Estructura cristalina del dominio N-terminal del Receptor de rianodina de Plutella xylostella

Biochemistry

Your institution must subscribe to JoVE's Biochemistry section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

En este artículo se describen los protocolos de determinación de la expresión, purificación, cristalización y la estructura de la proteína del dominio N-terminal del receptor de rianodina de polilla del diamondback (xylostella de Plutella).

Cite this Article

Copy Citation | Download Citations

Nayak, B. C., Wang, J., Lin, L., He, W., You, M., Yuchi, Z. Crystal Structure of the N-terminal Domain of Ryanodine Receptor from Plutella xylostella. J. Vis. Exp. (141), e58568, doi:10.3791/58568 (2018).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Desarrollo de insecticidas potentes y eficientes dirigidos a receptores de insectos rianodina (RyRs) ha sido de gran interés en el área de control de plagas agrícolas. Hasta la fecha, varios de diamida de insecticidas contra plagas que ryrs han sido comercializados, que genera ingresos anuales de 2 billones de dólares. Pero la comprensión del modo de acción de insecticidas dirigidas a RyR es limitada por la falta de información estructural sobre insectos RyR. Esto a su vez restringe la comprensión del desarrollo de resistencia a los insecticidas en las plagas. La polilla del diamondback (DBM) es una plaga devastadora destruyendo cultivos crucíferos a nivel mundial, que también se ha reportado que muestran resistencia a los insecticidas de la diamida. Por lo tanto, es de gran importancia práctica para el desarrollo de nuevos insecticidas contra el RyR DBM, especialmente dirigidos a una región diferente del sitio de unión de la diamida tradicional. Aquí, presentamos un protocolo para caracterizar estructuralmente el dominio N-terminal de RyR de DBM. La estructura cristalina de la radiografía fue solucionada por reemplazo molecular con una resolución de 2.84 Å, que muestra un motivo plegamiento beta-trébol y una hélice alfa que flanqueaban. Este protocolo puede ser adaptado para la expresión, purificación y caracterización estructural de otros dominios o proteínas en general.

Introduction

Receptores de rianodina (RyRs) son canales iónicos específicos que median la penetración de iones de Ca2 + en las membranas del retículo sarcoplásmico (SR) en las células musculares. Por lo tanto, juegan un papel importante en la contracción excitación proceso de acoplamiento. En su forma funcional, la RyR monta como un homo-tetrámero con una masa molecular de > 2 MDa, con cada subunidad compuesta por residuos del aminoácido del ~ 5000. En los mamíferos, existen tres isoformas: RyR1 de tipo músculo esquelético, músculo cardiaco tipo de RyR2 - y RyR3-ubicuo se expresa en diferentes tejidos1.

En insectos hay un único tipo de RyR, que se expresa en el tejido muscular y nervioso2. RyR insectos es más similar a los RyR2 mamíferos con una identidad de secuencia de aproximadamente 47%3. Diamida insecticidas dirigidos a RyR de lepidópteros y coleópteros se han desarrollado y comercializado por grandes empresas como Bayer (flubendiamide), DuPont (chlorantraniliprole) y Syngenta (cyantraniliprole). Desde su reciente lanzamiento, diamida insecticidas se han convertido en uno de la clase de más rápido crecimiento de insecticidas. Actualmente, las ventas de estos tres insecticidas cada año han cruzado 2 billones de dólares con una tasa de crecimiento de más del 50% desde 2009 (Agranova).

Recientes estudios han reportado el desarrollo de resistencia en los insectos después de algunas generaciones de uso de estos insecticidas4,5,6,7,8. Las mutaciones de la resistencia en el dominio transmembrana de RyRs de la polilla del diamondback (DBM), Plutella xylostella (G4946E, I4790M) y las posiciones correspondientes de minador del tomate, Tuta absoluta (G4903E, I4746M) muestran que la región podría participar en el enlace de insecticida diamida como esta región es conocida por ser crítica para la compuerta del canal4,8,9. A pesar de extensas investigaciones en esta área, los mecanismos moleculares exactos de diamida insecticidas permanecen fuera de alcance. Por otra parte, no está claro si las mutaciones de resistencia afectan las interacciones con diamides directamente o allosterically.

Estudios anteriores han reportado la estructura de varios dominios de RyR de especies de mamíferos y la estructura de cuerpo entero RyR1 mamíferos y RyR2 por cristalografía de rayos x y microscopia del cryo-electrón, respectivamente10,11, 12,13,14,15,16,17,18,19,20,21 . Pero hasta el momento, ninguna estructura de insecto RyR se ha divulgado, que nos impide entender los entresijos moleculares de la función del receptor, así como los mecanismos moleculares de acción insecticida y el desarrollo de resistencia a los insecticidas.

En este manuscrito, presentamos un protocolo generalizado para la caracterización estructural de dominio β-trébol de N-terminal del receptor de rianodina de palomilla, una plaga destructiva que infectan cultivos crucíferas a nivel mundial22. La construcción fue diseñada según el conejo publicado RyR1 NTD cristal estructuras23,24y cryo-EM modelos estructurales16,17,18,19, 20 , 21. esta es la primera estructura de alta resolución para insectos RyR, que revela el mecanismo de compuerta canal y proporciona una plantilla importante para el desarrollo de insecticidas específicos usando el diseño de fármacos basado en estructura. Para la aclaración de la estructura, se empleó Cristalografía de rayos x, que se considera como el gold standard para la determinación de la estructura de proteínas en cerca de resolución atómica. Aunque el proceso de cristalización es impredecible y mano de obra, este protocolo paso a paso le ayudará a los investigadores a expresar, purificar y caracterizar otros dominios de insecto RyR o cualquier otras proteínas en general.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. clonación de genes, expresión de la proteína y purificación

  1. PCR amplificación ADN correspondiente a la proteína de interés (residuos 1-205 de DBM RyR, Genbank según no. AFW97408) y clonar en pET-28a-HMT vector de clonación de ligadura-independiente (LIC)25. Este vector contiene una etiqueta histidina, etiqueta MBP y un sitio de la hendidura de proteasa TEV en el N-terminal15.
    1. Diseño Lic. primers para la amplificación del gene de la blanco con 5' extensiones de LIC-compatible con:
      Primer avance de LIC:
      5' TACTTCCAATCCAATGCAATGGCGGAAGCGGAAGGGG 3'
      Cartilla LIC inversa:
      5' TTATCCACTTCCAATGTTATTATATGCCGGTCCCGTACGGC 3'
    2. Combinar los componentes de la reacción (50 μL): tampón 1 μL de plantillas de la DNA (100 ng/μL), 1 μL de cebador forward (10 μM), 1 μL de cebador reverso (10 μM), 0,5 μL de ADN polimerasa (NEB), 5 μL de reacción 10 x, 1 μL de dNTP (25 mM) , 40,5 μL de Rnasa free Dec2O.
      1. Coloque la mezcla de reacción en una máquina PCR y ejecutar el siguiente programa.
      2. Incubar a 95 ° C por 3 min, y luego ejecutar 30 ciclos de (95 ° C por 30 s, 58 ° C durante 15 s, 72 ° C por 1 min). Incubar a 72 ° C por 5 min y luego mantener a 4 ° C.
      3. Ejecutar la mezcla de reacción entera (50 μL) en un gel de agarosa al 2% y extracto con un Kit de extracción de Gel. Seguir el protocolo del fabricante.
    3. Independiente de la ligadura de clonación (Lic.)
      1. Realizar digestión SspI (60 μL): 20 μL de vector de ADN (50 ng/μL), 6 μL de 10 x buffer de reacción, 4 μL de SspI y 30 μL de ddH2O. incubar a 37 ° C por 3 h. ejecutar la reacción entera mezcla en gel de agarosa 1% y extraer con un Kit de extracción de Gel. Seguir el protocolo del fabricante.
      2. Realizar tratamiento de polimerasa de la DNA de T4 del vector e insertar ADN. Combinar los siguientes: 5 μL de ADN vector o inserto (50 ng/μL), 2 μL de tampón de polimerasa de la DNA de x T4 10, 1 μL de dGTP (25 mM) para el vector o 1 μL de dCTP (25 mM) para insertar DNA, 1 μL de la TDT (100 mM), 0.4 μL de T4 DNA polimerasa (LIC-calificado) y 9,6 μL de ddH2O. reacciones de incubar a temperatura ambiente durante 40 minutos Inactive por calor enzima a 75 ° C por 20 min.
        Nota: El vector LIC e insertar ADN deben ser tratados en reacciones separadas.
      3. Realizar el LIC recocido reacción. Combinar los siguientes: 2 μL de ADN inserto tratados con T4, 2 μL de LIC tratados con T4 ADN del vector. Incubar la reacción a temperatura ambiente durante 10 minutos.
  2. Transformar BL21 (DE3) e. coli las células con este plásmido recombinante.
    1. Descongelar las células competentes (50 μL en el tubo de microcentrífuga) en hielo.
    2. Añadir aproximadamente 1 μL (50 ng) del plásmido en el tubo. Mezcle las células y ADN sacudiendo suavemente el tubo de 2 – 3 veces. Coloque el tubo en hielo por 20 min.
    3. Caliente golpes a 42 ° C 40 lugar s. el tubo en hielo nuevamente por 2 minutos agregue 1 mL de medio de temperatura LB al tubo.
    4. Lugar el tubo de mezcla en la coctelera de 250 rpm a 37 ° C durante 45 minutos difundir 150 – 200 μL de la mezcla sobre las placas de selección. Invierta la placa e incubar durante una noche a 37 ° C.
  3. Escoge una sola Colonia y cultura las células en medio de 2YT 100 mL que contiene 50 kanamicina μg/mL a 37 ° C durante la noche. A la mañana siguiente, inocular medio de 2YT 1 L que contiene kanamicina 50 de μg/mL con 10 mL de la noche a la mañana cultura e incubar en la incubadora de la coctelera de 37 ° C a 250 rpm, hasta el OD600 ~ 0.6. Después de eso inducir la cultura con IPTG para una concentración final de 0,4 mM y crecer para otro 5 h a 30 ° C.
  4. La cosecha de las células por centrifugación a 8.000 x g por 10 min a 4 ° C, recoger las células y resuspender cada células de 10 g en 40 mL de tampón de lisis (10 mM HEPES pH 7.4, 250 mM KCl, 10 mM β-mercaptoetanol, lisozima de 25 μg/mL, 25 μg/mL DNasa 1 mM PMSF).
    1. Interrumpir por sonicación en amplitud de 65% por 8 min con 1 s s 1 y el apagado. Eliminar los restos celulares por centrifugación a 40.000 x g durante 30 min a 4 ° C. Filtrar el sobrenadante por pasando por 0,22 μm filtro y cargar en el bucle de muestra.
  5. Purificar la proteína de fusión, hienden la etiqueta y volver a purificar la proteína diana.
    1. Purificar la proteína de fusión utilizando columna de Ni-NTA (tampón de Unión: pH HEPES 10 mM 7.4, 250 mM KCl, tampón de elución: pH HEPES 10 mM 7.4, 250 mM KCl, imidazol de 500 mM) y purificar mediante un sistema de purificación, con un degradado lineal de imidazol 20-250 mM.
    2. Unirse a la proteína diana eluídas con proteasa TEV (1:50 cociente) durante la noche a 4 ° C.
    3. Purificar la mezcla de reacción de hendidura utilizando columna de resina de amilosa (tampón de Unión: pH HEPES 10 mM 7.4, 250 mM KCl, tampón de elución: pH HEPES 10 mM 7.4, 250 mM KCl, maltosa 10 mM) y la columna de Ni-NTA para quitar la etiqueta y proteasa TEV. La proteína diana estará en la fracción de flujo a través de estas dos columnas.
    4. Dializan la muestra contra tampón de diálisis (10 mM Tris-HCl pH 8.8, 50 mM KCl, 10 mM β-mercaptoetanol para reducir la concentración de sal. Purificar la muestra en una columna de intercambio aniónico (tampón de Unión: 10 mM Tris-HCl de pH 8.8, 10 mM β-mercaptoetanol, tampón de elución: 10 mM Tris-HCl de pH 8.8, de 1 M de KCl, 10 mM β-mercaptoetanol) por un degradado lineal de 20 – 500 mM KCl en el tampón de elución.
    5. Como paso final en el proceso de purificación, concentrado de la proteína usando el concentrador centrífugo (10 kDa MWCO) e inyecte en una columna de gel filtración Superdex 200 26/600 para comprobar la homogeneidad.
  6. Examinar la pureza de la proteína ejecutándolo en un 15% de SDS PAGE.
    Nota: Todas las columnas se ejecutan en un sistema de purificación de proteína con un caudal de enlace de 2 mL/min y un caudal de elución de 4 mL/min excepto filtración de gel de 1 mL/min.

2. cristalización y la preparación de la proteína

  1. Concentrar la muestra de proteína purificada a 10 mg/mL utilizando el concentrador centrífugo (10 kDa MWCO) y cambio de buffer a buffer de cristalización antes de guardarlo a-80 ° C.
  2. Realizar proyección de cristalización (proporción 1:1, 200 nL de proteína y 200 nL de amortiguamiento de la reserva) por la sesión caiga método de difusión de vapor a 295 K con varios kits de cristalización utilizando un sistema robótico en un formato de 96 pocillos para manejo de líquidos automatizados.
    Nota: Usamos equipos de investigación de dimensiones moleculares y Hampton y el grifo automático de manejo de líquidos.
  3. Sellar la placa de 96 pocillos cristalización para evitar la evaporación y permitir el equilibrio de la caída de la proteína con el búfer de reserva. Entonces, mantener las placas en la incubadora de cristal a 18 ° C.
  4. Verifique las placas de 96 pozos periódicamente con un microscopio de luz para controlar el crecimiento y la formación de cristales.
  5. Para diferenciar cristales proteicos de cristales de sal, usar un tinte de proteína. Añadir 1 μl de colorante a la gota del destino. Espere aproximadamente 1 h y observar bajo el microscopio. Los cristales de proteína dará vuelta al azules.
  6. Utilizar las condiciones de cristalización positiva (sulfato de amonio de 1.5 M, 0.1 M Tris pH 8.0) para optimizar aún más los cristales con colgante gota método de difusión de vapor en placas de 24 pocillos.
    1. Optimizar el pH de 7.0 a 8.5 con intervalo de unidad de pH 0,5 cada paso. Optimizar la concentración de sulfato de amonio de 1.2 M a 1,7 M con intervalos de 0.1 M cada paso. (En nuestro caso las mejores condiciones de producir grandes cristales en forma de placa era sulfato de amonio de 0.1 M HEPES pH 7.0 y 1.6 M)

3. cristal de montaje, recogida de datos de la radiografía y determinación de la estructura

  1. Montar cristales en un cryoloop y flash-cool en nitrógeno líquido con depósito solución que contiene 20% de glicerol como crio-protector. Coloque los cristales en unipuck para el almacenamiento y transporte.
  2. La pantalla cristales de la proteína usando un Rigaku en difracción de rayos x. Elija los mejores con las resoluciones más altas para la recolección de datos en las instalaciones de sincrotrón (nuestro conjunto de datos fue tomado del BL17U1 en instalaciones de Radiación Sincrotrón de Shanghai).
    1. Utilice el software de control de línea BluIce26 montaje y centro de los cristales por la función de centrado automática o manual. Realizar exposiciones de prueba para determinar la estrategia de recolección de datos, incluyendo a partir de ángulo, tiempo de exposición, distancia del detector, ancho de marco y números.
    2. Recoger datos por consiguiente (hemos recogido 180 marcos con tiempo de exposición de 1 s, ancho de marco de 1° y la distancia del detector de 350 mm).
  3. Índice, integrar y ampliar el conjunto de datos utilizando HKL2000 suite27. Primero la función Buscar para encontrar los puntos de difracción y luego índice los puntos y seleccione el grupo de espacio a la derecha. Tras la integración del pico, escala del conjunto de datos con el modelo de error apropiado y guarde el archivo de .sca salida.
  4. Resolver el problema de la fase de reemplazo molecular usando Phaser28 en PHENIX29.
    1. Para calcular el número de copias posibles de las moléculas de proteína en la unidad asimétrica Xtriage30.
    2. Busca las plantillas de estructura adecuada con semejanza de la identidad y estructural de la secuencia alta como la proteína de la blanco usando estructuras conocidas de la literatura o los modelos generados por servidor de predicción de estructura como Phyre231 (utilizamos conejo RyR1 NTD como un modelo de búsqueda, ID de PDB 2XOA).
    3. Ejecute el Phaser usando el archivo de datos de difracción, el archivo de estructura de la plantilla y el archivo de secuencia de la proteína para encontrar la solución.
  5. Realizar autocompilación32 en PHENIX29 para generar el modelo inicial utilizando el archivo de salida de Phaser y el archivo de secuencia de la proteína diana.
  6. Manual construir la estructura en la densidad del electrón experimental modificado con focha33 y perfeccionar utilizando phenix.refine34 en ciclos iterativos.
  7. Validar el modelo final con las herramientas de validación de PHENIX18.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Purificación del

El dominio N-terminal de DBM RyR se expresó como proteína de fusión con una etiqueta de hexahistidine, una etiqueta MBP y un sitio de la hendidura de proteasa TEV. Hemos seguido una estrategia de cinco pasos de purificación para obtener una proteína altamente pura, adecuada para el propósito de la cristalización. En primer lugar, la proteína de fusión fue purificada de la fracción soluble de lisado de células por columna de Ni-NTA (HP HisTrap). A continuación, la proteína de fusión fue sometida a escote de proteasa TEV y la molécula de hexahistidine-MBP fue quitada por la columna de resina de amilosa seguido por columna de Ni-NTA. Además, la proteína se purificó por columna de intercambio aniónico (Q Sepharose HP) y finalmente por la columna de gel filtración (Superdex 200 26/600). El rendimiento final de proteico purificado del cultivo bacteriano 1 L 2YT medios fue ~ 4 mg. La proteína purificada mostraron una única banda en SDS-PAGE de ~ 21 kDa (figura 1). El volumen de elución de la columna de gel filtración confirmó la NTD RyR purificados para ser un monómero (figura 1).

Cristalización

Cristalización inicial en placas de 96 pocillos rindió cristales en varias condiciones. Estas condiciones fueron seleccionadas para la optimización de cristal en placas de 24 pozos. La condición más óptima donde se formaron cristales de forma de la placa de alta calidad era 0.1 M HEPES pH 7.0 y 1.6 M sulfato de amonio (figura 2).

Determinación de la estructura

Cristales obtienen fue difractada a 2.84 Å en la línea BL17U1 instalaciones de Radiación Sincrotrón de Shanghai. El cristal fue indexado en grupo P61 con parámetros de celda unidad un = 170.13, b = 170.13, c = 51.763 Å, α = β = 90,00 °, γ = 120 º. Para la determinación de la estructura, reemplazo molecular fue empleado con conejo RyR1 NTD como un modelo de búsqueda en PHENIX. Otro refinamiento de la estructura se realizó en PHENIX un final Rtrabajar y Rlibre de 21.63 y 24,52%, respectivamente. Las estadísticas de recolección y refinamiento de datos se enumeran en la tabla 1. La estructura solucionada de DBM RyR NTD cubriendo los residuos 1-205 (PDB ID 5Y9V) se muestra en la figura 3.

Figure 1
Figura 1: Cromatograma de filtración gel y SDS-PAGE que representa purificación de DBM RyR NTD35. SDS PAGE (15%) en el recuadro muestra purificada DBM RyR NTD como una sola banda después de los cinco pasos estrategia de purificación. El carril de la izquierda muestra el marcador estándar de proteína (PM). El cromatógrama de la filtración de gel obtenido usando una columna de Superdex 200 26/600 muestra los picos de elución en 240 mL, que corresponde a la forma monomérica de la proteína. Haga clic aquí para ver una versión más grande de esta figura.

Figure 2
Figura 2. Cristalización de DBM RyR NTD35Cristales de DBM RyR NTD producido por método de difusión de vapor como se ha visto bajo un microscopio de luz. La condición de la cristalización fue sulfato de amonio de 0.1 M HEPES pH 7.0 y 1.6 M. Barra de escala = 200 μm. haga clic aquí para ver una versión más grande de esta figura.

Figure 3
Figura 3: Estructura de DBM RyR NTD (PDB ID 5Y9V)35Resolver la estructura de la proteína se muestra desde dos puntos de vista. Elementos de estructura secundaria son etiquetados. Filamentos β se muestran de color morado. Α hélice y hélice10 3 se muestran en azul. Bucles se muestran en blanco. NT y Ct son el N-terminal y c-terminal de la proteína, respectivamente. Haga clic aquí para ver una versión más grande de esta figura.

Tabla 1: estadísticas de recolección y refinamiento de datos para la DBM RyR NTD cristal35. Haga clic aquí para descargar esta tabla.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

En este papel, describimos el procedimiento para expresar por vía recombinante, purificar, cristalizar y determinar la estructura de DBM RyR NTD. Para la cristalización, un requisito crucial es obtener proteínas con homogeneidad, pureza y alta solubilidad. En nuestro protocolo, decidimos utilizar vector pET-28a-HMT ya que contiene un hexahistidine etiqueta y etiqueta de la MBP, que pueden ser utilizados para que la purificación obtener una mayor pureza de doblez. Además, el MBP etiqueta SIDA en la solubilidad de la proteína diana. Purifica la proteína cinco pasos consecutivos que rindió la proteína que era muy puro y adecuado para la cristalización. Proyección de la cristalización se realizó mediante líquido automatizado sistema de manejo. Comparado con proyección tradicional por el ajuste manual de la gota, sistema automatizado utiliza volúmenes muy pequeños de muestra, ahorra tiempo y energía. También mejora la reproducibilidad debido a la precisión del manejo de líquidos. Cristales fueron difractados internamente para la detección y en el sincrotrón para la recolección de datos ya que proporciona rayos x con mayor intensidad y menor divergencia tal modo obtención de datos de alta calidad. Reemplazo molecular fue nuestra primera opción como plantillas estructurales similares estaban disponibles en la base de datos. La forma alternativa es usar una fase experimental, incluyendo MAD and SAD, MIR, etc.

Mientras que para resolver la estructura de DBM RyR NTD, los coeficientes de Matthews de Xtriage30 sugiere que la unidad asimétrica (ASU) probablemente contenía cuatro monómeros con 46% solvente contenido, que tiene una probabilidad del 49%. Sin embargo, no pudimos encontrar la solución adecuada con cuatro moléculas en ASU. Posterior corre a buscar dos, tres, cinco, seis moléculas tampoco. Finalmente encontramos la solución adecuada con sólo una molécula en ASU, que sólo tiene 4% de probabilidad y sobre 86% de contenido de solvente. El alto contenido de agua fue confirmado después de que hemos solucionado la estructura. Así, el extremo alto contenido solvente existen dependiendo de la forma intrínseca de que paquetes de proteína.

Aunque la cristalografía de rayos x es un estándar de oro para la determinación de la estructura de proteínas, las proteínas con gran desorden o regiones flexibles y algunos complejos de proteínas grandes con débil afinidad están desafiando a cristalizar. Métodos de la ingeniería de la proteína, incluyendo lazo-truncamiento, superficie entropía reducción y cross-linking, podría mejorar las posibilidades de obtención de cristales de proteína mejor. Además de la revelación de estructuras de proteínas de alta resolución, Cristalografía de rayos x puede utilizarse también para el estudio de las interacciones proteína-pesticidas, que nos ayudaría en el diseño de plaguicidas basado en la estructura. Qi et al encontraron que diferentes familias de diamides podrían enlazar a sitios distintos que son diferentes entre especies36. Con nuestra estrategia, uno puede determinar las estructuras de RyR de múltiples especies e identificar los elementos únicos responsables de la species-specificity observada. En general, este protocolo puede ser adaptado para la determinación de la expresión, purificación, cristalización y la estructura de proteínas o dominios de la proteína por sí solas o en complejos con fármacos de molécula pequeña.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Los autores no tienen nada que revelar.

Acknowledgements

La financiación para esta investigación fue proporcionada por: nacionales de investigación clave y programa de desarrollo de China (2017YFD0201400, 2017YFD0201403), nacional naturaleza ciencia Fundación de China (31320103922, 31230061) y proyecto de nacional investigación básica (973) programa de China (2015CB856500, 2015CB856504). Estamos muy agradecidos al personal en la línea BL17U1 en instalaciones de Radiación Sincrotrón Shanghai (SSRF).

Materials

Name Company Catalog Number Comments
pET-28a-HMT vector This modified pET vector contains a hexahistidine tag, an MBP fusion protein and a TEV protease cleavage site at the N-terminus (Lobo and Van Petegem, 2009)
E. coli BL21 (DE3) strain Novagen 69450-3CN
HisTrapHP column (5 mL) GE Healthcare 45-000-325
Amylose resin column New England Biolabs E8021S
Q Sepharose high-performance column  GE Healthcare 17-1154-01
Amicon concentrators (10 kDa MWCO) Millipore UFC901008
Superdex 200 26/600 gel-filtration column  GE Healthcare 28-9893-36
Automated liquid handling robotic system  Art Robbins Instruments Gryphon
96 Well CrystalQuick Greiner bio-one 82050-494
Uni-Puck Molecular Dimensions MD7-601
Mounted CryoLoop - 20 micron Hampton Research HR4-955
CryoWand Molecular Dimensions MD7-411
Puck dewar loading tool Molecular Dimensions MD7-607
Nano drop Thermo Scientific NanoDrop One
Crystal incubator Molecular Dimensions MD5-605
X-Ray diffractor Rigaku FRX
PCR machine Eppendorf Nexus GX2
Plasmid mini-prep kit Qiagen 27104
Gel extraction kit Qiagen 28704
SspI restriction endonuclease NEB R0132S
T4 DNA polymerase Novagen 2868713
Kanamycin Scientific Chemical 25389940
IPTG Genview 367931
HEPES Genview 7365459
β-mercaptoethanol Genview 60242
Centrifuge Thermo Scientific Sorvall LYNX 6000 
Sonnicator Scientz II-D
Protein purification system GE Healthcare Akta Pure
Light microscope Nikon SMZ745
IzIt crystal dye Hampton Research HR4-710
Electrophoresis unit Bio-Rad 1658005EDU
Shaker Incubator Zhicheng ZWYR-D2401
Index crystal screen Hampton Research HR2-144
Structure crystal screen Molecular Dimensions MD1-01
ProPlex crystal screen Molecular Dimensions MD1-38
PACT premier crystal screen Molecular Dimensions MD1-29
JCSG-plus crystal screen Molecular Dimensions MD1-37

DOWNLOAD MATERIALS LIST

References

  1. Giannini, G., Sorrentino, V. Molecular structure and tissue distribution of ryanodine receptors calcium channels. Medicinal Research Reviews. 15, (4), 313-323 (1995).
  2. Takeshima, H., et al. Isolation and characterization of a gene for a ryanodine receptor/calcium release channel in Drosophila melanogaster. FEBS Letters. 337, (1), 81-87 (1994).
  3. Sattelle, D. B., Cordova, D., Cheek, T. R. Insect ryanodine receptors: molecular targets for novel pest control chemicals. Invertebrate Neuroscience. 8, (3), 107-119 (2008).
  4. Steinbach, D., et al. Geographic spread, genetics and functional characteristics of ryanodine receptor based target-site resistance to diamide insecticides in diamondback moth, Plutella xylostella. Insect Biochemistry and Molecular Biology. 63, 14-22 (2015).
  5. Wang, X., Khakame, S. K., Ye, C., Yang, Y., Wu, Y. Characterisation of field-evolved resistance to chlorantraniliprole in the diamondback moth, Plutella xylostella, from China. Pest Management Science. 69, (5), 661-665 (2013).
  6. Liu, X., Wang, H. Y., Ning, Y. B., Qiao, K., Wang, K. Y. Resistance Selection and Characterization of Chlorantraniliprole Resistance in Plutella xylostella (Lepidoptera: Plutellidae). Journal of Economic Entomology. 108, (4), 1978-1985 (2015).
  7. Guo, L., et al. Functional analysis of a point mutation in the ryanodine receptor of Plutella xylostella (L.) associated with resistance to chlorantraniliprole. Pest Management Science. 70, (7), 1083-1089 (2014).
  8. Troczka, B., et al. Resistance to diamide insecticides in diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae) is associated with a mutation in the membrane-spanning domain of the ryanodine receptor. Insect Biochemistry and Molecular Biology. 42, (11), 873-880 (2012).
  9. Roditakis, E., et al. Ryanodine receptor point mutations confer diamide insecticide resistance in tomato leafminer, Tuta absoluta (Lepidoptera: Gelechiidae). Insect Biochemistry and Molecular Biology. 80, 11-20 (2017).
  10. Borko, L., et al. Structural insights into the human RyR2 N-terminal region involved in cardiac arrhythmias. Acta Crystallographica Section D. 70, (Pt 11), 2897-2912 (2014).
  11. Sharma, P., et al. Structural determination of the phosphorylation domain of the ryanodine receptor. FEBS Journal. 279, (20), 3952-3964 (2012).
  12. Kimlicka, L., Lau, K., Tung, C. C., Van Petegem, F. Disease mutations in the ryanodine receptor N-terminal region couple to a mobile intersubunit interface. Nature Communications. 4, 1506 (2013).
  13. Lau, K., Van Petegem, F. Crystal structures of wild type and disease mutant forms of the ryanodine receptor SPRY2 domain. Nature Communications. 5, 5397 (2014).
  14. Amador, F. J., et al. Crystal structure of type I ryanodine receptor amino-terminal beta-trefoil domain reveals a disease-associated mutation "hot spot" loop. Proceedings of the National Academy of Sciences of the United States of America. 106, (27), 11040-11044 (2009).
  15. Lobo, P. A., Van Petegem, F. Crystal structures of the N-terminal domains of cardiac and skeletal muscle ryanodine receptors: insights into disease mutations. Structure. 17, (11), 1505-1514 (2009).
  16. des Georges, A., et al. Structural Basis for Gating and Activation of RyR1. Cell. 167, (1), 145-157 (2016).
  17. Efremov, R. G., Leitner, A., Aebersold, R., Raunser, S. Architecture and conformational switch mechanism of the ryanodine receptor. Nature. 517, (7532), 39-43 (2015).
  18. Peng, W., et al. Structural basis for the gating mechanism of the type 2 ryanodine receptor RyR2. Science. 354, (6310), (2016).
  19. Wei, R. S., et al. Structural insights into Ca2+-activated long-range allosteric channel gating of RyR1. Cell Research. 26, (9), 977-994 (2016).
  20. Yan, Z., et al. Structure of the rabbit ryanodine receptor RyR1 at near-atomic resolution. Nature. 517, (7532), 50-55 (2015).
  21. Zalk, R., et al. Structure of a mammalian ryanodine receptor. Nature. 517, (7532), 44-49 (2015).
  22. Furlong, M. J., Wright, D. J., Dosdall, L. M. Diamondback moth ecology and management: problems, progress, and prospects. Annual Review of Entomology. 58, 517-541 (2013).
  23. Amador, F. J., et al. Crystal structure of type I ryanodine receptor amino-terminal beta-trefoil domain reveals a disease-associated mutation "hot spot" loop. Proceedings of the National Academy of Sciences of the United States of America. 106, (27), 11040-11044 (2009).
  24. Lobo, P. A., Van Petegem, F. Crystal Structures of the N-Terminal Domains of Cardiac and Skeletal Muscle Ryanodine Receptors: Insights into Disease Mutations. Structure. 17, (11), 1505-1514 (2009).
  25. Aslanidis, C., de Jong, P. J. Ligation-independent cloning of PCR products (LIC-PCR). Nucleic Acids Research. 18, (20), 6069-6074 (1990).
  26. Stepanov, S., et al. JBluIce-EPICS control system for macromolecular crystallography. Acta Crystallographica Section D. 67, (3), 176-188 (2011).
  27. Minor, W., Cymborowski, M., Otwinowski, Z., Chruszcz, M. HKL-3000: the integration of data reduction and structure solution--from diffraction images to an initial model in minutes. Acta Crystallographica Section D. 62, (Pt 8), 859-866 (2006).
  28. McCoy, A. J., et al. Phaser crystallographic software. Journal of Applied Crystallography. 40, (Pt 4), 658-674 (2007).
  29. Adams, P. D., et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallographica Section D. 66, (Pt 2), 213-221 (2010).
  30. Zwart, P. H., Gross-Kunstleve, R. W., Adams, P. D. Xtriage and Fest: Automatic assessment of X-ray data and substructure structure factor estimation. CCP4 Newsletter. (43), 27-35 (2005).
  31. Kelley, L. A., Mezulis, S., Yates, C. M., Wass, M. N., Sternberg, M. J. The Phyre2 web portal for protein modeling, prediction and analysis. Nature Protocols. 10, (6), 845-858 (2015).
  32. Terwilliger, T. C., et al. Iterative model building, structure refinement and density modification with the PHENIX AutoBuild wizard. Acta Crystallographica Section D. 64, (Pt 1), 61-69 (2008).
  33. Emsley, P., Cowtan, K. Coot: model-building tools for molecular graphics. Acta Crystallographica Section D. 60, 2126-2132 (2004).
  34. Afonine, P. V., et al. Towards automated crystallographic structure refinement with phenix.refine. Acta Crystallographica Section D. 68, (Pt 4), 352-367 (2012).
  35. Lin, L., et al. Crystal structure of ryanodine receptor N-terminal domain from Plutella xylostella reveals two potential species-specific insecticide-targeting sites. Insect Biochemistry and Molecular Biology. 92, 73-83 (2018).
  36. Qi, S., Casida, J. E. Species differences in chlorantraniliprole and flubendiamide insecticide binding sites in the ryanodine receptor. Pesticide Biochemistry and Physiology. 107, (3), 321-326 (2013).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics