וקטור lentiviral פלטפורמה למסירה יעיל של כלי עריכת Epigenome לתוך האדם המושרה מודלים המחלה נגזר תאי גזע Pluripotent

Genetics

Your institution must subscribe to JoVE's Genetics section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

לפלח epigenome DNA עריכה מייצג גישה טיפולית רב-עוצמה. פרוטוקול זה מתאר את הייצור, טיהור, הריכוז של ה-all-in-one וקטורים lentiviral מסתירים את transgene CRISPR-dCas9-DNMT3A עבור יישומים לעריכת epigenome בתא גזע pluripotent המושרה אנושי (hiPSC)-נגזר נוירונים.

Cite this Article

Copy Citation | Download Citations

Tagliafierro, L., Ilich, E., Moncalvo, M., Gu, J., Sriskanda, A., Grenier, C., Murphy, S. K., Chiba-Falek, O., Kantor, B. Lentiviral Vector Platform for the Efficient Delivery of Epigenome-editing Tools into Human Induced Pluripotent Stem Cell-derived Disease Models. J. Vis. Exp. (145), e59241, doi:10.3791/59241 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

השימוש של תאים hiPSC, נגזר מייצג בגישה יקר ללמוד מחלות ניווניות אנושי. כאן, אנו מתארים את פרוטוקול ממוטב עבור הבידול של hiPSCs נגזר מטופל עם triplication של אלפא-synuclein ג'ין (SNCA) מיקומה לתוך מחלת פרקינסון (PD)-אוכלוסיות עצביים וכולינרגיים הרלוונטיים. לצבירת ראיות הראה כי רמות גבוהות של SNCA הם סיבתי לפיתוח של הכרה PD. קליניות צריכים לייסד רומן גישות טיפוליות עבור PD, במיוחד אלה מיקוד ברגולציה של ביטוי SNCA , אנחנו לאחרונה פיתחה מערכת CRISPR/dCas9-מתילציה-מבוסס DNA epigenetically לווסת שעתוק SNCA על ידי העשרת רמות מתילציה האזור רגולטוריות אינטרון 1 SNCA . כדי לספק את המערכת, המורכב מת (שהפעלתם בוטלה) הגירסה של Cas9 (dCas9) התמזגו עם המחשבים קטליטי של 3A אנזים methyltransferase ה-DNA (DNMT3A), וקטור lentiviral משמש. מערכת זו חלה על תאים המכילים triplication של לוקוס SNCA ומקטין את SNCA-mRNA ואת רמות החלבון בכ 30% באמצעות מתילציה DNA יישוב של אינטרון SNCA 1. Downregulation מכויל של רמות SNCA מציל הקשורים למחלות פנוטיפים הסלולר. בפרוטוקול הנוכחי, אנו שואפים לתאר את הליך שלב אחר שלב עבור המבדילים hiPSCs לתוך ובתאים עצבית (NPCs) ואת הממסד אימות של מבחני pyrosequencing על ההערכה של הפרופיל מתילציה SNCA אינטרון 1. חלוקה לרמות ביתר פירוט את המערכת lentivirus-CRISPR/dCas9 שימוש בניסויים אלה, פרוטוקול זה מתאר כיצד לייצר ולטהר, להתרכז וקטורים lentiviral כדי לסמן להתאמתם עבור epigenome ואת הגנום-יישומים לעריכת באמצעות hiPSCs ו- NPCs. הפרוטוקול ניתנת להתאמה בקלות והוא יכול לשמש כדי לייצר כייל נוגדנים גבוה lentiviruses ליישומים במבחנה ויוו.

Introduction

פלטפורמות מרובות לעריכת epigenome פותחו לאחרונה להתמקד על כל רצפי DNA אזורים ששולטים ג'ין ביטוי1,2. הכלים לעריכת epigenome שנוצר מתוכננים (i) להסדיר שעתוק, (ii) לשנות שינוי היסטון posttranslational, (iii) לשנות מתילציה DNA, (iv) לווסת את רכיב אינטראקציות. הגישה כדי לעגן את מכפילי תמלול/כרומטין Cas9 (מת) שהפעלתם בוטלה (dCas9) מופעל מבעבר מפותח לעריכת epigenome פלטפורמות, כגון אבץ אצבע חלבונים (ZFPs) ו effectors כמו מפעיל שעתוק (אגדות), מחסה תחום אפקטור תעתיק חזק (אד) התמזגו לתחום ה-DNA מחייב מעוצב (DBD)3. התוצאות של פנוטיפ הרצויה כגון הפעלה או דיכוי מוגדרת על-ידי המולקולה אפקטור מעוגנת את לוקוסים אנדוגני (איור 1). כדי ליצור activators תעתיק לתכנות, dCas9/gRNA מודולים מקושרים VP164,5,6 (איור 1 א'), תחום הפעלה ויראלי מגייס Pol II והמנגנון שעתוק כללי. השינוי של מערכת זו כללה VP64, tetramer של תחומים VP16, מתן אפילו יותר חזקה הפעלת קצב5,6. המערכת כבר מועסקים בהצלחה להפעיל קידוד ואזורים noncoding על ידי מיקוד היזמים ואלמנטים רגולטוריות. חשוב, אף-על-פי מולקולות VP64 ישירות אל תשנה את הכרומטין באזור היעד, היא מגייסת מכפילי כרומטין אשר מאגד תוצאות בעדות של הסימנים פעיל (euchromatin), כולל acetylation H3/H4, H3-K4 di / tri-מתילציה5,6. בנוסף VP64, יחידת משנה p65 של המתחם NF-κB האנושי יש כבר קשור את מודול dCas9/gRNA7. מעניין, קשירה של אלה effectors לאזורים במעלה הזרם של שעתוק התחלה אתרים (אזעקת דייט) ובתוך היזמים תוצאות אינדוקציה גנים חזקים. למרות זאת, effectors VP64 ו p65 שיכולים להפעיל גם את ההשפעות activatory תוך כדי להיות מקושר לאזורים ממוקם במורד הזרם של אזעקת דייט, משפרי דיסטלי7,8. כדי מביאות לתגובה תעתיק עמיד יותר, מספר dCas9-VP64 או dCas9-p65 fusions צריך להתגייס על יעד בודד לוקוס9,10. ככזה, ההתפתחות האחרונה של מפעילים הדור הבא, אשר לגייס תחומים אפקטור מרובים על-ידי מורכבת dCas9 יחיד-gRNA, כגון SunTag, הביא חזק הפעלה יכולת השוואה בין dCas9-VP64 פיוז'ן עמיתיהם11 , 12. תעתיק הפעלה משופרת התקבל באמצעות היתוך גרעיני של VP64, p65 Rta (VPR), transactivation לתחום של גמא-herpesviruses, קצה קרבוקסילי של dCas913 (איור 1 א'). מערכות CRISPR/dCas9 דומות התפתחו במטרה הדיכוי (איור 1B).

ג'ין אנדוגני דיכוי יכולה להיות מושגת עם fusions מדכא. שבולם שעברו הנדסה לאחור באמצעות מגוון רחב של מנגנונים (איור 1B). הוכח כי מערכות CRISPR/dCas9, לקשר את מדכא. שבולם DBD (אפילו בלי אפקטור תחום/s), ביעילות תסתמי כבר ביטוי גנים בעוד קשור יזם או נגד הזרם/במורד הזרם-TSS אזורים3,6 ,14. ההשפעות על שעתוק נגרמת על ידי הפרעה הסטריים של איגוד פקטור שעתוק ועיבוד RNA פולימראז. עם זאת, גישות מקיף יותר נדרשים, כמו ג'ין דיכוי מאת לבד הסטריים מכשלה הוא לעתים קרובות לא מספיק בשביל להשתיק חזקים. ההתפתחות האחרונה של הדור הבא של משתיקי קול בהתבסס על מערכות CRISPR/dCas9 נושא מדכא. שבולם תעתיק תחומים (TRDs), מכפילי היסטון (H3-K9 di-/ tri-מתילציה, H3-K27 di-/ tri-מתילציה; H3-K36 di-/ tri-מתילציה, H3/H4 deacetylation), ואת מתילציה DNA (CpG) הוביל את בניית כלים epigenetic ומאפשר עמידים יותר להשתיק אפקטים4,5,15,16, 17,18,19,20. זה הוכח, כי הגיוס של אלה epigenetic מכפילי ה-DNA עשוי להוביל להיווצרות עוד כרומטין סגור, והם מרוכז, אשר בדרך כלל להפיק יותר חזק שתיקה התוצאה21,22. התחום שתיקה הנפוץ ביותר בשימוש עם DBDs הוא4,Krüppel-הקשורים תיבת (קראב)5. הגיוס של הגורם הוכח כדי להתכתב עם כרומטין השינויים; ובכל זאת, המנגנון של שינויים אלה הם עדיין להיות מבואר16,17,18. לאחרונה, הוכח כי הלוקליזציה של קראב ל- DNA יכול לקדם את מכלול של methyltransferase היסטון את SETDB1, את מתחמי NuRD deacetylation (HDAC) היסטון, מציעה את האפשרות כי אינטראקציות אלה לתווך את היווצרות עיבוי כרומטין, תעתיק שתיקה3,13. כגישה חלופית, אפקטור תחומים יכול להיות דבוקה DBDs ליצירת חלבון שתיקה epigenetic מותאם אישית. מערכת זו מזרז ישירות דכאניים סימוני הדנ א או שינויים היסטון.

לאחרונה, השימוש במערכות CRISPR/dCas9 סינתטי קשור האנזים DNMT3A יש כבר לשנות את ייעודו עבור הביטול תעתיק. DNMT3A מזרז מתילציה DNA זה מפעילה דיכוי גנים ברמת השעתוק במהלך היווצרות של הטרוכרומטין על היזמים ג'ין אנדוגני, אחרים אזורים רגולטוריות (איור 1B)18,20. מקדונלד ואח18 ו- Vojta et al.20 היו המחברים הראשונים לדווח על כך שניתן להשתמש מתילציה DNA epigenome-ג'ין להחרשת או דיכוי, הממחיש המערכת פיוז'ן המועבר פלסמיד dCas9-DNMT3A יכול לשפר מנע בעוצמה ציטוזין מתילציה סביב ה TSS18,20. מקדונלד ועמיתים הפגינו התעסוקה של האסטרטגיה עלולה לגרום לירידה משמעותית (כ-40%) בגן מדכאי, רמות ה-mRNA CDKN2A 18. באופן דומה, פילוח האזור מקדם unmethylated של גנים באך או IL6ST מראה מתילציה CpG מוגבר זה היה בקורלציה עם הפחתה כפולה של ביטוי גנים20. המעבדה שלנו יש לאחרונה לשנות את ייעודו השימוש מתילציה DNA attenuating התוצאה פתולוגית של SNCA ביטוי (איור 2)23. האסטרטגיה מבוססת על שיפור סלקטיבי מתילציה DNA בתוך אזור אינטרון 1 SNCA , כפי שדווח בעבר להיות hypomethylated PD, דמנציה עם לוי גופים (DLB) המוח24,25, 26. Hypomethylation זה נקשר ביטוי SNCA , ובכך מציעים ליעד אטרקטיבי עבור התערבות טיפולית24,27,28. אנחנו לאחרונה הראו רמה נמוכה של מתילציה DNA אינטרון SNCA 1, אזור hiPSC, נגזר וכולינרגיים NPCs המתקבל מטופל PD עם triplication SNCA 23. היתרון של מודל ניסיוני זה היא כי NPCs ניתן robustly מופצות בתרבות או נוסף הבדיל לתוך נוירונים בוגרים, הפעלת של סינון יעיל לזהות גורמים גנטיים המתווכות פנוטיפים הסלולר, כולל חמצוני מתח, אפופטוזיס29. יתר על כן, מערכת מודל זה מאפשר למדענים לסכם את האירועים התפתחותית זו לפני תחילת סימפטום בחולים. בנוסף, נגזר hiPSC NPCs מייצגים כלי נהדר כדי לבדוק את המסלולים תאית ומולקולרית המשויך ביטוי גנים. חשוב, NPCs נגזר hiPSC, בשילוב עם טכנולוגיית CRISPR/Cas9-epigenome המדינה-of-the-art יכול מאוד להקל על הפיתוח של "הדור הבא סמים" למחלות ניווניות רבות.

כדי להפחית את רמות פתולוגי של ביטוי SNCA, שפיתחנו לאחרונה מערכת מבוססת lentivirus נושא של חלבון כימרי dCas9-DNMT3A ו- gRNA כדי במיוחד היעד מתילציה CpG בתוך אינטרון SNCA 1 (איור 2 א)23. פרוטוקול זה יתאר וקטור lentiviral (LV) עיצוב וייצור בפירוט. הזינו אותו מייצגים אמצעי יעיל להעברת רכיבים CRISPR/dCas9 מכמה סיבות, כלומר מוסיף (i) את יכולת לשאת DNA מגושם, (ii) יעילות גבוהה של מגוון רחב של תאים, כולל תאים החלוקה והן nondividing30 transducing , וכן (iii) את היכולת שלהם זירוז תגובות ציטוטוקסיות ו immunogenic מינימלי. לאחרונה, אנחנו שהוחל מערכת LV נוירונים דופאמין hiPSC, נגזר מן המטופל עם triplication של מיקומה SNCA והפגינו את הפוטנציאל הטיפולי של אותו למסירה של עריכת epigenome מתילציה כלים23 ( איור 2B). ואכן, מערכת LV-gRNA/dCas9-DNMT3A גורמת עלייה משמעותית מתילציה DNA-האזור אינטרון 1 SNCA . גידול זה מתכתב עם הירידה ברמות של mRNA, חלבון SNCA 23. יתר על כן, SNCA downregulation מציל הקשורות PD פנוטיפים ב- SNCA triplication/hiPSC-derived וכולינרגיים נוירונים (למשל, מיטוכונדריאלי ROS ייצור ותא הכדאיות)23. חשוב לציין, הפגנו כי ההפחתה בביטוי SNCA על ידי מערכת LV-gRNA-dCas9-DMNT3A הוא מסוגל היפוך על הפנוטיפים האופייניים של נוירונים דופאמין hiPSC, נגזר מן המטופל PD שביצע את SNCA triplication, כגון מיטוכונדריאלי ROS ייצור ותא הכדאיות23. המטרה של פרוטוקול זה הוא 1) כדי לחלק לרמות הפרוטוקול של הפקה וריכוז של פלטפורמת LV ממוטב ליצירה צייץ בשיא ההכנות נגיפי ו 2) כדי לתאר את הבידול של hiPSCs לתוך NPCs בדוגמת להפוך וכולינרגיים בוגרת נוירונים31,32 , אפיון רמות מתילציה של האזור יישוב בתוך אינטרון SNCA 1.

פלטפורמות lentiviral יש יתרון גדול על פלטפורמת וקטור הפופולרי ביותר, כלומר adeno-הקשורים וקטורים (AAVs), אשר הוא היכולת של לשעבר להכיל מוסיף גנטי גדול33,34. AAVs ניתן ליצור תשואות גבוהות באופן משמעותי, אבל בעלי קיבולת אריזה נמוך (< 4.8 kb), להתפשר על השימוש בהם לצורך אספקת מערכות CRISPR/Cas9 ה-all-in-one. לפיכך, נראה כי אותו יהיה הפלטפורמה-של-הבחירה ביישומי מעורב אספקה של כלים CRISPR/dCas9. לכן, פרוטוקול שמפורטות כאן יהיה כלי רב ערך עבור חוקרים שרוצים להעביר ביעילות רכיבים לעריכת epigenome תאים ואיברים. פי הפרוטוקול, מתאר את האסטרטגיה כדי להגדיל את יכולות הייצור וביטוי של הווקטורים באמצעות שינוי ב- cis הרכיבים בתוך30,35קלטת ביטוי וקטור. האסטרטגיה מבוססת על הרומן מערכת שפותחה למד במעבדה שלנו ואני מדגיש את היכולת שלה לייצר חלקיקים נגיפיים בטווח של 1010 יחידות ויראלי (וו) /mL30,35.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

1. מערכת העיצוב והייצור וירוס

  1. פלסמיד עיצוב ובנייה
    הערה: הבנייה של וקטור LV-gRNA-dCas9-DNMT3A ה-all-in-one מתבצע באמצעות הפקה- ואת קלטת ביטוי ממוטב ביטוי שפורסמו על-ידי Ortinski et al.30. בקלטת וקטור נושא שידור חוזר של האתר זיהוי של גורם שעתוק Sp1 ומחיקה של המדינה-of-the-art בתוך לא מתורגם (U3') אזור של טרמינל 3' באורך חוזר (משמאל לימין) (איור 2 א)30,36. עמוד השדרה וקטור נמצאו יעילים אספקת ולבטא30,CRISPR/Cas935.
    1. להשיג את הגירסה deactivate (המלח) של SpCas9 (dCas9) באמצעות מערכות מוטגנזה דגן (נתונים לא מוצג). החלף את השיבוט מחסה מוטציות D10A ו- H840A בתחומים קטליטי HNH ו- RuvC של האנזים, בהתאמה, עם Cas9 פעיל pBK30129 על ידי החלפת בין שברי AgeI-BamHI (איור 3).
    2. שואבים את התחום קטליטי DNMT3A pdCas9-DNMT3A-eGFP (ראה טבלה של חומרים) על ידי הגברה של DNMT3A חלק BamHI-429/R 5 '- GAGCGGATCCCCCTCCCG - 3' BamHI-429/L 5' - CTCTCCACTGCCGGATCCGG - 3' (איור 3). כדי להגביר את האזור המכיל DNMT3A, השתמש התנאים הבאים: (1) 95 ° C 60 s, (2) 95 ° C עבור 10 s, (3) 60 ° C עבור 20 s, (4) 68 ° C עבור 60 ס' חזור על תנאי 2 עד 4 30 x. עבור הסיומת הסופי, להשתמש 68 מעלות צלזיוס למשך 3 דקות והחזק 4 ° C.
    3. לשכפל השבר DNMT3A, מתעכל על ידי אנזים הגבלה BamHI, לתוך האתר BamHI של וקטור שונה pBK301 נושא dCas9. ודא השיבוט על ידי סנגר ישירה רצף. שימו לב כי פלסמיד הביא בנמלים dCas9-DNMT3A-p2a-puromycin transgene. פלסמיד מבטא gRNA לגרדום מ- U6 אנושי המקדם (איור 3).
    4. החלף את הגן כתב puromycin חלבון פלואורסצנטי ירוק (GFP) כדי ליצור dCas9-DNMT3A-p2a-GFP. לעכל dCas9-DNMT3A-p2a-פורו פלסמיד עם FseI. לטהר את המקטע וקטור בעזרת שיטת טיהור ג'ל. הכן את תותב באמצעות עיכול pBK201a (pLenti-GFP) עם FseI. לשכפל את מקטע FseI לתוך וקטור. PBK539 פלסמיד הביא בנמלים transgene dCas9-DNMT3A-p2a-GFP (איור 3).
  2. Culturing HEK-293T תאים, ציפוי תאים עבור תרביות תאים
    הערה: כליה אנושית עובריים 293T (HEK-293T) תאים מתורבתים ב גבוהה מלאה-גלוקוז Dulbecco המתואמת של בינוני הנשר (DMEM; 10% עגל שור סרום, אנטיביוטיקה-antimycotic 1 x, 1 x נתרן פירובט, 1 x לא חיוניות חומצת אמינו, 2 מ מגלוטמין) ב 37 ° C עם 5% CO 2. עבור הפארמצבטית הפרוטוקול, מומלץ לבחון את הנסיוב עגל כאשר מחליפים הרבה/אצווה שונים. עד 15 6 ס מ לוחות הדרושים לייצור lentiviral.
    1. השתמש התאים נמוך-המעבר להפעלת תרבות חדשה (נמוך יותר מאשר מעבר 20). לאחר התאים להגיע למפגש 90%-95%, וארוקן את המדיה ואת בעדינות לשטוף אותו עם עקר 1 x באגירה פוספט תמיסת מלח (PBS).
    2. להוסיף 2 מ של טריפסין-EDTA (0.05%) דגירה זה ב 37 מעלות צלזיוס למשך 3-5 דקות. כדי להשבית הכימית דיסוציאציה, להוסיף 8 מ של DMEM גבוהה-גלוקוז מלאה, ו x x-15 פיפטה 10 עם פיפטה סרולוגית 10 מ ליצירת תא בודד השעיה של 4 x 106 תאים למ"ל.
    3. עבור transfections, מעיל צלחות 15 ס מ עם ג'לטין 0.2%. הוסף 22.5 מ של גלוקוז גבוה בינוני, זרע התאים על-ידי הוספת 2.5 מ של התא השעיה (סה כ ~ 1 x 107 תאים/צלחת). דגירה הלוחות ב 37 ° C עם 5% CO2 עד 70%-80% הנהרות.
  3. תרביות תאים תאים HEK-293T
    1. להכין 2 x פתרון באגירה ולבס BBS CaCl 1 מ'2, על פי Vijayraghavan, קנטור35. לסנן את הפתרונות על ידי הכנסתם מסנן מיקרומטר 0.22 ואחסן אותם ב 4 º C. המיקס תרביות תאים חייב להיות ברור לפני תוספת שלה על התאים. אם השילוב הופך מעוננים במהלך הדגירה, להכין טרי x BBS 2 (ה-pH = 6.95).
    2. כדי להכין את תערובת פלסמיד, להשתמש של פלסמידים ארבע כמפורט (התמהיל הבא הוא מספיק עבור לוח 15 ס מ אחד): 37.5 µg של וקטור CRISPR/dCas9-העברה (pBK492 [DNMT3A-פורו-לא-gRNA] או pBK539 [DNMT3A-GFP-לא-gRNA]); 25 µg של pBK240 (psPAX2); µg 12.5 של pMD2.G; µg 6.25 של pRSV-rev (איור 4A). חישוב נפח פלסמידים מבוסס על ריכוז ולהוסיף הכמויות הנדרש לתוך צינור חרוטי 15 מ"ל. להוסיף µL 312.5 של 1 מ' CaCl2 להביא את עוצמת הקול הסופי 1.25 mL, בעזרת סטרילי dd-H2O. בעדינות להוסיף mL 1.25 של פתרון 2 x BBS בעת vortexing המיקס. תקופת דגירה של 30 דקות בטמפרטורת החדר. התאים הם מוכנים תרביות תאים, ברגע שהם יהיו confluent 70%-80%.
    3. האחות התקשורת ולהחליף אותו עם 22.5 מ ל שזה עתה הוכנו DMEM גבוהה-גלוקוז ללא סרום. להוסיף 2.5 מ של תערובת תרביות תאים dropwise כל צלחת 15 ס מ. מערבולת הלוחות, דגירה ב 37 ° C עם 5% CO2 על 2-3 h.
    4. לאחר 3 שעות, להוסיף 2.5 מ ל (10%) של נסיוב לכל צלחת דגירה בין לילה ב 37 ° C עם 5% CO2.
    5. ביום 1 לאחר תרביות תאים, לבחון את התאים כדי לוודא שלא תהיה שום או מוות של תאים מינימלית, כי התאים יצרו תרבות confluent (100%).
      1. לשנות את התקשורת על-ידי הוספת 25 מ ל שזה עתה הוכנו סרום DMEM ו-10% גלוקוז גבוהה כל צלחת.
    6. דגירה ב 37 ° C עם 5% CO2 במשך 48 שעות.
  4. הקציר של הוירוס
    1. לאסוף את תגובת שיקוע של כל התאים transfected, בריכה להם צינורות חרוט 50 מ. צנטריפוגה ב 400-450 x g עבור 10 דקות לסנן את תגובת שיקוע דרך יחידת מסנן ואקום 0.45 מיקרומטר. לאחר סינון, ניתן לשמור את תגובת שיקוע ב 4 ° C לאחסון לטווח קצר (עד 4 ימים). לאחסון לטווח ארוך, להכין aliquots ואחסן אותם ב- 80 ° c
      הערה: ההכנות נגיפי nonconcentrated צפויים להיות ~ 2 x 107 3 x 107 וו/mL (עיין בסעיף 1.5 לקביעת כייל נוגדנים). מומלץ להכין aliquots לשימוש יחיד, מאז מספר מחזורים ההקפאה-הפשרה תגרום לאובדן 10% – 20% ב- titers תפקודית.
  5. ריכוז של נגיפים
    הערה: לטיהור, שיטת כפול-סוכרוז שני שלבים מעורבים צעד מעבר צבע סוכרוז, צעד כרית סוכרוז הוא ביצע (איור 4B).
    1. ליצירת מעבר צבע סוכרוז, להכין את צינורות ultracentrifugation חרוט לפי הסדר הבא: 0.5 מ של 70% סוכרוז ב- PBS 1 x, 0.5 מ של 60% סוכרוז DMEM, 1 מ"ל של 30% סוכרוז ב DMEM ו 2 מ של 20% סוכרוז ב- 1 x PBS.
    2. . בזהירות, מוסיפים את תגובת שיקוע, שנאספו לפי סעיף 1.4, מעבר הצבע. מאחר לנפח הכללי שנאסף ארבעה לוחות 15 ס מ 100 מ ל, להשתמש 6 צינורות ultracentrifugation לעבד את תגובת שיקוע ויראלי.
    3. באותה מידה להפיץ את תגובת שיקוע ויראלי בקרב כל שפופרת ultracentrifugation. כדי למנוע שבירה צינור במהלך צנטריפוגה, מלא הצינורות ultracentrifugation כדי לפחות שלוש וארבע של קיבולת הנפח הכולל שלהם. לאזן את הצינורות עם 1 x PBS. Centrifuge את הדגימות ב x 70,000 g עבור 2 h ב-17 מעלות צלסיוס
      הערה: כדי לשמור על השכבה סוכרוז במהלך השלבים האצה והאטה, לאפשר את ultracentrifuge לאט להאיץ ולהאט הרוטור מ-0 ל-200 x g ומ-200 0 x g במשך 3 דקות הראשון והאחרון של הספין, בהתאמה.
    4. בעדינות לאסוף 30% – 60% סוכרוז שברים לתוך צינורות נקיים (איור 4B). להוסיף 1 x למעלה (קר) PBS 100 מ של הנפח הכולל. מערבבים על-ידי pipetting מספר פעמים.
    5. . בזהירות, stratify ההכנה ויראלי על כרית סוכרוז על-ידי הוספת מ 4 ל 20% סוכרוז (ב- 1 x PBS) ברכבת התחתית. המשך על-ידי pipetting ~ 20 – 25 מ של הפתרון ויראלי למחזור בכל. למלא את הצינורות 1 x PBS אם אמצעי האחסון של התוכן שלהם הוא פחות מ 3-4 למחזור. בזהירות לאזן בין הצינורות. צנטריפוגה ב 70,000 x g עבור 2 h ב-17 מעלות צלסיוס . רוקן את תגובת שיקוע, היפוך הצינורות על מגבות נייר כדי לאפשר את הנותרים נוזלי כדי לנקז.
    6. להסיר את כל הנוזל על ידי בזהירות כ רפה בעברית את הנוזל הנותר. שימו לב כי, בשלב זה, פלטות המכילה הוירוס בקושי נראה קטן. נקודות שקופות. להוסיף µL 70 ל- 1 x PBS צינור הראשון כדי resuspend בגדר. ביסודיות pipette ההשעיה, להעביר אותו הצינור הבא עד כל החבילות הן resuspended.
    7. לשטוף את הצינורות עם µL 50 נוספים של 1-PBS ומיקס כמו בעבר. שימו לב כי, בשלב זה, עוצמת הקול של התליה האחרון ~ 120 µL, מופיע מעט חלבי. כדי לקבל השעיה ברורה, להמשיך עם צנטריפוגה s 60 ב x 10,000 ג'י. להעביר את תגובת שיקוע צינור, להפוך 5 µL aliquots, ולאחסן אותם ב- 80 ° c
      הערה: ההכנות וקטור lentiviral רגישים מחזוריות החוזרות ונשנות הקפאה והפשרה. בנוסף, הוא הציע כי השלבים הנותרים הם לעשות תרביות רקמה בלימה או ב המיועד אזורים מוסמך במונחים של להיות ברמה נאותה של תקני אבטחה (איור 4B).
  6. כימות של titers ויראלי
    הערה: ההערכה של נגיפי titers מבוצע בשיטת p24 מקושרים-אנזים immunosorbent assay (אליסה) (p24מחסום פה אליסה), על-פי התוכנית חיסון לאיידס הלאומית המכונים לבריאות (NIH) פרוטוקול עבור HIV-1 p24 ללכוד הנוגדנים עם שינויים קלים.
    1. השתמש µL 200 של 0.05%-Tween-20 x 1 קר ב- PBS (PBS-T) כדי לשטוף את הבארות של צלחת 96-ובכן 3 x.
    2. כדי להרגיע את הצלחת, השתמש µL 100 של נוגדן monoclonal anti-p24 מדולל ב- 1:1,500 ב- 1 x PBS. דגירה את הצלחת בן לילה ב 4 º C.
    3. להכין ריאגנט חסימה (1% שור אלבומין [BSA] ב- 1 x PBS) ולהוסיף 200 µL בכל טוב כדי למנוע מחייב לא ספציפית. השתמש µL 200 של PBS-T כדי לשטוף את x 3 טוב לפחות שעה בטמפרטורת החדר.
    4. להמשיך עם הכנת המדגם. בעת עבודה עם ההכנות וקטור מרוכז, לדלל וקטור ב- 1: 100, באמצעות µL 1 מדגם µL 89 של dd-H20, 10 µL של טריטון X-100 (ריכוז סופי של 10%). על ההכנות nonconcentrated, לדלל את הדגימות-1:10.
    5. לקבל HIV-1 סטנדרטים באמצעות כפולה לדילול טורי (הריכוז ההתחלתי הוא 5 ng/mL).
    6. לדלל את הדגימות מרוכז (להכין בשלב 1.6.4) ב- RPMI 1640 בתוספת 0.2% BSA Tween 20 ו- 1% כדי להשיג 1:10, 000, 1:50, 000, 1:250,000 דילולים. באופן דומה, לדלל את הדגימות nonconcentrated (להכין בשלב 1.6.4) ב- RPMI 1640 בתוספת 0.2% Tween 20 ו- 1% BSA להקים שבערך, 1:2, 500, ו דילולים 1:12,500.
    7. הוסף את הדגימות ואת תקני בצלחת ב- triplicates. דגירה בין לילה ב 4 º C.
    8. למחרת, לשטוף את הבארות 6 x.
    9. להוסיף 100 µL של הארנב polyclonal נוגדן anti-p24, מדולל ב- 1:1,000 ב RPMI 1640, 10% סרום שור עוברית (FBS), BSA 0.25% ו- 2% העכבר הרגיל סרום (NMS), דגירה ב 37 מעלות צלזיוס במשך 4 שעות.
    10. לשטוף את הבארות 6 x. להוסיף עז ארנב נגד חזרת peroxidase IgG מדולל ב- 1:10,000 ב RPMI 1640 בתוספת 5% עז נורמלית בסרום, 2% NMS, BSA 0.25% ו- 0.01% Tween 20. דגירה ב 37 ° C עבור 1 h.
    11. לשטוף את הבארות 6 x. הוסף שוייץ peroxidase המצע, דגירה בטמפרטורת החדר למשך 15 דקות.
    12. כדי להפסיק את התגובה, להוסיף 100 µL של 1 N HCl. בקורא microplate, למדוד את ספיגת ב 450 ננומטר.
  7. מדידה של הכתב פלורסנט בעוצמה
    1. השתמש ההשעיה ויראלי להשגת 10-fold לדילול טורי (מתוך 10-1 כדי 10-5) ב 1 x PBS.
    2. צלחת 5 x 10 תאים5 HEK-293T כל טוב של צלחת 6-. טוב. החל µL 10 של כל דילול ויראלי לתאים, דגירה ב 37 ° C עם 5% CO2 במשך 48 שעות.
    3. להמשיך תא לפעיל על-ידי קרינה פלואורסצנטית מיון (FACS) ניתוח כדלקמן: ניתוק תאים על-ידי הוספת µL 200 של 0.05% טריפסין-EDTA פתרון. דגירה התאים ב 37 מעלות צלזיוס למשך 5 דקות, resuspend אותם ב 2 מ של DMEM בינוני (עם סרום). לאסוף הדגימות לתוך צינור חרוטי 15 מ"ל צנטריפוגה-x 400 g ב- 4 מעלות צלזיוס. Resuspend בגדר ב µL 500 ל- PBS קר 1 x.
    4. לתקן את התאים על-ידי הוספת µL 500 של 4% paraformaldehyde (PFA), תקופת דגירה של 10 דקות בטמפרטורת החדר.
    5. צנטריפוגה ב x 400 g ב 4 ° C, resuspend בגדר ב 1 מ"ל של PBS 1 x. לנתח את הביטוי GFP באמצעות מכשיר FACS, כפי שמתואר Ortinski et al.30. כדי לקבוע כייל פונקציונלי של וירוס, השתמש בנוסחה הבאה.
      Equation 1
      כאן,
      Tg = מספר תאים GFP-חיוביות;
      Tn = סה כ מספר תאים;
      N = מספר כולל של תאים transduced;
      V = אמצעי המשמש עבור התמרה חושית (ב microliters).
  8. ספירת תאים GFP-חיובית
    הערה: לקבוע את הריבוי של זיהום (MOI) כי הוא מועסק עבור התמרה חושית. מבחן של טווח רחב של MOIs (מ- MOI = 1 ל- MOI = 10).
    1. הזרע 3 x 105 לתאים5 HEK-293T עונה 4 פרק 10 לכל כל טוב של צלחת 6-. טוב.
    2. כאשר התאים להגיע > 80% הנהרות, מגלי אותם עם וקטור למשרד הפנים של עניין.
    3. דגירה ב 37 ° C עם 5% CO2, לנטר את האות ה-GFP בתאים 1-7 ימים.
    4. לספור את מספר תאי ה-GFP-חיוביות. מעסיקים מיקרוסקופ פלואורסצנטי (תוכנית 4 x אובייקטיבי, 0.1 נ. א, 40 x הגדלה) באמצעות מסנן GFP (עירור אורך גל = 470 ננומטר, אורך גל פליטה = 525 ננומטר). השתמש untransduced תאים כדי להגדיר שליטה אוכלוסיית תאים GFP-שלילי.
    5. מעסיקים את הנוסחה הבאה כדי לקבוע את כייל פונקציונלי של הנגיף.
      Equation 2
      כאן,
      N = מספר תאים GFP-חיוביות;
      D = גורם לדילול;
      M = פקטור ההגדלה;
      V = נפח של וירוס המשמש עבור התמרה חושית.
      הערה: לחשב התוצאות בעקבות דוגמה זו: עבור תאים GFP-חיובית 10 (N) נספרים לדילול (ד) 10-4 (1:10, 000) בהגדלה 20 x (ז) במדגם 10 µL (V), יהיה טו למיליליטר (10 x 104) x (20) x (10) x (100) = 2 x 108 וו/mL.

2. הבידול של העצבי דופאמין ובתאים

  1. Culturing hiPSCs
    הערה: hiPSCs מחולה עם triplication של מיקומה SNCA, ND34391, התקבלו מן המכון הלאומי של הפרעות נוירולוגיות ו קו (NINDS) קטלוג (ראה טבלה של חומרים).
    1. תרבות hiPSCs בתנאים מזין תלויית תרבות ESC-iPSC נטולת מזין בינוני (ראה טבלה של חומרים) על גבי הממברנה המלא hESC מטריקס בסיסי (BMM)-מצופה לוחות (ראה טבלה של חומרים). לשטוף את המושבות confluent עם 1 מ"ל של DMEM/F12, להוסיף 1 מיליליטר דיסוציאציה ריאגנט (ראה טבלה של חומרים), דגירה למשך 3 דקות בטמפרטורת החדר.
    2. האחות הכימית דיסוציאציה ולהוסיף 1 מ"ל של תרבות ESC-iPSC נטולת מזין בינוני.
    3. לגרד את הצלחת השימוש של מרים תא, resuspend את המושבות ב mL 11 נטולת מזין ESC-iPSC תרבות בינוני על ידי pipetting x-5 4 x באמצעות פיפטות בורוסיליקט.
    4. לוחית רישוי 2 מ"ל של המושבה השעיה על גבי צלחות מצופה BMM ולמקם את הצלחת ב 37 ° C עם 5% CO2. לבצע שינוי בינונית מדי יום, לפצל את התאים כל 5-7 ימים.
  2. בידול לתוך העצבי דופאמין ובתאים
    הערה: הבידול של hiPSCs לתוך וכולינרגיים עצבית ובתאים (MD NPCs) מתבצעת באמצעות פרוטוקול זמינים מסחרית אינדוקציה עצבי בינוני לפי הוראות היצרנים, עם שינויים קלים (32 31, ראה טבלה של חומרים). היום הראשון של הבידול נחשב יום 0. HiPSCs באיכות גבוהה נדרשים עבור בידול עצבית יעילה. אינדוקציה של MD NPCs הוא performedusing גוף embryoid (EB)-מבוסס פרוטוקול.
    1. לפני שמתחילים את הבידול של hiPSCs, להכין צלחת תרבות microwell (ראה טבלה של חומרים) על פי הוראות היצרן שלה.
    2. לאחר הכנת לוח תרבות microwell, להוסיף 1 מ"ל של אינדוקציה עצבי בינוני (נים; ראה טבלה של חומרים) בתוספת 10 מיקרומטר Y-27632.
    3. להפריש את הצלחת עד מוכן לשימוש.
    4. לשטוף את hiPSCs עם DMEM/F12, להוסיף 1 מ"ל של פתרון ניתוק התא (ראה טבלה של חומרים), דגירה למשך 5 דקות ב 37 ° C עם 5% CO2.
    5. Resuspend תאים בודדים ב- DMEM/F12, centrifuge אותם ב 300 x גרם במשך 5 דקות.
    6. וארוקן את תגובת שיקוע ובזהירות resuspend התאים נים + 10 מיקרומטר Y-27632 בריכוז הסופי של 3 x 106 תאים/מ ל....
    7. להוסיף 1 מ"ל של התליה תא בודד לבאר בודדת של צלחת תרבות microwell, centrifuge את הצלחת ב x 100 g למשך 3 דקות.
    8. בוחנים את הצלחת מתחת למיקרוסקופ כדי להבטיח ריפודי כתופיים התאים בין microwell, דגירה התאים ב 37 ° C עם 5% CO2.
    9. ימים 1-4, לבצע שינוי יומי בינוני חלקית.
    10. באמצעות micropipette של 1 מ"ל, להסיר 1.5 מ של המדיום וזורקים. . לאט, להוסיף 1.5 מ של נים טריים ללא Y-27632.
    11. חזור על שלב 2.2.10 עד יום ד'.
    12. יום 5, מעיל אחד טוב של צלחת 6-ובכן עם BMM.
    13. מניחים מסננת הפיך מיקרומטר 37 (ראה טבלה של חומרים) על גבי צינור חרוטי 50 מ ל (פסולת). הצבע על החץ של מסננת הפיך כלפי מעלה.
    14. הסר את המדיום לצלחת תרבות microwell מבלי להפריע את EBs בנוי.
    15. להוסיף 1 מ"ל של DMEM/F12, מיד לאסוף את EBs עם פיפטה בורוסיליקט ולסנן אותם דרך מסננת.
    16. חזור על שלב 2.2.15 עד EBs כל יוסרו לצלחת תרבות microwell.
    17. היפוך של מסננת מעל צינור חרוטי 50 מ"ל ולהוסיף 2 מ של נים כדי לאסוף את כל EBs.
    18. לוחית רישוי 2 מ"ל של ההשעיה EB לבאר בודדת של צלחת מצופים BMM באמצעות פיפטה בורוסיליקט. דגירה של EBs ב 37 ° C עם 5% CO2.
    19. יום 6, להכין 2 מ"ל של נים + 200 ng/mL ששש (ראה טבלה של חומרים) ולבצע שינוי בינונית מדי יום.
    20. יום 8, לבחון את האחוז של אינדוקציה עצביים.
    21. לספור EBs מחובר ו, באופן ספציפי, לקבוע את מספר כל EB בודדים הממולא עם רוזטות עצבית. לכמת את אינדוקציה רוזט עצביים באמצעות הנוסחה הבאה.
      Equation 3
      הערה: אם תנאי הגיוס עצבית < 75%, הבחירה רוזט עצבית עשוי להיות לא יעיל.
    22. יום 12, להכין 250 מ של מדיום N2B27 119 מ של neurobasal בינוני, 119 מ של DMEM/F12 בינוני, 2.5 מ ל GlutaMAX, 2.5 מ ל NEAA, 2.5 מ של תוספת N2, 5 מ ל B27. ללא ויטמין A, μL 250 של גנטמיצין (50 מ"ג/מ"ל) , ו- 19. ΜL 66 של BSA (7 מ"ג/מ"ל).
    23. כדי להכין 50 מ של מדיום N2B27 מלאה, להוסיף 3 μM CHIR99021, 2 μM SB431542, bFGF 20 ng/mL, 20 ng/mL EGF ו 200 ng/mL ששש.
      הערה: חשוב להכין את השלמת בינונית לפני השימוש.
    24. האחות בינוני מן הבארות המכיל רוזטות עצבית, לשטוף עם 1 מ"ל של DMEM/F12.
    25. מודעה 1 מ"ל של ריאגנט הבחירה רוזט עצבית (ראה טבלה של חומרים) דגירה ב 37 ° C עם 5% CO2 לשעה.
    26. הסר בחירה הכימית, באמצעות pipettor של 1 מ"ל, מכוון ישירות האשכולות רוזט.
    27. להוסיף את המתלים צינור חרוטי 15 מ"ל וחזור על שלבים 2.2.25 ו- 2.2.26 עד רוב האשכולות רוזט עצבית שנאסף.
      הערה: כדי למנוע זיהום, עם סוגי תאים nonneuronal, לא overselect.
    28. Centrifuge התליה רוזט ב x 350 גרם במשך 5 דק. לשאוב את תגובת שיקוע, resuspend רוזטות עצבית N2B27 + 200 ng/mL ששש. להוסיף את המתלים רוזט עצבית לבאר, מצופים BMM, דגירה את הצלחת ב 37 ° C עם 5% CO2.
    29. ימים 13-17, לבצע שינוי בינונית מדי יום באמצעות בינוני N2B27 הושלמה. המעבר את התאים כאשר התרבויות confluent 80% – 90%.
    30. כדי לפצל את התאים, להכין צלחת BMM מצופים.
    31. לשטוף את התאים עם 1 מ"ל של DMEM/F12, תשאף המדיום ולהוסיף 1 מיליליטר דיסוציאציה ריאגנט (ראה טבלה של חומרים).
    32. תקופת דגירה של 5 דקות ב 37 מעלות צלזיוס, להוסיף 1 מ"ל של DMEM/F12, לסלק תאים המחוברים על ידי pipetting למעלה ולמטה. לאסוף את המתלים NPC צינור חרוטי 15 מ"ל. צנטריפוגה ב x 300 גרם במשך 5 דקות.
    33. וארוקן את תגובת שיקוע, resuspend תאי 1 מ"ל של N2B27 מלאה + 200 ng/mL ששש.
    34. לספור את התאים ואת צלחת אותם על צפיפות של 1.25 x5 10 תאים/cm2, דגירה התאים ב 37 ° C עם 5% CO2.
    35. לשנות את המדיום בכל יום אחר, באמצעות N2B27 מלאה + 200 ng/mL ששש.
      הערה: -קטע זה, NPCs נחשבים מעבר (P) 0. ניתן למשוך ששש של המדיום N2B27-P2.
    36. המעבר את התאים ברגע שיגיעו למפגש 80% – 90%.
    37. בשלב זה, לאשר כי התאים להביע סמנים Nestin ו- FoxA2 באמצעות immunocytochemistry ו- qPCR. פרוטוקול זה מוביל הדור של 85% תאי זוגית-חיובית עבור הסמנים Nestin ו- FoxA2.
    38. עבור passaging תאים, חזור על שלבים 2.2.31–2.2.36.
    39. להקפיא את התאים, החל מהמעבר P2. עבור הקפאת תאים, חזור על השלבים 2.2.31–2.2.36, resuspend בגדר תא-עונה 2 פרק 106 4 x 106 תאים למ"ל באמצעות קר קדמון עצבית קפוא בינוני (ראה טבלה של חומרים).
    40. להעביר 1 מ"ל של התליה תא לתוך כל cryovial, להקפיא את התאים באמצעות מערכת סטנדרטית קירור להאט את קצב-מבוקר. לאחסון לטווח ארוך, שמור את התאים חנקן נוזלי.
  3. מפשיר MD NPCs
    1. להכין צלחת מצופים BMM וחמים N2B27 מלאה. להוסיף 10 מ של DMEM חמים/F12 צינור חרוטי 15 מ"ל. המקום cryovial בתוך גוש חום 37 º C למשך 2 דקות.
      1. להעביר את התאים cryovial הצינור המכיל DMEM/F12. צנטריפוגה ב x 300 גרם במשך 5 דקות.
      2. וארוקן את תגובת שיקוע, resuspend תאי 2 מ של N2B27, ולהוסיף התליה תא טוב אחד של הלוח מצופה BMM. דגירה התאים ב 37 ° C עם 5% CO2.

3. התמרה חושית של MD NPCs וניתוח של מתילציה שינויים

  1. התמרה חושית של MD NPCs
    1. מגלי MD NPCs ב-70% למפגש עם וקטורים LV-gRNA/dCas9-DNMT3A-MOI = 2. להחליף את posttransduction h 16 בינונית N2B27.
    2. הוסף N2B27 5 puromycin µg/mL, 48 שעות לאחר התמרה חושית. התרבות התאים למשך 3 שבועות לתוך N2B27 פלוס puromycin כדי להשיג את הקווים MD NPC יציב. התאים מוכנים עבור יישומי הזרם (ה-DNA, RNA, חלבון ניתוח, אפיון פנוטיפי23, קפוא, passaging).
  2. אפיון לפרופיל מתילציה של אינטרון SNCA 1
    1. לחלץ את הדנ א של כל תא stably transduced קו באמצעות מיצוי הדנ א של קיט (ראה טבלה של חומרים).
    2. שימוש 800 ng של ה-DNA כדי לבצע המרה ביסולפאט, שימוש זמינים מסחרית קיט (ראה טבלה של חומרים). לאחר ההמרה ביסולפאט, elute ה-DNA ביסולפאט המרה כדי 20 ng/µL.
  3. PCR לניתוח pyrosequencing
    1. הכנת המיקס מאסטר PCR נוקלאז ללא צינור. עבור כל תגובה, להשתמש µL 0.4 של פריימר הפוכה (10 מיקרומטר), µL 0.4 של פריימר לפנים (10 מיקרומטר), µL 1.6 של MgCl2 (25 מ מ), 2 µL של 10 x CoralLoad להתרכז, 10 µL של מיקס מאסטר x PCR 2, µL 4 5 x Q-פתרון, µL 1 של ה-DNA , ו- 0.6 µL של נוקלאז ללא מים.
    2. להעביר את הצלחת התגובה thermocycler ולבצע PCR תוך שימוש בתנאים הבאים: 95 מעלות צלזיוס למשך 15 דקות, 50 מחזורים של 94 ° C ל 30 s, 56 ° C ל 30 s, ו- 72 מעלות צלזיוס ל 30 s, בצעד האחרון מינימום 10 הרחבה-72 מעלות צלזיוס. תחל המשמש את pyrosequencing של SNCA אינטרון 1 מוצגים בטבלה 1, איור 7 או משלים איור 1.
    3. לאחר הגברה, דמיינו את amplicons באמצעות µL 2 של מוצר ה-PCR עם אתידיום ברומיד מכתים, הבאים agarose בג'ל.
    4. מבחני Pyrosequencing מאומתות באמצעות תערובות של unmethylated (U), מפוגל DNAs המרה ביסולפאט (ז) ב- היחס הבא, דהיינו 100U:0M, 75U:25M, 50U:50M, 25U:75M ו 0U:100M (ראה טבלה של חומרים).
    5. התנהגות pyrosequencing בעזרת ריאגנטים pyrosequencing (ראה טבלה של חומרים), לחשב את הערכים מתילציה עבור כל אתר CpG באמצעות תוכנת pyrosequencing. לקבלת פרוטוקול מפורט pyrosequencing, עיין Bassil et al.37.

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

אימות של titers הייצור של הווקטורים LV-dCas9-DNMT3A-GFP/פורו בהשוואה לכנף GFP תמים

אנו לבצע p24מחסום פה אליסה כדי להשוות בין titers הפיזי של LV-dCas9-DNMT3A-GFP/פורו עם עמיתיהם GFP/פורו תמימה. התוצאות נציג, המוצגים באיור 5A, מדגימים כי התשואות הפיזי של וקטורים, שנוצר באמצעות פרוטוקול המתוארים במסמך זה, הן דומות. הדבר מצביע על כי השירות של עמוד השדרה וקטור ממוטבת, בשילוב עם פרוטוקול ייצור ממוטב, גורמת לתפוקה גבוהה כייל של הווקטורים CRISPR/dCas9. כדי להעריך את היעילות של האריזה של dCas9-DNMT3A transgene לתוך חלקיקי נגיפי, ביצענו של התמרה חושית של וקטור מרוכז לתאים HEK-293T (איור 5B). עם זאת, התוצאות דיווחו איור 5A הראו כי שיעור התמרה חושית של הווקטור LV-dCas9-DNMT3A-GFP היה נמוך באופן משמעותי מזה של וקטור GFP תמימה (איור 5B). למעשה, כייל פונקציונלי של וקטור LV-dCas9-DNMT3A-GFP היה ארבע פעמים נמוך מזה של המקבילה תמימה, רומז כי יעילות אריזה הרנ א CRISPR/dCas9 מצטמצם. יתר על כן, הווקטור LV-dCas9-DNMT3A-פורו הקימו מושבות עמידים puromycin בקצב שהיה למטר נמוך בהשוואה לכנף תמימה-פורו. בדקנו גם את היעילות של התמרה חושית של הווקטורים LV-dCas9-DNMT3A-פורו ב NPCs MD. למטרה זו, תאים היו transduced עם וקטור תמים LV-GFP, LV-dCas9-DNMT3A-פורו-MOI = 1. כפי שמוצג באיור 5C, המחירים התמרה חושית של וקטור שליטה פורו היו עושי גבוה יותר לעומת וקטור dCas9-DNMT3A. תוצאות אלו שאושרו על-ידי ה-GFP בגירסאות של הווקטורים (איור 5D). כפי שהוצע במקטע דיון, עם אריזה/ביטוי נמוך, מאפייני המערכת LV-epigenome-עריכה המתוארים כאן, רמות שלה מספיקים לגרום מתילציה DNA בר קיימא על הרצף היעד. יתר על כן, מאפיינים אלו ניתן לשפר באמצעות שינוי קנה מידה את הליך הייצור.

הבידול של MD NPCs

פרוטוקול מבוסס-EB המתוארים כאן מאפשר את הבידול של MD NPCs (איור 6A). אנחנו העריכו את התהליך בידול באמצעות סמנים ספציפי בשלבים שונים. hiPSCs הביע סמן pluripotency OCT4, ואילו NPCs MD באה לידי ביטוי הן Nestin והן FOXA2 (איור 6B, ג). בעבר דיווחנו כי פרוטוקול בידול זה מייצרת 83.3% של תאים חיובית כפולה עבור Nestin ו- FOXA2 סמני31, המאשרת את הבידול מוצלחת של תאים אלה. לפחות 75%-80% של התאים צריכים להראות את סמני תא ספציפי. תשואה נמוכה יותר (< 50%) תאים חיוביים עבור הסמנים ידרוש פרוטוקול בידול נוסף.

אימות של pyrosequencing מבחני עבור אינטרון SNCA הפרופיל מתילציה 1

מבחני pyrosequencing שבע (טבלה 1, משלים איור 1, איור 7 א) היו תוכנן ואומת עבור כימות של המצב מתילציה אינטרון SNCA 1. Chr4: 89,836,150-89,836,593 (GRCh38/hg38) אזור מכיל 23 סחורות ארוזות לצרכן. מבחני מעוצב היו תוקף על ליניאריות באמצעות תערובות שונות של unmethylated (U), מפוגל DNAs המרה ביסולפאט (ז) באמות מידה. תערובות שימשו את היחס הבא, דהיינו 100U:0M, 75U:25M, 50U:50M, 25U:75M ו- 0U:100M. כל מבחני שבע היו לאמת (איור 7 ב) והראה ליניארי המתאם R2 > 0.93. מבחני היו לאימות לא היו מחדש. באמצעות את מבחני מאומתים, ניתן היה לקבוע את רמות מתילציה סחורות ארוזות לצרכן 23 ב אינטרון SNCA 1 (איור 7C).

Figure 1
איור 1: כלי עריכת Epigenome עבור הפעלת גנים ודיכוי. קונפורמציה סגור (א) ה-dna המציג את ארגון הטרוכרומטין. מולקולות אפקטור, כולל VP64, P65, rta, אנזים demethylation דנ א ט-1 יכול להיות גויסו לאזורים רגולטוריות (היזמים, אינטרונים, וכו ') באמצעות זיווג עם מערכת dCas9-gRNA. הגיוס של המערכת גורמת כרומטין שיפוץ שמוביל הקמת הארגון כרומטין פתוח (euchromatin) המשויך הפעלת גנים. (B) המבוסס על Epigenome להשתיק יכולה להיות מושגת על-ידי גיוס קומפלקסים repressory dCas9, כולל האנזים מתילציה קראב, HDACs ו- DNA, DNMT3A באזורים רגולטוריות (היזמים, אינטרונים, וכו ') באמצעות קשירה עם רכיב gRNA. הגיוס של תוצאות הביטול ג'ין (להשתיק), מערכת קשורה עם ה-DNA כרומטין שיפוץ, ובשנת אי הנגישות של מכונות שעתוק כלליות למבנה כרומטין. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 2
איור 2: עיצוב של וקטורים lentiviral עבור יישוב מתילציה DNA בתוך SNCA triplicated לוקוסים. (א) הייצור ואת הביטוי-ממוטב וקטור המרכזי (backbone) מתואר בפירוט על ידי קנטור ואח23, Ortinski et al.30, Vijayraghavan וקנטור35. הביאורים של אלמנטים חבר העמים של וקטור הם רכיב אריזה וקטור (ψ, psi), הרכיב Rev התגובה (הכנה), אתרי Sp1-קישור (Sp1), U6 אנושי המקדם (hU6), מקדם 1α גורם התארכות הליבה (EFS-NC) ו הנגיף הפטיטיס מרמיטה רכיב תקינה posttranscriptional (WPRE). ייצוג סכמטי (ב') SNCA triplicated לוקוס. מתילציה DNA הוא מנגנון ויסות גנים ברמת השעתוק חשוב במישרין או בעקיפין מגביל DNA נגישות21. הביטוי SNCA מוגברת נצפתה בצירוף מקרים לרמות מתילציה CpG נמוכות באינטרון SNCA 1 (החצים הירוקים תווית של מדינת ביטוי גנים מופעל לוקוס SNCA triplicated). הגיוס של וקטורים LV-gRNA/dCas9-DNMT3A לנדנד את האנזים methyltransferase לאזור אינטרון 1 SNCA . התוצאה ההרכבה של כרומטין סגורה אשר התוצאות downregulation תעתיק של SNCA (חצים אדומים). אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 3
איור 3: הקמת קלטת ביטוי וקטור lentiviral נושא dCas9-DNMT3A transgene. וקטור הורים, pBK301, מתוארת Ortinski et al.30. וקטור היה לשכפל עם dCas9-DNMT3A-פורו (pBK492) או dCas9-DNMT3A-GFP (pBK539) (הזרם. שכפול ניתן למצוא בפרוטוקול קנטור ואח23). אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 4
איור 4: וקטור Lentiviral אריזה, ייצור וטיהור. (א) תרביות תאים ארעי פרוטוקול המשמש לייצור של LV-gRNA/dCas9-DNMT3A. כדי להפיק וקטורים, HEK-293T התאים היו transfected עם וירוס vesicular stomatitis G-חלבון (VSV-G), אריזה, ביטוי פלסמידים23. נגיפים נאספו מ- supernatants התרבות. הדור השני של מערכת אריזה שימש כדי להשלים הקלטות הביטוי. המערכת טיפח Tat וחלבונים Rev. פלסמיד Rev, pRSV-REV, היה שיושלם בנפרד. קיצורים: pCMV = מקדם cytomegalovirus; LTRs = חזרה מסוף זמן; VSV-G = וירוס vesicular stomatitis G-חלבון; הכנה = רכיב Rev תשובה; Sp1 = שעתוק מקדם אתרים Sp1 מחייב; Ψ = הרכיב אריזה וקטור (psi); WPRE = וודצ'אק הפטיטיס וירוס posttranscriptional רכיב; EFS-NC = מקדם 1α גורם התארכות הליבה; hU6 = מקדם U6 אנושי. ריכוז וטיהור (B) וקטור בוצע כדלקמן: פרוטוקול מעבר צבע כפול-סוכרוז שימש לטהר ולרכז נגיפים בעקבות ארעי תרביות תאים (ראה לעיל). בקצרה, תרבות תגובת שיקוע (SN) שנאספו, טעון על מעבר הדרגתי סוכרוז. כדי ליצור מעבר הצבע, 70%, 60%, 30%, 20% סוכרוז ופתרונות מומס 1 x PBS שימשו. השלב השני של טיהור כללו את ultracentrifugation נגד כרית של 20% סוכרוז. בגדר בנוי היה resuspended ב 1 x PBS. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 5
איור 5: הערכה של נגיפי titers. (א) p24 אליסה וזמינותו. הליך tittering בוצעה כפי שתואר על ידי קנטור ואח23. הווקטור תמימה (GFP) מודגשת בתוך הפס השחור. וקטור LV-dCas9-DNMT3A-פורו (בר אור-כחול) של LV-dCas9-DNMT3A-GFP וקטור (בר ירוק) יסומנו גם. ייצור חלקיקים הפיזי של הווקטורים יוערכו. התוצאות נרשמות במספרים עותק למיליליטר, שבו 1 ng של p24מחסום פה = 1 x 104 נגיפים. נתונים גרף מייצג את זאת אומרת ± SD 3 ניסויים עצמאית. (B) הערכת titers תפקודית בעקבות התמרה חושית לתאים HEK-293T. אותו המכילות פורו היו transduced לתאי HEK-293T כפי שמתואר תוצאות נציג. Titers תפקודית של היצור ויראלי נמדדו על ידי ספירת מספר מושבות בעקבות הבחירה puromycin. התוצאות היו מחושב כיחס של מספר מושבות המתקבל את lentiviral וקטור-פורו (שליטה וקטורית) ביחס dCas9-DNMT3A-פורו המקביל לו. הגרף מייצג את זאת אומרת ± SD 3 ניסויים עצמאית. (ג) הערכת יעילות התמרה חושית וביטוי של הווקטורים HEK-293T תאים (החלונית העליונה), NPCs (החלונית התחתונה). הלוחות משמאל מייצגים את transductions וקטור תמימה (GFP). הלוחות נכון מייצגים transductions של dCas9-DNMT3A-GFP וקטור. שלושה ימים posttransduction, תמונות נאספו באמצעות מיקרוסקופ קרינה פלואורסצנטית (40 x). (ד) הערכת titers תפקודית בעקבות התמרה חושית לתוך NPCs. אותו המכילות פורו היו transduced לתוך NPCs כפי שמתואר נציג תוצאות, התוצאות חושבו כמו פאנל B. הגרף מייצג את זאת אומרת ± SEM של הביולוגיה שלושה משכפל. קיצורים: HEK-293T = כליה אנושית עובריים 293T; NPCs = ובתאים עצבית. אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 6
איור 6: בידול ואפיון של NPCs MD נגזר hiPSC. (א) ציר הזמן מציג את הבידול של MD NPCs. כימות של MD NPC סמני נגזר hiPSC באמצעות immunocytochemistry (B ו- C) ו- ( Eו-D ) בזמן אמת (RT) PCR. הרמות של כל ה-mRNA חושבו ביחס הממוצע הגאומטרי של GAPDH-mRNA ופקדים הפניה PPIA-mRNA בשיטת- ΔΔCT 2. כל עמודה מייצגת הממוצע של שני ביולוגי, טכני משכפל. קווי השגיאה מייצגים ב- SEM אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Figure 7
איור 7: אימות כמותית של pyrosequencing מבחני SNCA מיקוד אינטרון 1. מבט כולל על מבחני pyrosequencing ב אינטרון SNCA 1 (א). (B) מעוצב מבחני היו תוקף באמצעות יחסים שונים של unmethylated (U), מפוגל (ז) המרה ביסולפאט ה-DNA, כלומר 100U:0M, 75U:25M, 50U:50M, 25U:75M ו- 0U:100M. (ג) Validated מבחני שימשו כדי למדוד את אחוז מתילציה של סחורות ארוזות לצרכן 23 באינטרון SNCA 1 ב hiPSC-derived NPCs MD מחולה עם triplication של מיקומה SNCA . העמודות מסמנות הממוצע של האחוז של סחורות ארוזות לצרכן מפוגל שני ניסויים עצמאית, ולהראות קווי השגיאה ב- SEM אנא לחץ כאן כדי להציג גירסה גדולה יותר של הדמות הזאת.

Assay # פריימר לפנים (5' - 3') פריימר הפוכה (5' - 3') קביעת רצף פריימר (5' - 3') CpG מכוסה
1 TTTTTGGGGAGTTTAAGGAAAGA AACCTCCTTACACTTCCATTTCAT * GGGGAGTTTAAGGAAAGA 1
2 TGGGGAGTTTAAGGAAAGAGATTT ACCTCCTTACACTTCCATTTCATT * GGTTGAGAGATTAGGTTGTT 2,3,4,5,6,7
3 TTGGGGAGTTTAAGGAAAGAGAT ACCTCCTTACACTTCCATTTCATT * AGAGAGGATGTTTTATG 7, 8
4 TTTTTGGGGAGTTTAAGGAAAGA * CCTCCTTACACTTCCATTTCATT CTTACACTTCCATTTCATTAT 9,8
5 TGGGGAGTTTAAGGAAAGAGATTT CCCTCAACTATCTACCCTAAACA * GAGTTTGGTAAATAATGAA 10, 11, 12, 13, 14, 15, 16, 17
6 GTGTAAGGAGGTTAAGTTAATAGG ACAACAAACCCAAATATAATAATTCTAAT * AGGTTAAGTTAATAGGTGGTAA 17, 18, 19, 20, 21, 22
7 TTTTTGGGGAGTTTAAGGAAAGA * CTCAAACAAACAACAAACCCAAAT CTCAAACAAACAACAAACCCAAAT 23, 22, 21, 20
* מציין biotyniliated primers

טבלה 1: מבחני Pyrosequencing על ההערכה של SNCA אינטרון 1 CpG מתילציה רמות.

משלים איור 1: סקירה של pyrosequencing מבחני ב אינטרון SNCA 1- אנא לחץ כאן כדי להוריד את הקובץ.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

הזינו אותו החלו להסתמן כמו הרכב של epigenome עריכה, במיוחד בהקשר של מחלות גנטיות, בעיקר בגלל היכולת שלהם (i) להכיל מטענים דנ א גדולים ו- (ii) מגלי ביעילות מגוון רחב של חלוקת תאים nondividing. היעילות אריזה גדולה של אותו מועיל במיוחד עבור יישומים הכוללים אריזות של מערכות CRISPR/dCas9 אשר גדולות מדי. מנקודת מבט זו, הזינו אותו מייצגים את-של-הבחירה בפלטפורמת למסירה של מערכות CRISPR/Cas9 ה-all-in-one. אכן, הפלטפורמה AAV, כי בדרך כלל מועסק ליישומים טיפול גנטי קליניות, הוא לא לגמרי מסוגל לאכסן אריזה גדולים הגדלים של המערכות dCas9-אפקטור. למעשה, הדרישות אריזה קפדנית של הווקטורים AAV הם האוסר על השימוש שלהם למסירה של רכיבים CRISPR/dCas9. כדי לשפר את יכולת אריזה AAV, פותחו מספר פלטפורמות מבוססות AAV הרומן. לדוגמה, בגישה פיצול-intein המפריד בין Cas9 של מערכת לתוך שתי קלטות AAV היה לאחרונה נבנה38. הגישה גדל הכולל אריזה קיבולת; עם זאת, נדרש את הייצור ואת cotransduction של AAV שני וקטורים38. גילוי SaCas9, נגזר Staphylococcus aureus, מותר הפיתוח של SaCas9/מדריך RNA-מערכת-39,-40. SaCas9 הוא קצר יותר, אבל לא פחות חזק האנזים Cas9, בקלות הארוזים לתוך AAV וקטורים. In vivo ניסויים הוכיחו כי מערכת זו ביעילות מטרות הגן תקינה של כולסטרול PCSK940. ובכל זאת, יעילות האריזות של ה-all-in-one AAV וקטורים דורשת עוד שיפור. בהתחשב היתרונות ברורים של מערכת משלוח LV, אנחנו לאחרונה שפותחו ונמצאות בשימוש של transgene lentiviral טיפח את עמוד השדרה dCas9-DNMT3A, כמו גם לפיגום gRNA. כדי לבדוק את הפוטנציאל הטיפולי של מערכת חדשנית זו, נוכל להחיל אותו על משטרת hiPSC, נגזר נוירונים נשא SNCA לוקוסים triplication23. נוכל לאמת את היעילות של מערכת זו, שהובילה downregulation ייחודית של SNCA-mRNA וחלבון רמות23. חשוב מכך, המערכת הפגינו את היכולת להציל את הפנוטיפים הסלולר הקשורים למחלות, מציעה את הפוטנציאל הגדול של הגישה עבור טיפולים מבוססי epigenome23.

כדי להגדיל את הייצור של הווקטורים, השקנו לאחרונה מספר שינויים לתוך בקלטת ביטוי וקטור, כולל השילוב של Sp1, מחיקה ב 3' LTR אתרי למטה-שינוי גודל של פלסמיד הביטוי (ראו בפסקה הבאה)30 .

שינויים פלטפורמות קיימות

שיטת הייצור המובאת כאן מאפשר את הדור של וקטורים LV-CRISPR/dCas9-titers בטווח של דז'ה וו10 עונה 1 פרק 10/mL (איור 5). כפי שמודגש לעיל, כדי להשיג titers ייצור גבוה יותר, הוסיף שידור חוזר של האתר מחייב Sp1 של פקטור שעתוק לתוך קלטת וקטור הביטוי ה-all-in-one CRISPR/Cas9 ואנו הציג מחיקה המדינה-of-the-art לתוך האזור U3 של 3' משמאל לימין. לבצע שינויים אלה הביאו קולטנים upregulation משמעותית יעילות האריזות וקטור (~2.5x) כמו גם ביטוי transgene (בערך פי. שבעה)30,35. שיפורים אלה הם בהסכמה עם נתונים שנוצר קודם לכן41,42,43,44.

שלבים קריטיים ופתרון בעיות

הקלטת וקטור ממוטבת, הארוזים לתוך חלקיקים נגיפיים, יוצר titers של 1 x 1010 וו/mL לכל ~ 5 x 10 מפיק7 תאים. במקרה של הייצור של הווקטורים ב titers התחתון, יש לשקול את השיפורים הבאים. 1) להשתמש בתאים HEK-293T במספר נמוך המעבר. להחליף את התאים באופן קבוע לאחר ≥ 20 קטעים. בנוסף, להחליף את התאים כשהם מראים קצב צמיחה איטי. 2) באופן שגרתי לבדוק את הרכיבים של המדיום מאז הם עשויים לתרום השינויים בכייל נוגדנים וירוס. החלף סרום עוברית עם סרום חסכונית עגל הקוסמית. 3) שורות תאים שונים המשמש וקטור דור להפגין כושר ייצור שונות. לדוגמה, HEK-293T תאים המסוגלים לייצר וקטורים ברמות שנמצאים גבוה יותר מאשר התאים HEK - 293FT על-ידי שלוש פעמים (נתונים לא מוצג). 4) תרביות תאים אופטימלית תושג כאשר התאים נמצאים הנהרות 70%-80%. צפיפויות נמוך יגרום במוות מוקדמת של תאים כגורם רעילות ויראלי. עם זאת, הצפיפויות גבוהות יגרמו לירידה משמעותית יעילות הייצור. ככלל, צפיפות התאים לפני תרביות תאים צריך לאפשר את התאים לחלק פעם אחת לפני יצירת תרבות confluent באופן מלא. 5) titers תרביות תאים גם תלוי ה-pH של BBS הכימית. ככלל, אנו מציעים בדיקות אוסף חדש של BBS באווירה תקנים פיילוט לפני השימוש בו. ה-pH x BBS 2 צריך להיות 6.95.

הגדלת תנובת הייצור לעומת התמרה חושית יעילות/ביטוי

זה צריך להיות ציין כי למרות Sp1-אותו transgenes CRISPR/dCas9 נשיאה מסוגלים לייצר titers באזור עונה 1 פרק 1010 וו/mL לכל ~ 5 x7 10 תאים מפיק, שהוא דומה עם וקטור תמימה (איור 5A), יעילות של אריזות של וירוס RNA בסכנה משמעותית עם dCas9-DNMT3A transgene. אכן, נדגים כ עושי ירידה תפקודית titers ויכולות ביטוי של LV-dCas9-DNMT3A-פורו/GFP וקטורים (איור 5B-D). הקטנת אריזה ויעילות הביטוי של הווקטורים עשוי להיות תוצאה של ביטוי DNMT3A. בהקשר זה, זה הוכח כי מתילציה DNA עשוי לשחק תפקיד חשוב בשליטה על שכפול HIV-1 לבין ביטויה ג'ין. לכן, זה יהיה צורך לקבוע אם אותו כפופים תקנה דומה, אם זה המקרה, לפתח אסטרטגיות inducible-שתיקה הפעילות DNMT3A בשלב הייצור וקטור. למרות תשואה ייצור נמוכה יותר, להפגין הווקטורים הגון titers תפקודית (בטווח נמוך 109 , אשר יספיקו יישומים רבים, כולל אלה הדורשים ויוו משלוח). ראוי לציין כי הליך הייצור יכול להיות בקלות upscaled, כמפורט בסקירה, אשר אמור לאפשר התאמה titers שהושג עם מערכות ביטוי אחרות.

טיפול וקטור ובטיחות

כדי ליצור אותו, יש לשקול את הנקודות הבאות של בטיחות. ראשית, הזינו אותו דורשים אבטחה ברמה 2 containments. למרות הבטיחות היחסית של אותו (אשר נובעת טבעם חטא), פעילות גנים ברמת השעתוק שיורית כבר הפגינו22. יתר על כן, LV הגנום יכול להינצל על ידי HIV-122. בגלל כל זה, מומלץ מאוד לבצע שכפול מבחני כשירות (במיוחד על ההכנות מרוכז). על נהלי בטיחות לגבי הטיפול lentiviruses, אנו מתייחסים כאן אבטחה ב- Microbiological, מעבדות ביו-רפואית, מהדורה רביעית, שפורסם על ידי המרכז לבקרת מחלות (CDC; זמינים באינטרנט). עבור יישומים קליניים, להשתמש הדור השלישי של המערכת אריזה. עם זאת, יש לציין כי השימוש של הדור השלישי של מערכות אריזה משייכת titers התחתון השוואת עם מערכות אריזה של הדור השני.

משמעויות וכיוונים עתידיים

פלטפורמת הרומן שמפורטות כאן משפר את ארגז הכלים והולך המסירה של רכיבים לעריכת epigenome, אחרים וחקלאיים מולקולרית תאים ואיברים. למרות ההתקדמות בפיתוח מערכות המבוססות על HIV-1, רק מספר פלטפורמות מדגימים את התשואות בר-קיימא של היצור ויראלי. אופטימיזציה של עמוד השדרה וקטור דיווחו כאן אפשרה להתמודד עם הנושאים הקשורים יעילות ייצור נמוכה יחסית של הווקטורים. כדי לשפר את המאפיינים של ייצור וקטור, זה יהיה יקר כדי לבדוק אם התשואות וקטור, הביטוי ניתן לשפר באמצעות התוספת של העתקה רב חזרה של מוטיב מחייב אותו או על-ידי ריבוב המוטיב Sp1 עם זיהוי אתרים עבור גורמים אחרים. בהקשר זה, התוצאות המובאות כאן עשוי להציע אסטרטגיה כללית לשיפור חלשה יחסית היזמים רקמות ספציפיות, כגון אדם סינפסין אני (hSyn) ולא CamKIIa.

לאחרונה להדגים כי הביטוי לטווח ארוך של LV Cas9/המדריך המועבר RNA עלול לגרום לתופעות בלתי רצויות את המטרה30. אף-על-פי מושג זה מוחל בעיקר על חלוקת תאים, זה יהיה מאוד מועיל לפתח מערכות וקטור episomal מסוגל לספק transiently את מטעני טיפולית. כמו אזכור לעיל, וקטורים AAV הם חשובים מאוד, transiently אספקת רכב; עם זאת, היכולת אריזה נמוך מאוד להשפיע את השימוש בהם, במיוחד עבור יישומים לעריכת epigenome. מסיבה זו, וקטורים lentiviral חשוכת-integrase (IDLVs), הייתי מציע אמצעי אטרקטיבי עבור משלוח וביטוי של כלי עריכת epigenome מבוסס על CRISPR/dCas9. המאפיינים הבאים של פלטפורמת IDLV הם אטרקטיביים במיוחד: (i) היכולת להעביר מטענים גנטיים רחבה של תאים ואיברים; (ii) קיבולת אריזה סופריור – וזה יתרון ניכר על פני AAV וקטורים; (iii) הארעיות משלוח (וזה יתרון ניכר בהשוואה את אותו integrase-כשיר)45,30. האופי episomal של הגנום IDLV מדגיש את התעריפים אינטגרציה נמוכה מאוד שלהם, בתור שכזה, הם מאוד מועיל עבור הפחתת סיכון של insertional מוטגנזה מכוונת. לאחרונה אנחנו אופטימיזציה מאפיינים ייצור וביטוי של IDLV, יצירת פלטפורמה זו יעילה ובטוחה עבור משלוח של רכיבים CRISPR/Cas930. ואכן, IDLVs משופר היו מסוגל גרימת הגנום מהירה ומתמשכת עריכה בתאים HEK-293T, הנוירונים במוח postmitotic. המערכת מאופיינת ביטוי ארעי, נמצאה להיות בטוח יותר אותו integrase-המוסמכת המתאימה. ההסתגלות של וקטורים IDLV עבור יישומים הכוללים epigenome לעריכת מניפולציות יהיה מאוד מועיל עבור השדה טיפול גנטי.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

אוניברסיטת דיוק הגיש בקשה לרישום פטנט זמני הקשורים במחקר זה.

Acknowledgments

עבודה זו הייתה מומן בחלקו על ידי בפרס הפיתוח Neurotechnology קאהן (כדי האו. סי) ואת נבחרת מוסדות של בריאות/לאומי המכון של הפרעות נוירולוגיות שבץ (NIH/NINDS) (NS085011 R01 כדי האו. סי).

Materials

Name Company Catalog Number Comments
Equipment
Optima XPN-80 Ultracentrifuge Beckman Coulter A99839
0.22 μM filter unit, 1 L Corning 430513
0.45-μm filter unit, 500 mL Corning 430773
100 mm TC-Treated Culture Dish Corning 430167
15 mL conical centrifuge tubes Corning 430791
150 mm TC-Treated Cell Culture dishes with 20 mm Grid Corning 353025
50 mL conical centrifuge tubes Corning 430291
6-well plates Corning 3516
Aggrewell 800 StemCell Technologies 34811
Allegra 25R tabletop centrifuge Beckman Coulter 369434
BD FACS Becton Dickinson 338960
Conical bottom ultracentrifugation tubes Seton Scientific 5067
Conical tube adapters Seton Scientific PN 4230
Eppendorf Cell Imaging Slides Eppendorf 30742060
High-binding 96-well plates Corning 3366
Inverted fluorescence microscope Leica DM IRB2
QIAprep Spin Miniprep Kit (50) Qiagen 27104
Reversible Strainer StemCell Technologies 27215
SW32Ti rotor Beckman Coulter 369650
VWR® Disposable Serological Pipets, Glass, Nonpyrogenic VWR 93000-694
VWR® Vacuum Filtration Systems VWR 89220-694
xMark™ Microplate Absorbance plate reader Bio-Rad 1681150
Name Company Catalog Number Comments
Cell culture reagents
Human embryonic kidney 293T (HEK 293T) cells ATCC CRL-3216
Accutase StemCell Technologies 7920
Anti-Adherence Rinsing Solution StemCell Technologies 7010
Anti-FOXA2 Antibody Abcam Ab60721
Anti-Nestin Antibody Abcam Ab18102
Antibiotic-antimycotic solution, 100x Sigma Aldrich A5955-100ML
B-27 Supplement (50x), minus vitamin A Thermo Fisher Scientific 12587010
BES Sigma Aldrich B9879 - BES
Bovine Albumin Fraction V (7.5% solution) Thermo Fisher Scientific 15260037
CHIR99021 StemCell Technologies 72052
Corning Matrigel hESC-Qualified Matrix Corning 08-774-552
Cosmic Calf Serum Hyclone SH30087.04
DMEM-F12 Lonza 12-719
DMEM, high glucose media Gibco 11965
DNeasy Blood & Tissue Kit Qiagen 69504
EpiTect PCR Control DNA Set Qiagen 596945
EZ DNA Methylation Kit Zymo Research D5001
Gelatin Sigma Aldrich G1800-100G
Gentamicin Thermo Fisher Scientific 15750078
Gentle Cell Dissociation Reagent stemCell Technologies 7174
GlutaMAX Thermo Fisher Scientific 35050061
Human Recombinant bFGF StemCell Technologies 78003
Human Recombinant EGF StemCell Technologies 78006
Human Recombinant Shh (C24II) StemCell Technologies 78065
MEM Non-Essential Amino Acids Solution (100x) Thermo Fisher Scientific 11140050
mTeSR1 StemCell Technologies 85850
N-2 Supplement (100x) Thermo Fisher Scientific 17502001
Neurobasal Medium Thermo Fisher Scientific 21103049
Non-Essential Amino Acid (NEAA) Hyclone SH30087.04
PyroMark PCR Kit Qiagen 978703
RPMI 1640 media Thermo Fisher Scientific 11875-085
SB431542 StemCell Technologies 72232
Sodium pyruvate Sigma Aldrich S8636-100ML
STEMdiff Neural Induction Medium StemCell Technologies 5835
STEMdiff Neural Progenitor Freezing Medium StemCell Technologies 5838
TaqMan Assay FOXA2 Thermo Fisher Scientific Hs00232764
TaqMan Assay GAPDH Thermo Fisher Scientific Hs99999905
TaqMan Assay Nestin Thermo Fisher Scientific Hs04187831
TaqMan Assay OCT4 Thermo Fisher Scientific Hs04260367
TaqMan Assay PPIA Thermo Fisher Scientific Hs99999904
Trypsin-EDTA 0.05% Gibco 25300054
Y27632 StemCell Technologies 72302
Name Company Catalog Number Comments
p24 ELISA reagents
Monoclonal anti-p24 antibody NIH AIDS Research and Reference Reagent Program 3537
Goat anti-rabbit horseradish peroxidase IgG Sigma Aldrich 12-348 Working concentration 1:1500
Goat serum, Sterile, 10 mL Sigma G9023 Working concentration 1:1000
HIV-1 standards NIH AIDS Research and Reference Reagent Program SP968F
Normal mouse serum, Sterile, 500 mL Equitech-Bio SM30-0500
Polyclonal rabbit anti-p24 antibody NIH AIDS Research and Reference Reagent Program SP451T
TMB peroxidase substrate KPL 5120-0076 Working concentration 1:10,000
Name Company Catalog Number Comments
Plasmids
pMD2.G Addgene 12253
pRSV-Rev Addgene 52961
psPAX2 Addgene 12259
Name Company Catalog Number Comments
Restriction enzymes
BsmBI New England Biolabs R0580S
BsrGI New England Biolabs R0575S
EcoRV New England Biolabs R0195S
KpnI New England Biolabs R0142S
PacI New England Biolabs R0547S
SphI New England Biolabs R0182S

DOWNLOAD MATERIALS LIST

References

  1. Hsu, P. D., Lander, E. S., Zhang, F. Development and applications of CRISPR-Cas9 for genome engineering. Cell. 157, (6), 1262-1278 (2014).
  2. Gaj, T., Gersbach, C. A., Barbas, C. F. 3rd ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends in Biotechnology. 31, (7), 397-405 (2013).
  3. Thakore, P. I., Black, J. B., Hilton, I. B., Gersbach, C. A. Editing the epigenome: technologies for programmable transcription and epigenetic modulation. Nature Methods. 13, (2), 127-137 (2016).
  4. Gilbert, L. A., et al. CRISPR-mediated modular RNA-guided regulation of transcription in eukaryotes. Cell. 154, (2), 442-451 (2013).
  5. Gilbert, L. A., et al. Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation. Cell. 159, (3), 647-661 (2014).
  6. Perez-Pinera, P., et al. RNA-guided gene activation by CRISPR-Cas9-based transcription factors. Nature Methods. 10, (10), 973-976 (2013).
  7. Chavez, A., et al. Highly efficient Cas9-mediated transcriptional programming. Nature Methods. 12, (4), 326-328 (2015).
  8. Horlbeck, M. A., et al. Nucleosomes impede Cas9 access to DNA in vivo and in vitro. eLife. 5, (2016).
  9. Chavez, A., et al. Comparison of Cas9 activators in multiple species. Nature Methods. 13, (7), 563-567 (2016).
  10. Zhou, H., et al. In vivo simultaneous transcriptional activation of multiple genes in the brain using CRISPR-dCas9-activator transgenic mice. Nature Neuroscience. 21, (3), 440-446 (2018).
  11. Tanenbaum, M. E., Gilbert, L. A., Qi, L. S., Weissman, J. S., Vale, R. D. A protein-tagging system for signal amplification in gene expression and fluorescence imaging. Cell. 159, (3), 635-646 (2014).
  12. Konermann, S., et al. Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Nature. 517, (7536), 583-588 (2015).
  13. Holtzman, L., Gersbach, C. A. Editing the Epigenome: Reshaping the Genomic Landscape. Annual Review of Genomics and Human Genetics. (2018).
  14. Perez-Pinera, P., et al. Synergistic and tunable human gene activation by combinations of synthetic transcription factors. Nature Methods. 10, (3), 239-242 (2013).
  15. Thakore, P. I., et al. Highly specific epigenome editing by CRISPR-Cas9 repressors for silencing of distal regulatory elements. Nature Methods. 12, (12), 1143-1149 (2015).
  16. Amabile, A., et al. Inheritable Silencing of Endogenous Genes by Hit-and-Run Targeted Epigenetic Editing. Cell. 167, (1), 219-232 (2016).
  17. Liu, X. S., et al. Editing DNA Methylation in the Mammalian Genome. Cell. 167, (1), 233-247 (2016).
  18. McDonald, J. I., et al. Reprogrammable CRISPR/Cas9-based system for inducing site-specific DNA methylation. Biology Open. 5, (6), 866-874 (2016).
  19. Huang, Y. H., et al. DNA epigenome editing using CRISPR-Cas SunTag-directed DNMT3A. Genome Biology. 18, (1), 176 (2017).
  20. Vojta, A., et al. Repurposing the CRISPR-Cas9 system for targeted DNA methylation. Nucleic Acids Research. 44, (12), 5615-5628 (2016).
  21. Razin, A., Kantor, B. DNA methylation in epigenetic control of gene expression. Progress in Molecular and Subcellular Biology. 38, 151-167 (2005).
  22. Kantor, B., Ma, H., Webster-Cyriaque, J., Monahan, P. E., Kafri, T. Epigenetic activation of unintegrated HIV-1 genomes by gut-associated short chain fatty acids and its implications for HIV infection. Proceedings of the National Academy of Sciences of the United States of America. 106, (44), 18786-18791 (2009).
  23. Kantor, B., et al. Downregulation of SNCA Expression by Targeted Editing of DNA Methylation: A Potential Strategy for Precision Therapy in PD. Molecular Therapy. (2018).
  24. Jowaed, A., Schmitt, I., Kaut, O., Wullner, U. Methylation regulates alpha-synuclein expression and is decreased in Parkinson's disease patients' brains. Journal of Neuroscience. 30, (18), 6355-6359 (2010).
  25. Wang, Y., et al. A DNA methyltransferase inhibitor, 5-aza-2'-deoxycytidine, exacerbates neurotoxicity and upregulates Parkinson's disease-related genes in dopaminergic neurons. CNS Neuroscience & Therapeutics. 19, (3), 183-190 (2013).
  26. Matsumoto, L., et al. CpG demethylation enhances alpha-synuclein expression and affects the pathogenesis of Parkinson's disease. PLOS One. 5, (11), e15522 (2010).
  27. Desplats, P., et al. Alpha-synuclein sequesters Dnmt1 from the nucleus: a novel mechanism for epigenetic alterations in Lewy body diseases. Journal of Biological Chemistry. 286, (11), 9031-9037 (2011).
  28. Ai, S. X., et al. Hypomethylation of SNCA in blood of patients with sporadic Parkinson's disease. Journal of the Neurological Sciences. 337, (1-2), 123-128 (2014).
  29. Tagliafierro, L., Chiba-Falek, O. Up-regulation of SNCA gene expression: implications to synucleinopathies. Neurogenetics. 17, (3), 145-157 (2016).
  30. Ortinski, P. I., O’Donovan, B., Dong, X., Kantor, B. Integrase-Deficient Lentiviral Vector as an All-in-One Platform for Highly Efficient CRISPR/Cas9-Mediated Gene Editing. Molecular Therapy - Methods & Clinical Development. 5, 153-164 (2017).
  31. Tagliafierro, L., et al. Genetic analysis of alpha-synuclein 3' untranslated region and its corresponding microRNAs in relation to Parkinson's disease compared to dementia with Lewy bodies. Alzheimer’s & Dementia. 13, (11), 1237-1250 (2017).
  32. Tagliafierro, L., Zamora, M. E., Chiba-Falek, O. Multiplication of the SNCA locus exacerbates neuronal nuclear aging. Human Molecular Genetics. (2018).
  33. Kantor, B., McCown, T., Leone, P., Gray, S. J. Clinical applications involving CNS gene transfer. Advances in Genetics. 87, 71-124 (2014).
  34. Kantor, B., Bailey, R. M., Wimberly, K., Kalburgi, S. N., Gray, S. J. Methods for gene transfer to the central nervous system. Advances in Genetics. 87, 125-197 (2014).
  35. Vijayraghavan, S., Kantor, B. A Protocol for the Production of Integrase-deficient Lentiviral Vectors for CRISPR/Cas9-mediated Gene Knockout in Dividing Cells. Journal of Visualized Experiments. (130), e56915 (2017).
  36. Bayer, M., et al. A large U3 deletion causes increased in vivo expression from a nonintegrating lentiviral vector. Molecular Therapy. 16, (12), 1968-1976 (2008).
  37. Bassil, C. F., Huang, Z., Murphy, S. K. Bisulfite pyrosequencing. Methods in Molecular Biology. 1049, 95-107 (2013).
  38. Truong, D. J., et al. Development of an intein-mediated split-Cas9 system for gene therapy. Nucleic Acids Research. 43, (13), 6450-6458 (2015).
  39. Nishimasu, H., et al. Crystal Structure of Staphylococcus aureus Cas9. Cell. 162, (5), 1113-1126 (2015).
  40. Ran, F. A., et al. In vivo genome editing using Staphylococcus aureus Cas9. Nature. 520, (7546), 186-191 (2015).
  41. Van Lint, C., Ghysdael, J., Paras, P., Burny, A., Verdin, E. A transcriptional regulatory element is associated with a nuclease-hypersensitive site in the pol gene of human immunodeficiency virus type 1. Journal of Virology. 68, (4), 2632-2648 (1994).
  42. Van Lint, C., et al. Transcription factor binding sites downstream of the human immunodeficiency virus type 1 transcription start site are important for virus infectivity. Journal of Virology. 71, (8), 6113-6127 (1997).
  43. Goffin, V., et al. Transcription factor binding sites in the pol gene intragenic regulatory region of HIV-1 are important for virus infectivity. Nucleic Acids Research. 33, (13), 4285-4310 (2005).
  44. Kim, Y. S., et al. Artificial zinc finger fusions targeting Sp1-binding sites and the trans-activator-responsive element potently repress transcription and replication of HIV-1. Journal of Biological Chemistry. 280, (22), 21545-21552 (2005).
  45. Kantor, B., et al. Notable reduction in illegitimate integration mediated by a PPT-deleted, nonintegrating lentiviral vector. Molecular Therapy. 19, (3), 547-556 (2011).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics