रिस्टलीकरण के लिए उपयुक्त था उपज द्वारा प्रोटीन शुद्ध । क्रिस्टलीकरण स्क्रीनिंग स्वचालित तरल हैंडलिंग प्रणाली का उपयोग किया गया था । मैनुअल ड्रॉप सेटिंग द्वारा पारंपरिक स्क्रीनिंग की तुलना में, स्वचालित प्रणाली नमूना की बहुत छोटी मात्रा का उपयोग करता है, समय और ऊर्जा बचाता है । यह तरल हैंडलिंग की सटीकता के कारण reproducibility को भी बढ़ाता है । क्रिस्टल स्क्रीनिंग के लिए घर में diffracted थे और डेटा संग्रह के लिए सिंक्रोट्रॉन पर के रूप में यह उच्च तीव्रता और कम विचलन के साथ एक्स-रे प्रदान करता है, जिससे उच्च गुणवत्ता डेटा उपज । आणविक प्रतिस्थापन हमारी पहली पसंद के रूप में समान संरचनात्मक टेंपलेट्स डेटाबेस में उपलब्ध थे । वैकल्पिक मार्ग से प्रायोगिक चरणबद्ध प्रयोग करना है, जिसमें विक्षिप्त, दु: खी, मीर आदि शामिल हैं ।

जबकि DBM RyR NTD की संरचना को सुलझाने, मैथ्यू Xtriage30 से प्राप्त गुणांक का सुझाव दिया है कि असममित इकाई (आसू) सबसे अधिक संभावना ४६% विलायक सामग्री है, जो ४९% की संभावना है के साथ चार मोनोमर निहित । लेकिन, आसू में चार अणुओं के साथ हम सही समाधान नहीं खोज पाए । इसके बाद रनों के लिए दो, तीन, पाँच, छः अणुओं की तलाश भी विफल रही. अंततः हम आसू, जो केवल 4% संभावना है और ८६% से अधिक विलायक सामग्री में केवल एक अणु के साथ सही समाधान मिल गया । उच्च पानी की सामग्री की पुष्टि के बाद हम संरचना हल किया गया था । इस प्रकार, चरम उच्च विलायक सामग्री जो प्रोटीन पैक में आंतरिक रास्ते पर निर्भर करता है मौजूद है ।

हालांकि एक्स-रे क्रि प्रोटीन संरचना निर्धारण में एक स्वर्ण-मानक है, बड़े विकार या लचीले क्षेत्रों के साथ प्रोटीन और कमजोर अपनत्व के साथ कुछ बड़े प्रोटीन परिसरों सघन करने के लिए चुनौती दे रहे हैं । प्रोटीन इंजीनियरिंग तरीकों, सहित पाश-जनचेतना, सतह एन्ट्रापी कमी और पार से जोड़ने, बेहतर प्रोटीन क्रिस्टल प्राप्त करने की संभावना में सुधार हो सकता है. उच्च संकल्प प्रोटीन संरचनाओं का खुलासा करने के अलावा, एक्स-रे क्रि भी प्रोटीन कीटनाशक बातचीत, जो हमें संरचना आधारित कीटनाशक डिजाइन पर मदद मिलेगी अध्ययन करने के लिए इस्तेमाल किया जा सकता है । क्वी एट अल. पाया गया कि diamides के विभिंन परिवारों अलग साइटों है कि३६प्रजातियों के पार अलग है के लिए बाध्य हो सकता है । हमारी रणनीति का प्रयोग, एक कई प्रजातियों से RyR संरचनाओं का निर्धारण और अद्वितीय मनाया प्रजातियों के लिए जिंमेदार तत्वों की पहचान कर सकते है विशिष्टता । कुल मिलाकर, इस प्रोटोकॉल अभिव्यक्ति के लिए अनुकूलित किया जा सकता है, शुद्धि, क्रिस्टलीकरण और किसी भी प्रोटीन या प्रोटीन डोमेन के संरचना निर्धारण स्वयं के द्वारा या जटिल में छोटे अणु दवाओं के साथ ।

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

लेखकों का खुलासा करने के लिए कुछ नहीं है ।

Acknowledgements

इस अनुसंधान के लिए धन द्वारा प्रदान की गई थी: चीन के राष्ट्रीय प्रमुख अनुसंधान और विकास कार्यक्रम (2017YFD0201400, 2017YFD0201403), राष्ट्रीय प्रकृति विज्ञान फाउंडेशन ऑफ चाइना (३१३२०१०३९२२, ३१२३००६१), और नेशनल बेसिक रिसर्च (९७३) कार्यक्रम की परियोजना चीन (2015CB856500, 2015CB856504) । हम शंघाई सिंक्रोट्रॉन विकिरण सुविधा (SSRF) में beamline BL17U1 पर कर्मचारियों के लिए आभारी हैं ।

Materials

Name Company Catalog Number Comments
pET-28a-HMT vector This modified pET vector contains a hexahistidine tag, an MBP fusion protein and a TEV protease cleavage site at the N-terminus (Lobo and Van Petegem, 2009)
E. coli BL21 (DE3) strain Novagen 69450-3CN
HisTrapHP column (5 mL) GE Healthcare 45-000-325
Amylose resin column New England Biolabs E8021S
Q Sepharose high-performance column  GE Healthcare 17-1154-01
Amicon concentrators (10 kDa MWCO) Millipore UFC901008
Superdex 200 26/600 gel-filtration column  GE Healthcare 28-9893-36
Automated liquid handling robotic system  Art Robbins Instruments Gryphon
96 Well CrystalQuick Greiner bio-one 82050-494
Uni-Puck Molecular Dimensions MD7-601
Mounted CryoLoop - 20 micron Hampton Research HR4-955
CryoWand Molecular Dimensions MD7-411
Puck dewar loading tool Molecular Dimensions MD7-607
Nano drop Thermo Scientific NanoDrop One
Crystal incubator Molecular Dimensions MD5-605
X-Ray diffractor Rigaku FRX
PCR machine Eppendorf Nexus GX2
Plasmid mini-prep kit Qiagen 27104
Gel extraction kit Qiagen 28704
SspI restriction endonuclease NEB R0132S
T4 DNA polymerase Novagen 2868713
Kanamycin Scientific Chemical 25389940
IPTG Genview 367931
HEPES Genview 7365459
β-mercaptoethanol Genview 60242
Centrifuge Thermo Scientific Sorvall LYNX 6000 
Sonnicator Scientz II-D
Protein purification system GE Healthcare Akta Pure
Light microscope Nikon SMZ745
IzIt crystal dye Hampton Research HR4-710
Electrophoresis unit Bio-Rad 1658005EDU
Shaker Incubator Zhicheng ZWYR-D2401
Index crystal screen Hampton Research HR2-144
Structure crystal screen Molecular Dimensions MD1-01
ProPlex crystal screen Molecular Dimensions MD1-38
PACT premier crystal screen Molecular Dimensions MD1-29
JCSG-plus crystal screen Molecular Dimensions MD1-37

DOWNLOAD MATERIALS LIST

References

  1. Giannini, G., Sorrentino, V. Molecular structure and tissue distribution of ryanodine receptors calcium channels. Medicinal Research Reviews. 15, (4), 313-323 (1995).
  2. Takeshima, H., et al. Isolation and characterization of a gene for a ryanodine receptor/calcium release channel in Drosophila melanogaster. FEBS Letters. 337, (1), 81-87 (1994).
  3. Sattelle, D. B., Cordova, D., Cheek, T. R. Insect ryanodine receptors: molecular targets for novel pest control chemicals. Invertebrate Neuroscience. 8, (3), 107-119 (2008).
  4. Steinbach, D., et al. Geographic spread, genetics and functional characteristics of ryanodine receptor based target-site resistance to diamide insecticides in diamondback moth, Plutella xylostella. Insect Biochemistry and Molecular Biology. 63, 14-22 (2015).
  5. Wang, X., Khakame, S. K., Ye, C., Yang, Y., Wu, Y. Characterisation of field-evolved resistance to chlorantraniliprole in the diamondback moth, Plutella xylostella, from China. Pest Management Science. 69, (5), 661-665 (2013).
  6. Liu, X., Wang, H. Y., Ning, Y. B., Qiao, K., Wang, K. Y. Resistance Selection and Characterization of Chlorantraniliprole Resistance in Plutella xylostella (Lepidoptera: Plutellidae). Journal of Economic Entomology. 108, (4), 1978-1985 (2015).
  7. Guo, L., et al. Functional analysis of a point mutation in the ryanodine receptor of Plutella xylostella (L.) associated with resistance to chlorantraniliprole. Pest Management Science. 70, (7), 1083-1089 (2014).
  8. Troczka, B., et al. Resistance to diamide insecticides in diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae) is associated with a mutation in the membrane-spanning domain of the ryanodine receptor. Insect Biochemistry and Molecular Biology. 42, (11), 873-880 (2012).
  9. Roditakis, E., et al. Ryanodine receptor point mutations confer diamide insecticide resistance in tomato leafminer, Tuta absoluta (Lepidoptera: Gelechiidae). Insect Biochemistry and Molecular Biology. 80, 11-20 (2017).
  10. Borko, L., et al. Structural insights into the human RyR2 N-terminal region involved in cardiac arrhythmias. Acta Crystallographica Section D. 70, (Pt 11), 2897-2912 (2014).
  11. Sharma, P., et al. Structural determination of the phosphorylation domain of the ryanodine receptor. FEBS Journal. 279, (20), 3952-3964 (2012).
  12. Kimlicka, L., Lau, K., Tung, C. C., Van Petegem, F. Disease mutations in the ryanodine receptor N-terminal region couple to a mobile intersubunit interface. Nature Communications. 4, 1506 (2013).
  13. Lau, K., Van Petegem, F. Crystal structures of wild type and disease mutant forms of the ryanodine receptor SPRY2 domain. Nature Communications. 5, 5397 (2014).
  14. Amador, F. J., et al. Crystal structure of type I ryanodine receptor amino-terminal beta-trefoil domain reveals a disease-associated mutation "hot spot" loop. Proceedings of the National Academy of Sciences of the United States of America. 106, (27), 11040-11044 (2009).
  15. Lobo, P. A., Van Petegem, F. Crystal structures of the N-terminal domains of cardiac and skeletal muscle ryanodine receptors: insights into disease mutations. Structure. 17, (11), 1505-1514 (2009).
  16. des Georges, A., et al. Structural Basis for Gating and Activation of RyR1. Cell. 167, (1), 145-157 (2016).
  17. Efremov, R. G., Leitner, A., Aebersold, R., Raunser, S. Architecture and conformational switch mechanism of the ryanodine receptor. Nature. 517, (7532), 39-43 (2015).
  18. Peng, W., et al. Structural basis for the gating mechanism of the type 2 ryanodine receptor RyR2. Science. 354, (6310), (2016).
  19. Wei, R. S., et al. Structural insights into Ca2+-activated long-range allosteric channel gating of RyR1. Cell Research. 26, (9), 977-994 (2016).
  20. Yan, Z., et al. Structure of the rabbit ryanodine receptor RyR1 at near-atomic resolution. Nature. 517, (7532), 50-55 (2015).
  21. Zalk, R., et al. Structure of a mammalian ryanodine receptor. Nature. 517, (7532), 44-49 (2015).
  22. Furlong, M. J., Wright, D. J., Dosdall, L. M. Diamondback moth ecology and management: problems, progress, and prospects. Annual Review of Entomology. 58, 517-541 (2013).
  23. Amador, F. J., et al. Crystal structure of type I ryanodine receptor amino-terminal beta-trefoil domain reveals a disease-associated mutation "hot spot" loop. Proceedings of the National Academy of Sciences of the United States of America. 106, (27), 11040-11044 (2009).
  24. Lobo, P. A., Van Petegem, F. Crystal Structures of the N-Terminal Domains of Cardiac and Skeletal Muscle Ryanodine Receptors: Insights into Disease Mutations. Structure. 17, (11), 1505-1514 (2009).
  25. Aslanidis, C., de Jong, P. J. Ligation-independent cloning of PCR products (LIC-PCR). Nucleic Acids Research. 18, (20), 6069-6074 (1990).
  26. Stepanov, S., et al. JBluIce-EPICS control system for macromolecular crystallography. Acta Crystallographica Section D. 67, (3), 176-188 (2011).
  27. Minor, W., Cymborowski, M., Otwinowski, Z., Chruszcz, M. HKL-3000: the integration of data reduction and structure solution--from diffraction images to an initial model in minutes. Acta Crystallographica Section D. 62, (Pt 8), 859-866 (2006).
  28. McCoy, A. J., et al. Phaser crystallographic software. Journal of Applied Crystallography. 40, (Pt 4), 658-674 (2007).
  29. Adams, P. D., et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallographica Section D. 66, (Pt 2), 213-221 (2010).
  30. Zwart, P. H., Gross-Kunstleve, R. W., Adams, P. D. Xtriage and Fest: Automatic assessment of X-ray data and substructure structure factor estimation. CCP4 Newsletter. (43), 27-35 (2005).
  31. Kelley, L. A., Mezulis, S., Yates, C. M., Wass, M. N., Sternberg, M. J. The Phyre2 web portal for protein modeling, prediction and analysis. Nature Protocols. 10, (6), 845-858 (2015).
  32. Terwilliger, T. C., et al. Iterative model building, structure refinement and density modification with the PHENIX AutoBuild wizard. Acta Crystallographica Section D. 64, (Pt 1), 61-69 (2008).
  33. Emsley, P., Cowtan, K. Coot: model-building tools for molecular graphics. Acta Crystallographica Section D. 60, 2126-2132 (2004).
  34. Afonine, P. V., et al. Towards automated crystallographic structure refinement with phenix.refine. Acta Crystallographica Section D. 68, (Pt 4), 352-367 (2012).
  35. Lin, L., et al. Crystal structure of ryanodine receptor N-terminal domain from Plutella xylostella reveals two potential species-specific insecticide-targeting sites. Insect Biochemistry and Molecular Biology. 92, 73-83 (2018).
  36. Qi, S., Casida, J. E. Species differences in chlorantraniliprole and flubendiamide insecticide binding sites in the ryanodine receptor. Pesticide Biochemistry and Physiology. 107, (3), 321-326 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics