바이러스 성 감염 및 초파리 Melanogaster 상호 작용 호스트-바이러스의 분석의 설립

* These authors contributed equally
Immunology and Infection
 

Summary

이 프로토콜에는 vivo에서 바이러스 감염 초파리 melanogaster 나노 주입 방법 기본적인 기법을 사용 하 여 바이러스-호스트 상호 작용을 분석 하에 설정 하는 방법을 설명 합니다.

Cite this Article

Copy Citation | Download Citations

Yang, S., Zhao, Y., Yu, J., Fan, Z., Gong, S. t., Tang, H., Pan, L. Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster. J. Vis. Exp. (145), e58845, doi:10.3791/58845 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

바이러스 확산 전염병 질병의 주요 원인입니다. 따라서, 바이러스와 호스트 간의 상호 작용을 이해 바이러스 감염의 치료 및 예방의 우리의 지식 확장에 매우 중요 하다. 과일 파리 초파리 melanogaster 입증 하나 항 바이러스 요인에 대해 강력한 유전자 도구 및 높은 보존된 타고 난 면역 바이러스-호스트 상호 작용을 조사 하는 가장 효율적이 고 생산적인 모델 생물 신호 경로. 여기에 설명 된 절차는 바이러스 성 감염을 확립 하 고 성인 파리에서 조직의 항 바이러스 응답을 유도 하 나노 사출 메서드를 보여 줍니다. 이 방법에서는 바이러스 주입 복용량의 정확한 제어 실험 재현성을 높은 수 있습니다. 이 연구에서 설명 하는 프로토콜 파리와 바이러스, 주입 방법, 생존 율 분석, 바이러스 부하 측정 및 항 바이러스 경로 평가의 준비를 포함 한다. 파리의 배경에 의해 바이러스 성 감염의 영향 효과 여기에 언급 했다. 이 감염 방법은 실행 하기 쉬운 그리고 양적 반복; 그것은 바이러스-호스트 상호 작용에 관련 된 호스트/바이러스 성 요인에 대 한 화면을 신호 하는 타고 난 면역 및 바이러스 감염에 대 한 응답에 다른 생물학 통로 사이 누화를 부하에 적용할 수 있습니다.

Introduction

바이러스 성 감염, 특히 arboviruses는Chikungunya 바이러스1, 등으로 신흥 뎅기열 바이러스, 황열병 바이러스2 , Zika바이러스3, 왔다 공중 보건에 큰 위협 전염병 발생 하 여 4. 따라서, 바이러스-호스트 상호 작용의 더 나은 이해 것이 전염병 제어 및 인 간에 있는 바이러스 성 질병의 치료에 대 한 점점 더 중요 해지고 있다. 이 목표에 대 한 더 적절 하 고 효율적인 모델 바이러스 감염을 기본 메커니즘을 조사를 설립 해야 합니다.

과일 파리, Drosophilamelanogaster (D. melanogaster), 바이러스-호스트 상호 작용5,6 를 조사 하는 강력한 시스템을 제공 하 고 인간의 바이러스 성 질병7 공부에 가장 효율적인 모델 중 하나를 것을 입증 했다 , 8 , 9. 높은 보존된 항 바이러스 신호 경로 비교할 수 없는 유전 도구 파리 인간 항 바이러스 연구에 대 한 실제 영향으로 의미 있는 결과 생산 하는 좋은 모델. 또한, 파리 간편 하 고 저렴 한 실험실에서 유지 하 고 감염 시 바이러스와 호스트에서 새로운 규제 요인6,10 의 대규모 검열을 위한 편리.

4 주요 높은 보존된 항 바이러스 경로 (., RNA 간섭 (RNAi) 통로11, JAK STAT 통로12, NF-κB 통로 autophagy 통로13) 최근 초파리 에서 공부 잘 년6. RNAi 통로 대부분 바이러스 감염6,14의 종류를 억제 수 있습니다 광범위 한 항 바이러스 메커니즘입니다. Dicer-2 (Dcr-2) 또는 Argonaute 2 (AGO2) 유전자에 있는 돌연변이 의해이 통로의 파괴 증가 바이러스 titer와 호스트 사망률15,,1617발생할 수 있습니다. JAK STAT 통로에 곤충, 예를 들어 Flaviviridae 가족과 Dicistroviridae 가족에서 바이러스에 의해 감염의 제어에 연루 되어있다., 파리16 및 웨스트 나 일 바이러스 (WNV) 초파리 C 바이러스 (DCV) 고 뎅 기 바이러스 모기18,19에서. 초파리 통행세 (인간의 NF κB 통로를 동종) 및 면역 결핍 (IMD) 경로 (인간의 NF-κB 및 TNF 통로 유사)는 모두 바이러스 침공20,21, 을 방어에 관련 된 22. autophagy는 초파리23,24에 잘 특징 이다 바이러스 성 감염의 규칙에 관련 된 다른 보존된 메커니즘입니다. 따라서, 이러한 경로 및 이러한 항 바이러스 신호 및 다른 사이 해 크로스 토크의 새로운 규제 요인의 식별 대사, 노화, 신경 반응 등 생물학적 경로 설정할 수 있습니다 쉽게 초파리 에서 시스템입니다.

비록 가장 잘 설립 된 바이러스 감염 모델 초파리 에서 RNA 바이러스, 무지개 빛깔의 무척 추 동물 바이러스 6I 감염에 의해 유도 된다 (4-6) 하 고 칼 리 티아 바이러스 DNA 바이러스의 연구에 대 한 잠재적인 파리25, 26. 또한, 바이러스도 인플루엔자 바이러스9같은 초파리의 감염 수 있도록 수정할 수 있습니다. 이 크게 초파리 심사 플랫폼의 응용 프로그램을 확장 했다. 이 절차에서는 우리 초파리에 있는 바이러스 성 감염 시스템을 개발 하는 방법을 설명 하기 위해 예를 들어 DCV 사용 합니다. DCV 9 단백질27인코딩 약 9300 뉴클레오티드의 긍정적인 감각 단일 좌초 된 RNA 바이러스입니다. D. melanogaster의 자연 병원 체로 DCV 호스트 바이러스 상호 작용 및 공동 진화28동안 호스트 생리, 행동 및 기저 면역 반응을 공부 하기 적합 한 바이러스로 간주 됩니다. 또한, 야생 타입 파리에 감염을 따르는 그것의 급속 한 사망 율은 DCV 유용 하다 저항 또는 취약 유전자에 대 한 화면을 호스트29에.

그러나 초파리에 있는 바이러스 성 감염을 공부 하는 때, 관심사의 여러 측면 있다. 예를 들어 공생 박테리아 Wolbachia 초파리 와 모기30,,3132에서 RNA 바이러스 확산의 넓은 스펙트럼을 억제 하는 기능이 있다. 최근의 증거는 Wolbachia 블록 Sindbis 바이러스 (SINV) 감염에는 upregulation 통해 methyltransferase 호스트33Mt2 식의 가능한 메커니즘을 보여 줍니다. 또한, 곤충의 유전적 배경과 바이러스 감염에 대 한 중요 한 이기도합니다. 유전자, pastrel (태평양 표준시), 자연 다형성 초파리34,35, DCV 감염 자화 율을 결정 하는 예를 들어, 동안 Ubc-E2H CG8492 의 loci 크리켓 마비 바이러스 (CrPV)와 무리 집 바이러스 (FHV) 감염, 각각36에서 포함 된다.

파리, 바이러스-호스트 상호 작용을 설정 하는 특정 방법 초파리 셀 라인37,38, 구두에 호스트 세포 구성 요소에 대 한 높은 처리 화면 등 연구 목적에 따라 선택 되어야 한다 감염 창 자 관련 항 바이러스 응답22,39,40,41,42 또는 나노 사출 상피 장벽을 조직의 면역 자극을 전달 하 여 찌르는 바늘을 공부 하 응답 합니다. 나노 사출 정확 하 게 제어할 수 유도 제어 항 바이러스 반응 및 생리 적인 병 변43, 바이러스 성 복용량 높은 실험 재현성44따라서 보장. 이 연구에서 우리는 초파리, 파리 배경 효과의 중요성을 강조에서 바이러스-호스트 상호 작용을 공부 하는 나노 사출 방법을 설명 합니다.

Protocol

참고: 시작 하기 전에 실험, 셀 라인 및 사용 하는 비행 주식 해야 하지 오염 특히 DCV, FHV, 초파리 X 바이러스 (DXV), 및 조류 신장 염 바이러스 (ANV) 바이러스에 대 한 다른 병원 균에 의해. 이상적으로, RNA 시퀀싱 또는 간단 하 게 PCR 기반 식별 오염10,45를 감지 하는 데 사용 됩니다. 오염 발생, 세포 선 및 비행 주식 사용할 수 없을 때까지 더 이상46완전히 소독.

1. 바이러스와 비행 준비

  1. 바이러스 전파 및 컬렉션
    참고: 초파리 S2 * 셀 DCV 전파 및 적정을 위해 사용 됩니다. S2 * 셀 라인 늦은 단계 D. melanogaster 태아의 기본 문화에서 파생 됩니다. 이 셀 라인 잘 했습니다47위에서 설명한.
    1. 1 x 107 가능한 셀/mL의 조밀도에 10 cm 세포 문화 접시에, 반 부착 단층으로 S2 * 셀 추가 CO2, 없이 25 ° C에서 슈나이더의 초파리 매체에 성장. S2 * 셀에 대 한 완전 한 매체 사용: 10% 열을 포함 하는 슈나이더의 초파리 매체 비활성화 FBS, 100 단위/mL 페니실린 및 100 μ g/mL 스.
      참고: 건강 한 세포 둥근 모양을 표시 하 고 동종 크기 전시 해야 합니다.
    2. 신속 하 게 녹여-80 ° c에서 25 ° C 물 목욕 DCV 주식. S2 * DCV 나에와 세포를 감염 세포 문화 요리 바이러스 솔루션의 1 mL를 직접 추가 하 여 즉시 = 0.01 (성장 지역: 55 cm2) S2 * 셀에 대 한 완전 한 매체의 10 mL와 함께.
    3. 3 ~ 5 일 동안 25 ° c 셀을 품 어. 셀 형태는 비정상적인 바이러스 컬렉션에 대 한 준비가 되 면, (셀 모양 흐릿하게 보이는) 문화 매체 검은 입자 세포 파편의 지표의 가득 차 있다.
    4. 아래로 pipetting으로 15 mL 튜브에 전체 셀 문화를 수집 하 고-80 ℃에서 동결 (에 대 한 최대 1 년).
      참고: DCV 저장할 수 있습니다, infectivity의 최소한의 손실-80 ° C에서 시간의 연장된 기간에 대 한 최대 1 년.
    5. 일정 한 동요와 25 ° C 물 욕조에 세포 배양을 해 동 하 고 4 ° c.에 15 분 동안 6000 x g에서 원심 살 균 15 mL 튜브에 소용돌이 상쾌한을 수집 합니다. 약 200 μ 튜브 당 바이러스 솔루션의 최대 수.
      참고:-80 ° c.에서 1 년까지 및 4 ° C에서 최대 3 일의 짧은 기간 동안 저장 될 수 있다 바이러스 aliquots 반복된 freeze-thaw 주기는 피해 야 한다. 그것은 항상 한 번에 모든 약 수를 사용 하 여입니다.
    6. 5 무작위 바이러스를 포함 하 관 cytopathic 효과 (CPE) 분석 결과 의해 평균 바이러스 (TCID50) 조직 문화 감염 복용량을 결정을 선택 (TCID50의 1 단위 = 0.7 플 라크 형성 단위 [PFU]).
      참고: CPE 호스트 세포 바이러스 침입으로 인 한 구조적인 변화를 말합니다. 감염 바이러스는 세포의 호스트 셀 또는 셀 세포48를 재현 하는 무 능력 때문에 하지 않고 죽을 때 발생 합니다.
      1. 1 일에 pipetting으로 준비 S2 * 세포를 수집 합니다. 휴대폰 번호를 계산 합니다. 4 분에 대 한 300 x g 세포를 원심 및 삭제는 상쾌한. 1 x 106 셀/mL S2 * 셀 1.1.1 단계에 설명 된 대로 완전 한 매체와의 밀도를 셀을 희석.
      2. 1 x 105 S2 시드 * 플랫-96-잘-바닥판 (confluency ~ 30%)을 잘 당 세포 (100 μ).
      3. S2 * 셀에 대 한 완전 한 매체와 DCV 재고의 직렬 10 희석을 수행 합니다. 우물에 50 µ L 희석을 추가 합니다. 부정적인 통제로 잘 분류 잘에 바이러스 없이 문화 매체의 50 µ L를 추가 합니다.
        참고: 각 희석 속도 대 한 8 우물 사용 되었다. 전형적인 DCV 수율은 약 108-109 PFU/mL, 희석 이상 ~ 10-5-10-10을 커버 한다.
      4. 하루에 4, CPE는 20 X 40 X 목표와 밝은 분야 현미경으로 관찰 합니다. 셀 흐리게 보일 잘 분류 하 고 매체 파편 "긍정적인 글쎄", 그리고 있는 셀 형태학은 "부정적인 잘"로 정상 잘의 가득 차 있다.
      5. 와 마크 CPE 포지티브 또는 네거티브 웰 스 + 또는-, 각각. 리드와 Muench 메서드49여 TCID50 바이러스를 계산 합니다.
    7. 모든 오염된 물질 및 오염 제거 냄비에 장갑의 처분. 바이러스는 원하는 TCID50도달할 수 없는, 경우 centrifuging 68000 x g 1 h 4 ° c.에 대 한에 의해 바이러스 솔루션의 100 mL를 집중
      참고: 10에서 복용량의 범위 실험의 목표에 따라2 106 TCID50 단위를 바이러스 감염에 사용할 수 있습니다. 일반적으로, 우리는 3 x 106 TCID50 단위를 사용합니다.
    8. 상쾌한 삭제 하 고 다시 Tris HCl 버퍼 (10 m m, pH 7.2)의 1 mL에 일시 중지. 튜브 및-80 ° c.에 게 바이러스 솔루션의 aliquot 20 μ 5 무작위 관을 TCID50 평균 바이러스를 다시 확인을 선택 하십시오.
  2. 감염에 대 한 비행 준비
    참고: 공생 박테리아 Wolbachia 곤충30,,3132,,3341에서 RNA 바이러스 감염의 많은 종류를 억제 수 있습니다. 따라서, 호스트-바이러스 감염 vivo에서33를 공부 하기 전에 파리에서 Wolbachia 정화에 필수적 이다.
    1. 신선한 표준 cornmeal 비행 음식 (식품의 1 패 포함 한다 cornmeal, 효 모, 한 천, CaCl2 0.726 g의 10.6 g의 32.19 g의 77.7 g 4 g (70% 에탄올)에서 50 µ g/mL 항생물질의 400 μ를 추가 하 여 항생물질을 포함 하는 비행 음식 준비 자당, 포도 당, 칼륨 솔의 고 5% C8H8O3의 15 mL 2 세대의 63.3 g의 31.62 g). 철저 하 게 혼합 하 고 4 ° c 하룻밤 에탄올을 증발 하는 음식 배치.
      참고: 에탄올의 높은 복용량 비행 불 임, 그래서이 단계를 생략 하지 않습니다 영향을 수 있습니다.
    2. 따뜻한 실내 온도에 식품을 새로 eclosed 성인 파리 (20 여성 및 10 남성)에 유리병. 25 ° c, 습도 60% 정상 명암 주기에서 파리 번 식.
      참고: 일반적으로, 그것은 충분 한 산란 파리에 대 한 3-4 일 걸립니다. 너무 많은 계란은 애벌레의 개발을 억제 하 고 항생물질 효율 감소.
    3. Eclosed 성인 파리 새로 수집 (3 시간 ~ 5 일)의 CO2, 그리고 반복 단계 빛 흐름 아래 ~ 1.2.1-1.2.2. 일반적으로 적어도 3 세대는 필요 Wolbachia의 완전히 제거 합니다.
    4. 항생물질 치료와 함께 3 세대 수집 후 5 Wolbachia 감염 테스트에 대 한 CO2 의 빛 흐름에서 난다. 이중 증 류 물 (ddH2O) 250 μ와 몇 0.5 m m 살 균 세라믹 비즈는 균질 화기를 사용 하 여 1.5 mL 튜브에 1 분 동안 파리를 갈기. 2 x의 또 다른 250 μ A 버퍼 추가 (0.2 M Tris HCl, pH 9.0, 0.2 M EDTA, 2 %SDS) 샘플을 소용돌이.
      참고: SDS 구슬 움직임을 방해 것입니다, 이후 1 버퍼 A x 사용할 수 없습니다 직접 파리를 갈기 위해. 파리는 붉은 눈을가지고, 만약이 DNA 제품의 색상에 영향을 미칠 수로 연 삭, 전에 머리 제거.
    5. -80 ° C (최대 1 년 유지)에서 샘플을 동결. 신속 하 게 녹여는 해산 될 때까지 25 ° C 물 욕조에-80 ° C에서 샘플. 30 분 동안 70 ° C에서 샘플을 품 어.
    6. 추가 5 190 μ M KOAc, 소용돌이 및 15 분 이상 얼음에 품 어.
    7. 샘플 실 온에서 5 분 13000 x g에서 원심는 상쾌한을 수집 하 고 새로운 튜브에 그들을 전송.
    8. 1.2.7 더 나은 품질로 DNA를 단계를 반복 합니다.
    9. 각 샘플에 소 프로 파 놀의 750 μ를 추가 하 고 부드럽게 손으로 몇 번 반전. 5 분 동안 실 온에서 품 어.
    10. 샘플 실 온에서 5 분 13000 x g에서 원심 및 삭제는 상쾌한. 흰색 genomic DNA 펠 릿은 튜브의 맨 아래에 있을 것입니다.
    11. 펠 릿, 5 분, 13000 x g에서 원심 분리기에 70% 에탄올의 1 mL을 추가 하 고 삭제는 상쾌한. 투명 하 게 될 때까지 DNA를 건조.
    12. DdH2O의 100 μ에서 DNA를 분해 하 고, 대 한 UV 흡수 분 광 광도 법에 의해 DNA 농도 적정 한 DNA 100 ng/μ를 희석.
    13. PCR 반응에 대 한 DNA의 사용 200 ng (20 μ 시스템 테이블의 자료를 참조). 다음 프로그램으로 PCR을 수행: 95 ° C 15 분; 45 95 ° C의 36 주기 s, 50 ° C 45 s, 그리고 1 분; 72 ° C에 대 한 그리고 열 cycler에서 최종 확장 단계 (1 분에 72 ° C).
      다음 뇌관을 사용 하 여 참고: Wolbachia 16S rRNA를 기반: 5' TGAGGAAGATAATGACGG 3' (앞으로)와 5' CCTCTATCCTCTTTCAACC 3' (반전). Wsp, 뇌관 했다 5' CATTGGTGTTGGTGTTGGTG 3' (앞으로)와 5' ACCGAAATAACGAGCTCCAG 3' (반전).
    14. 1 %agarose 젤 전기 이동 법으로 PCR 제품을 분석. PCR 제품의 Wolbachia 16S rRNA 및 wsp 크기가 약 200 bp 및 600 bp, 각각.
    15. 표준 cornmeal 비행 음식에 후면 Wolbachia 무료 플라이 주식. 3-5 날 새로 eclosed 남성 파리 감염에 대 한 수집.
      참고: 항생물질 치료 또한 항 바이러스 응답 호스트에 영향을 이후에 장 microbiota 구성에 발생할 수 있습니다. 모든 파리 같은 항생물질 치료 받아야 하는 것이 좋습니다. Wolbachia 무료 파리 본질적인 microbiota을 복원 하려면 적어도 3 세대에 대 한 표준 조건 하에서 성장 하십시오.
  3. Pastrel 유전형
    참고: 유전 배경에서 pst 유전자의 S 또는 R 대립 유전자의 존재는 초파리34,35DCV 감염에 영향을 미칠 알려졌다. 그것은 특히 DCV 감염에 대 한 태평양 표준시 유전자 형을 확인 해야 합니다. 바이러스 감염에 영향을 미칠 수 있습니다 태평양 표준시 에 있는 몇 가지 Snp, 주요 SNP는 512 C/t. 온도 기울기 PCR pst 유전자를 식별 하는 빠른 방법입니다.
    1. 추출 (단계 1.2.4-1.2.15) 위에서 설명한 대로 게놈 DNA를 비행.
    2. 512 C 뇌관, 5' CAGCATGGTGTCCATGAAGTC 템플릿으로 DNA의 사용 100 ng 3' (앞으로)와 5' ACGTGATCAATGCTGAAAGT 3' (반전) R 대립 유전자, 512T 뇌관, 5' CAGCATGGTGTCCATGAAGTT 감지 하 3' (앞으로)와 5' ACGTGATCAATGCTGAAAGT 3' (반전) 감지 하는 S 대립 유전자입니다.
    3. Tm (녹는 온도) 그라디언트를 다음과 같이 설정: 54 ° C, 54.7 ° C, 55.5 ° C, 58 ° C, 59.7 ° C, 62.2 ° C, 63.7 ° C, 및 64 ° C (45 각 온도에서 s).
      참고: PCR 연쇄 반응의 30 주기 (20 μ 시스템) 권장 됩니다.
    4. 2 %agarose 젤 전기 이동 법에 의해 100 bp PCR 제품을 시각화.

2. 초파리 에서 바이러스 감염

  1. 나노를 주입 하 여 파리를 감염 하 고 생존 분석 실험을 수행.
    1. 주사 바늘, 다시 채우기 주사 기름 바늘 및 앞에서 설명한50으로 인젝터 조립 준비를 모 세관을 당겨.
    2. CO2의 빛 흐름에서 패드에 파리 anaesthetize 흉부 내 주입44 50.6으로 파리를 접종 바이러스 솔루션 (100 PFU, Tris HCl 버퍼, pH 7.2 희석)의 nL. 파리 (병 당 20 파리)의 적어도 3 튜브를 주입.
      참고: 주사 시간이 걸리는 (시간 당 100 일반적으로 파리) 이며 DCV 복제는 매우 빠른, 그래서 한 번 각 유리병 (20 파리)를 마무리 하는 튜브에 정확한 시간을 적어 매우 중요 하다. 버퍼만 주입 모의 컨트롤로 설정 됩니다. 일반적으로, 남성 성인 파리는, 결과 더 안정적이 고 재현할 때 사용 하 여 보다 여성 호르몬 유사 짝짓기 하 고 복제 하는 동안 여성51의 판독 영향을 미칠 수 있기 때문.
    3. 25 ° C에서 삽입 된 파리, 정상적인 명암 주기에서 습도 60% 성장. 매일 신선한 음식으로 파리를 공급 하 고 죽은 flies의 수를 기록 합니다.
    4. 3 생물 복제를 수행 하 고 생존 곡선을 플롯.
    5. 생존 데이터의 통계 분석에 대 한 통계 소프트웨어에 의해 카 플 란-마이어 생존 곡선을 생성 합니다. P 값을 계산 하기 위해 로그-순위 테스트를 수행 합니다. 생존 테이블에서 각 주제에 대 한 정보를 입력 합니다. 소프트웨어는 다음 각 시간에 % 생존을 계산 하 고 카 플 란-마이어 생존 플롯 플롯.
      참고: 유리병에 추가 누 룩을 추가 하지 마십시오. 모의 컨트롤과 비교 DCV 감염 된 파리 때때로 ascites는 그리고는 서투른는 스티커 질 염에 취약 합니다. 거 대 한 일이 감염 된 파리에 대 한 시간 프레임을 찾을 수 예비 실험에 더 많은 시간을 포인트를 기록 하는 것이 낫다. 일반적으로, 감염 된 파리는 거의 Dcr-2 돌연변이 라인에도 첫 2 일 안에 죽는다. 이 시간대는 Wolbachia 무료 w1118 (블루밍턴 5905) 비행 감염 DCV의 100 PFU와, 약 3-5 일 게시 감염입니다. 과일 파리 0.5 h 포스트 주입 시간 이내 죽는 한다 계산 되지는 사망자로 바늘 부상에 의해 살해 될 수 있기 때문에 바이러스 성 감염에 의해 아닙니다.
  2. DCV는 CPE 시험에 의해 측정 로드
    참고: 바이러스 부하 (단계 1.1.6) 바이러스 주식의 적정에 유사 하 게 측정 하지만 추가 샘플 준비 (단계 2.2.1-2.2.4) 해야 합니다.
    1. 하루에 1, 단계 2.1.1-2.1.2에 설명 된 대로 남성 파리 감염. 그룹 20의에 삽입 된 파리를 그룹화 하 고 그들을 계속 원하는 시간 (일반적으로 24 시간 또는 3 일)에 대 한 신선한 비행 음식에 성장. 신선한 음식으로 파리를 매일 제공 합니다.
    2. 하루에 2, 씨앗 약 5의 밀도를 10 cm 세포 문화 접시에 초파리 S2 * 셀 x106 1 x 107 셀/mL 1.1.1 단계에서 설명한 대로.
    3. 3 일에 (CO2의 빛 흐름) 아래 5 파리를 수집 하 고 30 1.5 mL 원심 분리기 튜브에서 그들을 갈기 Tris 버퍼 및 균질 화기를 사용 하 여 세라믹 구슬 200 μ s. -80 ° C에서 샘플을 저장 하거나 즉시 다음 단계를 진행 합니다.
    4. 철저 하 게 소용돌이 샘플입니다. 1 mL 주사기와 0.22 μ m 필터를 필터 사용 새 1.5 mL 튜브에 상쾌한. 적정, 진행 단계 1.1.6.1-1.1.6.5에 설명 된 대로.
  3. DCV 부하 qRT-PCR에 의해 측정
    1. 위에서 설명한 대로 1 일에 파리를 감염. 그룹 삽입 된 남성 (20 파리/그룹) 파리, 원하는 시간에 대 한 일반적으로 24 시간 또는 3 일에 대 한 신선한 비행 음식에 성장 하 고. 신선한 음식으로 파리를 매일 제공 합니다.
    2. 3 일에의 세포의 용 해 버퍼 및 20 세라믹 구슬 200 μ와 1.5 mL 튜브에 CO2 의 빛 흐름 아래 5 파리 수집 (직경 0.5 m m =), 각 관에 추가적인 세포의 용 해 버퍼의 30 s. 추가 800 μ에 대 한 높은 속도와 균질 화기에 의해 샘플을 갈기 고 s 저장 더-80 ° C에 또는 즉시 RNA 추출 및 qRT-PCR을 수행합니다.
    3. RNase 무료 팁, 튜브를 준비 하 고 이온, diethylpyrocarbonate (DEPC) 치료와 0.22 μ m 막 필터링 물. 클로 프롬 (≥99.5%)의 200 μ를 추가 샘플으로 하 고 적극적으로 15 흔들 손으로 s. 품 어 5 분 이상 실 온에서 물 단계 및 유기 단계는 명확 하 게 구분 될 때까지.
      참고: 클로 프롬은 매우 유해 하 고 관리와 처리 해야 합니다. DNA 오염 위험을 증가 시킬 것 이다 샘플 소용돌이 하지 마십시오.
    4. 4 ° c.에서 15 분 13000 x g에서 원심 분리기 샘플
    5. 상쾌한의 400 μ를 수집 하 고 새로운 튜브는 상쾌한 전송. 에에 동일한 볼륨 소 프로 파 놀 (≥ 99.5%)와 혼합 하 고 부드럽게 반전 샘플 20 번, 다음 실 온에서 10 분 이상 침전.
      참고:-20 ° C에서 강수량 RNA 수율을 증가할 것 이다.
    6. 4 ° c.에서 10 분 13000 x g에서 원심 분리기 샘플 화이트 RNA 펠 릿 튜브의 하단에 볼 수 있습니다.
    7. 삭제는 상쾌한 고 70% 에탄올 (에탄올 DEPC 물에)의 1 mL을 추가 하 고 RNA를 씻고 몇 번을 반전.
    8. 4 ° c.에서 5 분 13000 x g에서 원심 분리기 샘플 5-10 분;에 대 한 표면에 뜨는 및 건조 RNA를 삭제 RNA는 투명 하 게 될 것입니다.
    9. 몇 번와 소용돌이 대 한 샘플, 피 펫 DEPC 물 50 μ를 추가 합니다.
    10. Titrating RNA 농도 대 한 RNA의 3 μ를 가져가 라. 260에 RNA를 정량 nm. 일반적으로,이 프로토콜에 의해 추출 된 RNA 농도 대략 100-500 μ g/μ, cDNA 합성에 적합.
    11. CDNA 합성에 RNA의 2 μ g를 사용 합니다. 100 μ ddH2O,-20 ° c.에가을 샘플을 희석
    12. 제조업체의 지침에 따라 qRT-PCR을 수행 하 고 qRT-PCR을 실행.
      참고: DCV의 cDNA 합성, 무작위 뇌관 일 폴 리 A 뇌관 보다는 훨씬 더 우리의 손에. DCV mRNA 식 생 ribosomal 단백질 49 (rp49) mRNA 정규화 됩니다. 이 부분에 사용 하는 oligonucleotide 뇌관: rp49 5' AGATCGTGAAGAAGCGCACCAAG 3' (앞으로)와 5' CACCAGGAACTTCTTGAATCCGG 3' (반전); DCV, 5' TCATCGGTATGCACATTGCT 3' (앞으로)와 5' CGCATAACCATGCTCTTCTG 3' (반전); vago, 5' TGCAACTCTGGGAGGATAGC 3' (앞으로)와 5' AATTGCCCTGCGTCAGTTT 3' (반전); 바이러스-유도 된 RNA 1 (비르-1) 5' 3' GATCCCAATTTTCCCATCAA (앞으로)와 5' GATTACAGCTGGGTGCACAA 3' (반전).

Representative Results

이 섹션의 결과 후에 D. melanogaster의 DCV 감염 얻을 수 있습니다. 그림 1 초파리에 있는 바이러스 성 감염의 플로우 차트를 보여 줍니다. 파리 intra-thoracically, 주입 하 고 샘플 바이러스 TCID50 와 게놈 RNA 수준 (그림 1)의 측정을 위해 수집 됩니다. 바이러스 감염 세포 세포의 용 해를 일으킬 수 있다 고 CPE 3 일 게시물 감염 (그림 2A)에서 관찰 된다. 바이러스 부하 CPE 시험에 의해 측정은 그에 맞춰 측정 정량 (그림 2B). 그림 3에서 보듯이 Wolbachia 초파리DCV 감염 억제. wol 16s rRNAwsp 뇌관 Wolbachia 존재 (그림 3A)와 Wolbachia감지 하는 데 사용 됩니다-무료 파리 DCV 감염 (그림 3B) 이후 크게 감소 생존 율을 보여. 그림 4 특정 뇌관을 사용 하 여 pst 다형성 그라데이션 PCR에 의해 확인 하는 방법을 보여 줍니다. 그림 5 에 wildtype 비행에서 DCV 감염의 의존 효과 복용량 보여 줍니다. 그림 5A 에서 생존 율 및 바이러스 3 일 게시물 감염은 그림 5B에서 볼 수에서 로드 합니다. 그림 6 에서는 DCV 감염 호스트52에 통로 신호 하는 Dcr2/RNAi 및 JAK/합계 항 바이러스를 활성화할 수 있습니다 보여 줍니다. Dcr2/RNAi 통로의 리포터 유전자 vago 식 식 수준 높은 3 일 게시물 감염 (그림 6A) 이다. JAK STAT 통로 또한 기자 유전자 비르-1 (그림 6B) 식 수준으로 표시 됩니다 DCV 감염 시 활성화 됩니다. 그림 7 Dcr2/RNAi 통로 초파리52항 바이러스 감염에 대 한 중요 한 것을 보여준다. Dcr-2 돌연변이 파리 DCV 감염 후 감소 생존 율 (그림 7A) 및 증가 바이러스 부하 (그림 7B) 있다.

Figure 1
그림 1: 초파리 감염 및 바이러스 부하 분석의 흐름 차트.
나노-주입 설정 초파리 감염. 스키마 차트에서는 파리 intra-thoracically 감염 그 바이러스 부하 CPE 시험 qRT-PCR에 의해 측정 됩니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 2
그림 2: DCV 부하 분석입니다.
바이러스 부하 CPE 시험에 의해 측정은 그에 맞춰 측정 정량. (A) 다른 바이러스 희석 (50 μ)와 함께 3 일 동안 25 ° C에서 교양 S2 * 셀. 사용 된 바이러스의 1 단위 TCID50 은 4.29 x 109 (3 x 109 PFU/mL에 해당). 첫 번째 패널, 10-3 희석; 두 번째 패널, 10-7 희석; 세 번째 패널, 10-10 희석; 앞 패널, 감염 없이. 패널 1과 2에에서 셀 표시 전형적인 CPE 긍정적인 표현 형 (흰색 화살표는 세포 파편을 나타냅니다), 그리고 셀 패널 3과 4에에서 일반적인 부정적인 표현 형을 표시. 눈금 막대는 그림에 표시 됩니다. (B) 측정 DCV 정량으로 로드 합니다. DCV의 직렬 10 희석을 수행 하 고 S2 * 셀 선 감염. 감염 된 세포의 총 RNA 추출 되 고 정량 DCV RNA 수준을 측정 하 수행 됩니다. 그라데이션 바이러스 전염 성 부하 (CPE 시험에 의해 결정) 셀에 일치 하 고 긍정적으로 정량 하 여 측정에 관련 된 (r2= 0.999). 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 3
그림 3: Wolbachia없이 파리의 바이러스 성 감염.
Wolbachia 감염 초파리에서 DCV 저항에 공헌 한다. (A) Wolbachia 존재 wol 16s rRNAwsp 뇌관에 의해 검출 된다. G1, G2 및 G3 대표 광 석r파리 (오 레 곤-R) (블루밍턴 5) 처리 항생물질에 의해 한, 2, 3 세대 각각. PCR 제품의 크기는 약 200 bp (wol 16s rRNA)와 600 bp (wsp). (B) Wolbachia 무료 파리 DCV 감염에 더 민감합니다. 3-5 일 오래 된 남성 성인 파리 DCV의 100 PFU로 주입 됩니다. 여유 Wolbachia Wolbachia 보호 DCV 감염 시 (대시 라인) 파리 보다 (실선) 크게 감소 표시 생존 파리. 두 개의 다른 wildtype 라인, 광 석r w1118, 생존 분석 결과 대 한 사용 되 고 비슷한 결과 보여줍니다. 모든 오차 막대를 나타내는 적어도 3 개의 독립적인 테스트;의 표준 오차 (남동) * P < 0.05, * * P < 0.01, * * * P < 0.001, * * * P < 0.0001, ns, 중요 하지. (B) 카 플 란-마이어 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 4
그림 4: Pastrel 유전형 그라데이션 PCR에 의해.
태평양 표준시 다형성 그라데이션 PCR에 의해 확인 됩니다. 그라데이션 PCR pst R (512 C)와 S (512T) 대립 유전자 초파리 성인에 구별을 수행 됩니다. Tm 그라디언트는 a 54 ° C:, b: 54.7 ° C, c: 55.5 ℃, d 58 ° C:, e: 59.7 ° C, f: 62.2 ° C, g: 63.7 ° C, h: 64 ° c.  이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 5
그림 5: 생존 율 및 DCV titer의 광 석r DCV의 다른 복용량에 감염.
광 석r파리 DCV, 10 PFU/비행, 50 PFU/비행 및 100 PFU/비행의 3 개의 다른 복용량으로 주입 됩니다. (A) 파리의 생존 율은 현저 하 게 더 높은 감염 복용량에 감염. 표시 된 파리의 (B)는 전체에서 DCV RNA 수준 몸 qRT-PCR에 의해 지정 된 시간에 측정 하 고 10 PFU/비행 접종 그룹의 정규화. 모든 오차 막대를 나타내는 적어도 3 개의 독립적인 테스트;의 표준 오차 (남동) * P < 0.05, * * P < 0.01, * * * P < 0.001, * * * P < 0.0001, ns, 중요 하지. 카 플 란-마이어 (A) 또는 단방향 anova (B). 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 6
그림 6: Dcr2/RNAi 고 JAK/합계 항 바이러스 신호 전달 경로 DCV 감염 후 활성화 합니다.
광 석r파리 DCV의 100 PFU 감염 되었습니다. Vago (A)와 몸 전체에 표현 하는 비르-1 (B) mRNA는 표시 된 시간 포인트 게시물 감염에서 qRT-PCR에 의해 측정 됩니다. 식의 변화는 감염 하기 전에 기저 레벨의 정규화 됩니다. 모든 오차 막대를 나타내는 적어도 3 개의 독립적인 테스트;의 표준 오차 (남동) * P < 0.05, * * P < 0.01, * * * P < 0.001, * * * P < 0.0001, ns, 중요 하지. 일방통행 ANOVA (A, B)입니다. 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Figure 7
그림 7: Dcr-2 돌연변이 비행 DCV 감염에 민감한.
Dcr-2 돌연변이 파리 그리고 그것의 유전 통제 w1118 파리 DCV의 100 PFU에 감염 되었습니다. (A) 생존 율 Dcr-2 결핍 파리와 야생-타입 (w1118) 파리의 게시물 DCV 감염. (B) DCV RNA 수준 표시 된 파리의 몸 전체에서 qRT-PCR 2 일 게시물 감염에 의해 측정 하 고 w1118의 정규화. 모든 오차 막대를 나타내는 적어도 3 개의 독립적인 테스트;의 표준 오차 (남동) * P < 0.05, * * P < 0.01, * * * P < 0.001, * * * P < 0.0001, ns, 중요 하지. 카 플 란-마이어 (A) 또는 스튜던트 T-검정 (B). 이 그림의 더 큰 버전을 보려면 여기를 클릭 하십시오.

Discussion

이 문서에서는, 선물이 상세한 절차 성인 초파리 melanogaster 에 바이러스 감염 시스템을 설정 하는 방법에 나노 분사를 사용 하 여. 프로토콜에 적절 한 플라이 라인 및 바이러스 주식, 감염, 전염 성 지표의 평가 기술과 항 바이러스 응답의 측정의 준비 포함 됩니다. DCV는 바이러스 성 병원 체의 예제로 사용 하 고, 바이러스의 다른 종류의 수만 성공적으로 적용 되었을 연구에 대 한 초파리 시스템에. 또한, 바이러스 또는 호스트의 규제 요인의 수백 파리에서 대규모 심사 통해 확인 되었습니다. 따라서,이 방법은 매우 적응력이 이며 DCV에 제한 하지 않습니다 /초파리 상호 작용.

성공적으로 전파 하 고 높은 titer DCV 수확, 몇 가지 해야 합니다 주의. 셀 이어야 한다 건강, 적당 한 밀도에 교양 시간에 수확. 셀 문화 볼륨 감소 해도 바이러스 titer 크게 영향을 하지 않습니다. 일반적으로, 107 셀 DCV 나에 의해 감염 = 0.01 것입니다 마지막으로 수확량 대략 108-109 TCID50 DCV 대부분 vivo에서 그리고 생체 외에서 실험의 요구를 만날 수 있는의. CPE 분석 결과 qRT-PCR 분석 결과 바이러스 부하의 측정을 위해이 프로토콜에서 설명 합니다. CPE 시험 어떻게든 까다롭습니다. 적절 한 세포 접종 밀도 긍정적/부정적 CPE 차별의 경험 있는 표준 신속 하 고 성공적인 CPE 분석 결과 허용 합니다. 따라서, 우리는 CPE 시험 CPE 분석 결과 마스터 하기 전에에서 컷오프 희석 포인트를 결정 하려면 여기 쉬운 qRT-PCR 분석 결과 제공 합니다.

그러나, DCV 성인 파리와 초파리 세포 라인에 대 한 매우 강력한 바이러스 이다. 100만 PFU/비행 접종 5 일 이내 야생의 50%를 죽 일 수 있습니다. 초과 감염 복용량 야생 타입 비행 및 잠재적인 취약 라인 사이의 의미를 숨길 수 있습니다. 그것은 새로운 화면을 시작할 때 두 개 이상의 감염 복용량을 적용 해야 합니다. 초파리 의 거 대 한 죽음 DCV의 높은 치 사 율 때문에 아주 짧은 시간 창에서 발생할 수 있습니다, 이후 예비 실험에서 죽음 수를 더 자주 기록이 좋습니다. DCV 감염 후 일부 파리는 때때로 ascites 증후군을 있다. 특히, 0.5 h 게시물 감염 내 죽을 파리 해야 제외는 부적절 한 바늘 주입 부상으로 발생할 수 있습니다.

DCV의 전염 성 강도 또한 실험을 시작 하기 전에 고려해 야 하는 많은 호스트 요인에 의해 좌우 된다. Wolbachia 수직 전송 endosymbiont는 파리32바이러스 감염에 큰 영향입니다. 비행 음식에 항생물질 치료 Wolbachia 감염을 제거 하는 일반적인 사용된 방법입니다. 그러나,이 메서드는 또한 항 바이러스 응답53에 차례로 영향을 미칠 수 장 microbiota 구성을 변경 합니다. 몇 가지 연구 바이러스 감염36, ubc-e2h, cg8492태평양 표준시에 유전 차이의 중요성을 강조 했다. 예를 들어 대부분 야생 타입 비행 라인 pst S 대립 유전자 있으며 picorna 같은 바이러스에 민감한 반면 대부분의 돌연변이 라인 블루밍턴 재고 센터에서 테스트 pst R 대립 유전자, 따라서 저항 phenotypes 데. 그것은 매우 야생 유형 제어29와 비교 저항 유전자에 밖으로 검사 하는 경우에 특히 태평양 표준시의 영향을 배제 하는 것이 중요.

나노-조직의 바이러스 감염 유도 주입, 외 다른 방법 공부 파리에 바이러스 감염을 사용할 수 있습니다. 초파리 세포 라인 화면 바이러스 감염으로는 높은 처리량 방법 관련 호스트 세포 구성 요소37,38입증 했다. 그러나, 생체 외에서 시스템 잘못 된 반응의 높은 속도와 함께 항상 에 비보를 확인 하는 경우 합니다. 그것만 제한 하 고 온화한 감염을 일으킬 수 있다 반면 DCV 또한 초파리를 구두로, 감염에 적용할 수 있습니다. 애벌레의 20%는 12 h 이내 감염 했다 14% 사망률 관찰만 단지 25%와 성인에서 20 일에 사망22파리. 0.15 m m 직경 핀 파리를 찌르는 바이러스 성 감염을 설정 하는 또 다른 방법은 이지만 정확한 감염 복용량 및 양적 반복성 보장할 수 없습니다. 파리에서 유전자 조작에 의해 바이러스 성 단백질 overexpressing 분자 interactomes vivo에서7을 공부 하는 좋은 방법 이다. 그러나, 그것은 감염 시 호스트에서 생리학과 병리학의 현실을 묘사 하지 않을 수 있습니다. 한편, 나노-주입 방법 또한 단점이 있다, 그것은 자연 감염 경로 직접 표 피, 첫 번째 항 바이러스 방위 선 우회 감염 직후 강한 시스템 면역 반응을 자극. 합계에서는, 특정 연구 목적 및 사용 가능한 실험 조건 다른 방법 중에서 선택에 있는 결정 요소가 됩니다.

Disclosures

저자는 공개 없다.

Acknowledgments

우리는 전체 팬 연구소 IPS에 감사 하 고 싶습니다. CA입니다. 우리는 의견에 대 한 실험적인 지원 및 박사 Gonalo 코르도바 Steger (Springer 자연), 박사 제시카 바 가스 (IPS, 파리), 박사 생 주 (IPS, 파리) 박사 Lanfeng 왕 (IPS, CA)을 감사합니다. 이 작품은 L.P (XDA13010500) 및 H.T (XDB29030300), L.P (31870887 및 31570897) 및 J.Y (31670909)을 중국의 국가 자연과학 기초 과학의 중국 아카데미의 전략적 우선 순위 연구 프로그램에서 교부 금에 의해 지원 되었다. L.P은 CAS 청소년 혁신 진흥 협회 (2012083)의 연구원 이다.

Materials

Name Company Catalog Number Comments
0.22um filter Millipore SLGP033RS
1.5 ml Microcentrifuge tubes Brand 352070
1.5 ml RNase free Microcentrifuge tubes Axygen MCT-150-C
10 cm cell culture dish Sigma CLS430167 Cell culture
100 Replacement tubes Drummond Scientific 3-000-203-G/X
15 ml tube Corning 352096
ABI 7500 qPCR system ABI 7500 qPCR
Cell Incubator Sanyo MIR-553
Centriguge Eppendof 5810R
Centriguge Eppendof 5424R
Chloroform Sigma 151858 RNA extraction
DEPC water Sigma 95284-100ML RNA extraction
Drosophila Incubator Percival I-41NL Rearing Drosophila
FBS Invitrogen 12657-029 Cell culture
flat bottom 96-well-plate Sigma CLS3922 Cell culture
Fluorescence microscope Olympus DP73
Isopropyl alcohol Sigma I9516 RNA extraction
Lysis buffer (RNA extraction) Thermo Fisher 15596026 TRIzol Reagent
Lysis buffer (liquid sample RNA extraction) Thermo Fisher 10296028 TRIzol LS Reagent
Microscope Olympus CKX41
Nanoject II Auto-Nanoliter Injector Drummond Scientific 3-000-204 Nanoject II Variable Volume (2.3 to 69 nL) Automatic Injector with Glass Capillaries (110V)
Optical Adhesive Film ABI 4360954 qPCR
Penicillin-Streptomycin, Liquid Invitrogen 15140-122 Cell culture
qPCR plate ABI A32811 qPCR
Schneider’s Insect Medium Sigma S9895 Cell culture
statistical software GraphPad Prism 7
TransScript Fly First-Strand cDNA Synthesis SuperMix TransScript AT301 RNA extraction
Vortex IKA VORTEX 3 RNA extraction

DOWNLOAD MATERIALS LIST

References

  1. Rahim, M. A., Uddin, K. N. Chikungunya: an emerging viral infection with varied clinical presentations in Bangladesh: Reports of seven cases. BMC Research Notes. 10, 410 (2017).
  2. Douam, F., Ploss, A. Yellow Fever Virus: Knowledge Gaps Impeding the Fight Against an Old Foe. Trends in Microbiology. (2018).
  3. Santiago, G. A., et al. Performance of the Trioplex real-time RT-PCR assay for detection of Zika, dengue, and chikungunya viruses. Nature Communications. 9. 9, 1391 (2018).
  4. Gould, E., Pettersson, J., Higgs, S., Charrel, R., de Lamballerie, X. Emerging arboviruses: Why today? One Health. 4, 1-13 (2017).
  5. Hughes, T. T., et al. Drosophila as a genetic model for studying pathogenic human viruses. Virology. 423, 1-5 (2012).
  6. Xu, J., Cherry, S. Viruses and antiviral immunity in Drosophila. Developmental & Comparative Immunology. 42, 67-84 (2014).
  7. Shirinian, M., et al. A Transgenic Drosophila melanogaster Model To Study Human T-Lymphotropic Virus Oncoprotein Tax-1-Driven Transformation In Vivo. Journal of Virology. 89, 8092-8095 (2015).
  8. Adamson, A. L., Chohan, K., Swenson, J., LaJeunesse, D. A Drosophila model for genetic analysis of influenza viral/host interactions. Genetics. 189, 495-506 (2011).
  9. Hao, L., et al. Drosophila RNAi screen identifies host genes important for influenza virus replication. Nature. 454, 890-893 (2008).
  10. Webster, C. L., et al. The Discovery, Distribution, and Evolution of Viruses Associated with Drosophila melanogaster. Plos Biology. 13, e1002210 (2015).
  11. Heigwer, F., Port, F., Boutros, M. RNA Interference (RNAi) Screening in Drosophila. Genetics. 208, 853-874 (2018).
  12. West, C., Silverman, N. p38b and JAK-STAT signaling protect against Invertebrate iridescent virus 6 infection in Drosophila. PLOS Pathogens. 14, e1007020 (2018).
  13. Liu, Y., et al. STING-Dependent Autophagy Restricts Zika Virus Infection in the Drosophila Brain. Cell Host & Microbe. 24, 57-68 (2018).
  14. Wang, X. H., et al. RNA interference directs innate immunity against viruses in adult Drosophila. Science. 312, 452-454 (2006).
  15. van Rij, R. P., et al. The RNA silencing endonuclease Argonaute 2 mediates specific antiviral immunity in Drosophila melanogaster. Genes & Development. 20, 2985-2995 (2006).
  16. Deddouche, S., et al. The DExD/H-box helicase Dicer-2 mediates the induction of antiviral activity in drosophila. Nature Immunology. 9, 1425-1432 (2008).
  17. Chotkowski, H. L., et al. West Nile virus infection of Drosophila melanogaster induces a protective RNAi response. Virology. 377, 197-206 (2008).
  18. Paradkar, P. N., Trinidad, L., Voysey, R., Duchemin, J. B., Walker, P. J. Secreted Vago restricts West Nile virus infection in Culex mosquito cells by activating the Jak-STAT pathway. Proceedings of the National Academy of Sciences of the United States of America. 109, 18915-18920 (2012).
  19. Souza-Neto, J. A., Sim, S., Dimopoulos, G. An evolutionary conserved function of the JAK-STAT pathway in anti-dengue defense. Proceedings of the National Academy of Sciences of the United States of America. 106, 17841-17846 (2009).
  20. Zambon, R. A., Nandakumar, M., Vakharia, V. N., Wu, L. P. The Toll pathway is important for an antiviral response in Drosophila. Proceedings of the National Academy of Sciences of the United States of America. 102, 7257-7262 (2005).
  21. Costa, A., Jan, E., Sarnow, P., Schneider, D. The Imd pathway is involved in antiviral immune responses in Drosophila. PLoS One. 4, e7436 (2009).
  22. Ferreira, A. G., et al. The Toll-dorsal pathway is required for resistance to viral oral infection in Drosophila. PLOS Pathogens. 10, e1004507 (2014).
  23. Moy, R. H., et al. Antiviral autophagy restrictsRift Valley fever virus infection and is conserved from flies to mammals. Immunity. 40, 51-65 (2014).
  24. Shelly, S., Lukinova, N., Bambina, S., Berman, A., Cherry, S. Autophagy is an essential component of Drosophila immunity against vesicular stomatitis virus. Immunity. 30, 588-598 (2009).
  25. Bronkhorst, A. W., et al. The DNA virus Invertebrate iridescent virus 6 is a target of the Drosophila RNAi machinery. Proceedings of the National Academy of Sciences of the United States of America. 109, E3604-E3613 (2012).
  26. Palmer, W. H., Medd, N. C., Beard, P. M., Obbard, D. J. Isolation of a natural DNA virus of Drosophila melanogaster, and characterisation of host resistance and immune responses. PLOS Pathogens. 14, e1007050 (2018).
  27. Jousset, F. X., Bergoin, M., Revet, B. Characterization of the Drosophila C virus. Journal of General Virology. 34, 269-283 (1977).
  28. Gupta, V., Stewart, C. O., Rund, S. S. C., Monteith, K., Vale, P. F. Costs and benefits of sublethal Drosophila C virus infection. J Evol Biol. 30, 1325-1335 (2017).
  29. Yang, S., et al. Bub1 Facilitates Virus Entry through Endocytosis in a Model of Drosophila Pathogenesis. Journal of Virology. (2018).
  30. Teixeira, L., Ferreira, A., Ashburner, M. The bacterial symbiont Wolbachia induces resistance to RNA viral infections in Drosophila melanogaster. Plos Biology. 6, e2 (2008).
  31. Ferguson, N. M., et al. Modeling the impact on virus transmission of Wolbachia-mediated blocking of dengue virus infection of Aedes aegypti. Science Translational Medicine. 7, 279ra237 (2015).
  32. Hedges, L. M., Brownlie, J. C., O'Neill, S. L., Johnson, K. N. Wolbachia and virus protection in insects. Science. 322, 702 (2008).
  33. Bhattacharya, T., Newton, I. L. G., Hardy, R. W. Wolbachia elevates host methyltransferase expression to block an RNA virus early during infection. PLOS Pathogens. 13, e1006427 (2017).
  34. Magwire, M. M., et al. Genome-wide association studies reveal a simple genetic basis of resistance to naturally coevolving viruses in Drosophila melanogaster. PLOS Genetics. 8, e1003057 (2012).
  35. Cao, C., Cogni, R., Barbier, V., Jiggins, F. M. Complex Coding and Regulatory Polymorphisms in a Restriction Factor Determine the Susceptibility of Drosophila to Viral Infection. Genetics. 2159-2173 (2017).
  36. Martins, N. E., et al. Host adaptation to viruses relies on few genes with different cross-resistance properties. Proceedings of the National Academy of Sciences of the United States of America. 111, 5938-5943 (2014).
  37. Moser, T. S., Sabin, L. R., Cherry, S. RNAi screening for host factors involved in Vaccinia virus infection using Drosophila cells. Journal of Visualized Experiments. (2010).
  38. Zhu, F., Ding, H., Zhu, B. Transcriptional profiling of Drosophila S2 cells in early response to Drosophila C virus. Journal of Virology. 10, 210 (2013).
  39. Ekstrom, J. O., Hultmark, D. A Novel Strategy for Live Detection of Viral Infection in Drosophila melanogaster. Scientific Reports. 6, 26250 (2016).
  40. Durdevic, Z., et al. Efficient RNA virus control in Drosophila requires the RNA methyltransferase Dnmt2. EMBO Reports. 14, 269-275 (2013).
  41. Chrostek, E., et al. Wolbachia variants induce differential protection to viruses in Drosophila melanogaster: a phenotypic and phylogenomic analysis. PLOS Genetics. 9, e1003896 (2013).
  42. Gupta, V., Vale, P. F. Nonlinear disease tolerance curves reveal distinct components of host responses to viral infection. Royal Society Open Science. 4, 170342 (2017).
  43. Chtarbanova, S., et al. Drosophila C virus systemic infection leads to intestinal obstruction. Journal of Virology. 88, 14057-14069 (2014).
  44. Merkling, S. H., van Rij, R. P. Analysis of resistance and tolerance to virus infection in Drosophila. Nature Protocols. 10, 1084-1097 (2015).
  45. Goic, B., et al. RNA-mediated interference and reverse transcription control the persistence of RNA viruses in the insect model Drosophila. Nature Immunology. 14, 396-403 (2013).
  46. Ashburner, M., Golic, K., Hawley, R. S. Drosophila: A Laboratory Handbook. Cold Spring Harbor Laboratory Press. (2011).
  47. Biochemical and Biophysical Research Communications: 1991 index issue. Cumulative indexes for volumes 174-181. Biochemical and Biophysical Research Communications. 1-179 (1991).
  48. Cotarelo, M., et al. Cytopathic effect inhibition assay for determining the in-vitro susceptibility of herpes simplex virus to antiviral agents. Journal of Antimicrobial Chemotherapy. 44, 705-708 (1999).
  49. Reed, L. J. M., H, A simple method of estimating fifty percent endpoints. The American Journal of Hygiene. 27, 493-497 (1938).
  50. Khalil, S., Jacobson, E., Chambers, M. C., Lazzaro, B. P. Systemic bacterial infection and immune defense phenotypes in Drosophila melanogaster. Journal of Visualized Experiments. e52613 (2015).
  51. Schwenke, R. A., Lazzaro, B. P. Juvenile Hormone Suppresses Resistance to Infection in Mated Female Drosophila melanogaster. Current Biology. 27, 596-601 (2017).
  52. Sabin, L. R., Hanna, S. L., Cherry, S. Innate antiviral immunity in Drosophila. Current opinion in immunology. 22, 4-9 (2010).
  53. Yin, J., Zhang, X. X., Wu, B., Xian, Q. Metagenomic insights into tetracycline effects on microbial community and antibiotic resistance of mouse gut. Ecotoxicology. 24, 2125-2132 (2015).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics