Eine konvergierende Strategie für die Generierung einer virtually Sequenced cDNA Library aus unreferenzierten pazifischen Austern

Bioengineering

Your institution must subscribe to JoVE's Bioengineering section to access this content.

Fill out the form below to receive a free trial or learn more about access:

 

Summary

Wir beschreiben eine Strategie, wie MAN RNA-Proben aus nicht referenzierten pazifischen Austernproben verwendet, und bewerten das genetische Material im Vergleich mit öffentlich verfügbaren Genomdaten, um eine virtuell sequenzierte cDNA-Bibliothek zu erzeugen.

Cite this Article

Copy Citation | Download Citations | Reprints and Permissions

Lyu, Y. M., Li, Y. Q., Song, H. B., Guo, J., Wang, T., Liu, L., Yedid, G., Voglmeir, J. A Converging Strategy for the Generation of a Virtually Sequenced cDNA Library from Unreferenced Pacific Oysters. J. Vis. Exp. (148), e59462, doi:10.3791/59462 (2019).

Please note that all translations are automatically generated.

Click here for the english version. For other languages click here.

Abstract

Der Zugang zu biologischem Material von Referenzarten, die zuvor in Schlüsselexperimenten wie der Entwicklung neuartiger Zelllinien oder Genomsequenzierungsprojekten verwendet wurden, ist aufgrund der verbrauchsfähigkeit der Proben. Obwohl sie inzwischen weit verbreitet sind über die Pazifikküsten Asiens, Australiens und Nordamerikas, sind einzelne pazifische Austernexemplare genetisch sehr vielfältig und daher nicht direkt als Ausgangsmaterial für Genbibliotheken geeignet. In diesem Artikel zeigen wir die Verwendung von unreferenzierten pazifischen Austernproben, die aus regionalen Fischmärkten gewonnen werden, um cDNA-Bibliotheken zu generieren. Diese Bibliotheken wurden dann mit dem öffentlich zugänglichen Austerngenom verglichen, und die engste verwandte Bibliothek wurde mit den mitochondrialen Referenzgenen Cytochrome C Oxidase Subunit I (COX1) und NADH Dehydrogenase (ND) ausgewählt. Die Eignung der generierten cDNA-Bibliothek wird auch durch Klonen und Expression von zwei Genen demonstriert, die die Enzyme UDP-Glucuronsäure-Dehydrogenase (UGD) und UDP-Xylose-Synthase (UXS) kodieren, die für die Biosynthese von UDP-Xylose aus UDP-Glucose.

Introduction

Der Erwerb von lebendem biologischem Material kann aufgrund langer Lieferzeiten, unternehmerischer Argumentation oder länderspezifischer Zollvorschriften eine Herausforderung darstellen. Alternativ kann das benötigte biologische Material auch aus phänotypisch identischen Proben entnommen werden. Diese Proben können jedoch auf der Ebene des Genotyps erheblich variieren, und daher werden Vergleiche mit digital gespeicherten Referenzgenomen derselben Art aufgrund der Inkompatibilität des neu beschafften Materials mit bestehenden DNA-Amplifikationsmethoden. Die Sequenzierung hochkonservierter Gene einzelner Proben ist ein weit verbreitetes und leistungsfähiges Werkzeug zur Identifizierung von Arten1, wie konservierte mitochondriale Gene, die häufig als Referenzgene für die Qualitätsbewertung von cDNA-Bibliotheken verwendet werden2 ,3,4,5,6. Die zugrunde liegende Begründung für die hier vorgestellte Methode ist, dass eine hohe Konservierung von mitochondrialen Gensequenzen in einzelnen anonymen Austernproben im Vergleich zu den entsprechenden Sequenzen des Referenzgenoms darauf hindeutet, dass andere Gene geringe Divergenz angesichts der im Allgemeinen schnelleren Rate der mitochondrialen DNA-Evolution im Vergleich zur Kern-DNA7, die die Amplifikation und Isolierung einer Vielzahl wissenschaftlich und industriell relevanter Gene ermöglicht, indem einfach öffentlich verfügbaren Sequenzierungsdaten als Referenz.

Das übergeordnete Ziel der hier beschriebenen Methode ist es, einen optimierten Workflow für die Erzeugung einer virtuell sequenzierten Austern-cDNA-Bibliothek zu präsentieren, die als Vorlagen-DNA für das Klonen von Austerngenen verwendet werden kann. Bei der virtuellen Sequenzierung wird die de novo genome Sequenzierung umgangen; Stattdessen wird eine bekannte, digital gespeicherte Referenzsequenz direkt verwendet, um Primer für die Produktion von cDNAs zu verwenden oder zu entwerfen, die schließlich eine Bibliothek umfassen (oder einer bereits vorhandenen Bibliothek hinzugefügt werden). Ziel ist es, eine konvergente cDNA-Bibliothek zu erzeugen, was bedeutet, dass Ähnlichkeiten zwischen den generierten cDNA-Sequenzen und der Referenzsequenz von niedriger bis hoher Divergenz geordnet werden können. Ein wesentlicher Vorteil der Verwendung der Cytochrom C Oxidase Untereinheit 1 (COX1) und NADH Dehydrogenase (ND) als Referenzgene ist, dass aufgrund der hohen Konservierung dieser mitochondrialen Gene auch stark geographisch disjunkte Austernproben profiliert werden können. Nachdem wir den Ansatz mit diesen etablierten Markern nachgewiesen haben, zeigen wir seine Anwendung bei zwei Enzymkandidaten, die an der Zuckernukleotid-Biosynthese beteiligt sind und von industrieller Relevanz sein können8,9, 10. Das biotechnologische Potenzial der pazifischen Auster ist noch unerforscht. Daher glauben wir, dass diese konvergierende Methode zur Vorbereitung einer virtuell sequenzierten cDNA-Bibliothek auch für nicht spezialisierte Forscher geeignet sein wird, die aus diesem relevanten biologischen Material cDNA erzeugen möchten.

Subscription Required. Please recommend JoVE to your librarian.

Protocol

HINWEIS: Eine schematische Übersicht ist in Abbildung 1dargestellt.

1. Probensammlung

  1. Erhalten Sie Austernproben. Halten Sie Austern während der Nacherntezeit, dem Transport und vor dem Laboreinsatz und -prozess innerhalb von 4-7 Tagen nach dem Kauf auf Eis.
    HINWEIS: Für dieses Protokoll wurden Austern vom Zhong Cai Wholesale Market in Nanjing (aus Ningde, Fujian, China und Lianyungang, Jiangsu, China), Haijie Aquatic Product Company in Qingdao (aus Qingdao, Shandong, China), Jucheng gekauft. Aquatic Product Company in Yantai (mit Ursprung in Yantai, Shandong, China) und Jinxiu Aquatic Product Company in Qingdao (aus Qingdao, Shandong, China)).

2. RNA-Isolierung durch Guanidinium-Thiocyanat-Phenol-Extraktion

  1. Herstellung einer Austerngewebeprobe
    1. Schneiden Sie ca. 100 mg homogenes Weichgewebe aus dem ungefähren geometrischen Zentrum jeder Austernprobe mit einem sterilisierten Skalpell aus und übertragen Sie die Proben in flüssigen Stickstoff.
    2. Den restlichen Teil der Austern durch Einfrieren bei -80 °C für 1 h einschläfern und als biologischen Abfall entsorgen.
    3. Schleifen Sie das blitzgefrorene Austerngewebe in einem Mörtel (200 ml), gefüllt mit 50 ml flüssigem Stickstoff, zu einem feinen Pulver.
    4. 75 mg des gefrorenen Gewebes jeder Probe in ein steriles 1,5 ml Zentrifugenrohr wiegen und mit 1 ml guanidinium thiocyanat-phenol Extraktionsreagenz vermischen. Zentrifugieren Sie die Probe bei 14.000 x g bei 4 °C für 15 min.
  2. Den Überstand auf ein neues 1,5 ml Zentrifugenrohr übertragen, 200 l Chloroform hinzufügen und gründlich mischen, indem man einen Wirbelmischer für 10-15 s verwendet, bis die Mischung milchig-weiß wird.
  3. Zentrifugieren Sie bei 14.000 x g bei 4 °C für 15 min und übertragen Sie die obere wässrige Schicht vorsichtig mit einer 200-L-Pipette, ohne die Interphase in ein neues 1,5 ml Zentrifugenrohr zu stören.
  4. Fügen Sie 500 l Isopropylalkohol hinzu und mischen Sie die Proben vorsichtig durch Inversion, dann lassen Sie die Proben für 20 min auf Eis. Zentrifuge bei 14.000 x g bei 4 °C für 8 min und entfernen Sie den Überstand.
  5. Setzen Sie jedes der Pellets in 1 ml 75% EtOH und Zentrifuge bei 14.000 x g bei 4 °C für 5 min. Entfernen Sie den gesamten Überstand.
  6. Wiederholen Sie Schritt 2.5 einmal. Trocknen Sie die Pellets für 6 min bei Raumtemperatur. Nicht länger trocknen; Andernfalls kann es schwierig sein, das RNA-Pellet im nächsten Schritt aufzulösen.
  7. Lösen Sie das getrocknete RNA-Pellet in 25 l DEPC (Diethylpyrocarbonat)-behandeltem Wasser und halten Sie die Röhre auf Eis. Verwenden Sie RNA-Proben innerhalb von 24 h.

3. cDNA-Bibliotheksgenerierung durch Reverse-Transkription

  1. Für jede RNA-Probe ein Reaktionsgemisch unter Verwendung eines kommerziellen Reverse-Transkriptionssystems unter Verwendung einer 10-L-Pipette vorbereiten: Fügen Sie 4 L MgCl 2-Lösung, 2 l 10x Reaktionspuffer, 2 l dNTP-Lösung, 0,5 l RNase-Inhibitor, 0,7 l AMV Reverse hinzu. Transkriptase, 0,5 l Oligo(dT) 15 Primer, 1 l der extrahierten RNA-Probe und 9,3 l H2O in eine 300-L-PCR-Röhre.
  2. Inkubationsgemisch in einem PCR Thermocycler für 60 min bei 42 °C inkubieren und dann die Temperatur für 5 min auf 95 °C erhöhen.
  3. Bewahren Sie die generierte cDNA-Bibliothek bis zu 12 Monate bei -20 °C auf.

4. Mitochondriale Genverstärkung und -reinigung

  1. Bereiten Sie die PCR-Mischung mit einer 10-L-Pipette vor. Fügen Sie 0,25 l (1,25 U) Hochtreue-DNA-Polymerase, 2 l dNTP-Lösung (2,5 mM pro dNTP), 0,5 l des COX1- oder ND-Vorwärtsprimers (100 m), 0,5 l des entsprechenden COX1- oder ND-Reverse-Primers (100 m), 1 l der cDNA-Bibliothek hinzu. , 5 l 5x Pufferlösung und 16 l destilliertes H2O in ein 300-L-PCR-Rohr.
  2. PcR-Verstärkung mit folgenden Parametern: Nach einem ersten Denaturierungsschritt bei 95 °C (Dauer 5 min), 35 PCR-Reaktionszyklen bestehend aus einem Glühschritt bei 55 °C (30 s), Dehnungsschritt bei 72 °C (2 min) und Denaturierungsschritt bei 95 °C (30 s) , führen Sie einen abschließenden Dehnungsschritt für 5 min bei 72 °C durch.
  3. Verwenden Sie 5 l des PCR-Produkts, um durch Agarose-Gel-Elektrophorese die Qualität des erhaltenen PCR-Produkts zu überprüfen. Beobachten Sie das verstärkte COX1- oder ND-Gen als einzelband bei 759 bzw. 748 Basenpaaren.
  4. Reinigen Sie den Rest des PCR-Produkts mit einem PCR-Reinigungskit.
    1. Fügen Sie der Probe 100 l der Lösung 'PCR-A' (DNA-Bindungspuffer, der hohe Konzentrationen von chaotropen Salzenenthält 11) hinzu. Wirbel kurz, um den Inhalt zu mischen.
    2. Legen Sie die Reinigungssäule in ein 2 ml Zentrifugenrohr. Pipette die Reaktionsmischung von 4.4.1. in die Spalte. Zentrifuge bei 14.000 x g für 1 min bei Raumtemperatur.
    3. Entsorgen Sie das Filtrat aus dem Zentrifugenrohr. Geben Sie die Säule in das 2 ml Zentrifugenrohr zurück, fügen Sie 700 l der Lösung 'W2' in die Säule und Zentrifuge bei 14.000 x g für 1 min bei Raumtemperatur ('W2' ist eine Waschlösung, die hohe Konzentrationen von Ethanol zur Entfernung von Restchaotropen enthält Salze aus der Reinigungskolonne).
    4. Entsorgen Sie den Filtrat und geben Sie die Säule an das 2 ml Zentrifugenrohr zurück. Fügen Sie der Säule und zentrifugieren bei 14.000 x g für 1 min bei Raumtemperatur 400 l Lösung 'W2' in die Säule und Zentrifuge ein.
    5. 1 ml entionisiertes Wasser in einer Metallblockheizung auf 65 °C vorheizen. Übertragen Sie die Säule in ein neues 1,5 ml Zentrifugenrohr. Pipette 25 l des 65 °C heißen vorgewärmten entionisierten Wassers in die Mitte der weißen Säulenmembran. Lassen Sie die Membran 1 min bei Raumtemperatur einweichen.
    6. Zentrifugieren Sie bei 14.000 x g für 1 min bei Raumtemperatur und entsorgen Sie die Säule.
  5. Lagern Sie das gereinigte PCR-Produkt bis zu 12 Monate bei -20 °C.

5. Mitochondriale Gensequenzierung und Vergleich

  1. Senden Sie die gereinigten PCR-Proben aus Schritt 4.5 für die Sanger-Sequenzierung mit den entsprechenden COX1- oder ND-Vorwärtsprimern als Sequenzierungsprimer. Optional können die COX1- oder ND-Reverse-Primer auch für die bidirektionale Sequenzierung verwendet werden.
  2. Vergleichen Sie nach dem Abrufen der Sequenzierungsergebnisse die Sequenzen mit der Genomsequenz des pazifischen Austernreferenzstamms (NCBI-Taxonomie-ID: 29159) mit dem NCBI-Nukleotid-BLAST-Online-Tool (blast.ncbi.nlm.nih.gov) (Abbildung2 und Abbildung 3) ).

6. Anwendung der cDNA-Bibliothek zum Klonen der Gene MgUGD und MgUXS

  1. Amplizieren und reinigen Sie die MgUGD- und MgUXS-Gene mit den jeweiligen Vorwärts- und Reverse-Primern von MgUGD und MgUXS durch PCR nach den Schritten 4.1. bis 4.4.
  2. Übertragen Sie 2 l Verdauungspuffer (10x konzentriert) und 6 l entionisiertes Wasser in ein 1,5 ml Zentrifugenrohr. Fügen Sie 10 L der gereinigten MgUGD- oder MgUXS-PCR-Produkte zusammen mit den Restriktionsendonukleasen Nde I und Xho I (je 1 L, 20 U) hinzu. Bei 37 °C für 3 h inkubieren.
  3. Bereiten Sie den vorverdauten pET-30a-Vektor vor: Übertragen Sie 500 ng des pET-30a-Vektors in ein neues 1,5 ml Zentrifugenrohr und aufladen Sie das Volumen mit entionisiertem Wasser auf 16 l. Fügen Sie 2 L Verdauungspuffer (10x konzentriert) zusammen mit den Restriktionsendonukleasen Nde I und Xho I (je 1 L, 20 U) hinzu.
    1. Nach dem Inkubieren der Mischung bei 37 °C für 3 h 1 l alkalische Phosphatase (1 U) hinzufügen und bei 37 °C für eine weitere Stunde inkubieren. Inaktivieren Sie die alkalische Phosphatase durch Erhitzen bei 75 °C für 10 min in einem vorgeheizten Metallblocker.
  4. Übertragen Sie 4 l der verdauten MgUGD- oder MgUXS-DNA-Produkte in frische 1,5 ml Zentrifugenröhrchen und fügen Sie 4 l des verdauten pET-30a-Vektors hinzu. Fügen Sie 1 l Ligationspuffer (10x), 1 l T4 Ligase (3 U) hinzu und inkubieren Sie das Reaktionsgemisch bei 22 °C für 3 h.
  5. Transformieren Sie elektrokompetente E. coli Mach1 Competent Cells durch Elektroporation mit den Ligationsprodukten. Verteilen Sie die transformierten Zellen auf LB-Agarplatten, die 50 g/ml Kanamycin enthalten. Inkubieren Sie Zellen bei 37 °C für 16 h.
  6. Überprüfen Sie Kolonien auf die gewünschte Einfügung durch Sanger-Sequenzierung mit den Plasmid-spezifischen T7-Promotor- und Terminatorgrundierungen. Bereiten Sie Plasmide aus den validierten bakteriellen Klonen vor.

7. Expressions- und Aktivitätstests von MgUGD und MgUXS

  1. Transformieren Sie E. coli BL21 (DE3) Kompetente Zellen mit Plasmiden, die die MgUGD- und MgUXS-Gene tragen, und verbreiten Sie die transformierten Zellen auf LB-Agarplatten, die 50 g/ml Kanamycin enthalten. Inkubieren Sie Zellen bei 37 °C für 16 h.
  2. Kultivieren Sie eine einzelne Kolonie in 5 ml LB Medium mit 50 g/ml Kanamycin über Nacht. Übertragen Sie die Kultur in 400 ml LB Medium und schütteln Sie kontinuierlich bei 200 Umdrehungen pro Minute bei einer Temperatur von 37 °C, bis die optische Dichte bei einer Wellenlänge von 600 nm (OD600) eine Absorption von etwa 0,5 erreicht.
    1. Reduzieren Sie die Inkubationstemperatur auf 20 °C und fügen Sie 400 l Isopropyl-D-Thiogalactopyranosid hinzu (Konzentration 1 M). Induzieren Sie die Expression der rekombinanten Proteine für 3 h.
  3. Erntezellen durch Zentrifugation bei 4.500 x g für 15 min bei 4 °C. Pellets in 10 ml Lysepuffer (100 mM NaCl, 50 mM Tris/HCl, 1% Triton X-100, 1 mM Phenylmethylsulfonyl-Fluorid (PMSF), pH 8,0) suspendieren.
  4. Stören Sie Zellen durch Beschallung für 20 min (40 Ein-/Aus-Zyklen mit 20 m Amplitude für 15 s bei 4 °C). Zentrifuge bei 14.000 x g bei 4°C für 20 min und den Überstand für den Aktivitätstest sammeln.
  5. Führen Sie den Aktivitätstest von MgUGD durch Inkubation von 2 l des Zelllysats mit 2 l UDP-Glucose (10 mM), 4 l NAD+ (10mM), 4 l MgCl2 (10 mM), 2 l Tris/HCl-Puffer (500 mM, pH 7,5) und 6 l deionisiertem H2O in einem neuen 1,5-L-Puffer (500 mM, pH 7,5) und 6 mL Zentrifugenrohr und inkubieren bei 37 °C für 30 min.
  6. Führen Sie den Aktivitätstest von MgUXS durch Inkubation von 2 l des Zelllysats mit 2 l UDP-Glucuronsäure (10 mM), 2 l Tris/HCl-Puffer (500mM, pH 7,5) und 14 l deionisiertem H2 O in einem neuen 1,5 ml Zentrifugenrohr und Inkubation bei 37 °C für 30 min durch.
  7. Die Reaktionen in Schritt 7.5 und 7.6 durch Zugabe von 20 l Methanol und 40 l Chloroform zu jedem Gemisch ablöschen. Nach dem Wirbeln der Probenmischungen zentrifugieren Sie bei 14.000 x g für 6 min bei 4 °C und sammeln Sie die obere wässrige Schicht jedes Rohres.
  8. Analysieren Sie die Reaktionsprodukte mit MALDI-TOF-Massenspektrometrie im negativen Ionisationsmodus im m/z-Bereich von 500-700. Mischen Sie 1 l Probenmischung mit 1 l 2,5-Dihydroxybenzoesäure-Probenmatrix (1% w/V in 50% wässrigem Acetonitril). Beachten Sie die erwarteten m/z-Werte bei 579 bzw. 535 für UDP-Glucuronsäure bzw. UDP-Xylose (Abbildung 4).

Subscription Required. Please recommend JoVE to your librarian.

Representative Results

Abbildung 1 zeigt eine schematische Übersicht über die beschriebene Präparationsmethode der konvergenten cDNA-Bibliothek, die von pazifischen Austernpersonen abgeleitet wurde. Abbildung 2 zeigt die Sequenzen der COX1- und ND-Gene einer entfernt verwandten Austernprobe mit hoher Divergenz von den COX1- und ND-Gensequenzen des Referenzmaterials. Abbildung 3 zeigt die Sequenzen der COX1- und ND-Gene einer eng verwandten Austernprobe mit geringer Divergenz von den COX1- und ND-Gensequenzen des Referenzmaterials. Abbildung 4 zeigt die erfolgreiche Anwendung der cDNA-Bibliothek, um die industrierelevanten Gene MgUGD und MgUXS zu klonen.

Figure 1
Abbildung 1 : Schematische Übersicht der beschriebenen Analysemethode für molekulare Identifizierung von Pazifisches Austernexemplar Verwendung von COX1 und ND als Referenzgene. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 2
Abbildung 2 : Sequenzausrichtung der COX1- und ND-Gensequenzen einer stark divergierenden Probe im Vergleich zu den COX1- und ND-Gensequenzen aus der Referenz Pazifische Auster Dehnung. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 3
Abbildung 3 : Sequenzausrichtung der COX1- und ND-Gensequenzen einer eng verwandten Probe im Vergleich zu den COX1- und ND-Gensequenzen aus der Referenz Pazifische Auster Dehnung. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Figure 4
Abbildung 4 : Schematische Übersicht über molekulares Klonen, rekombinante Expression und Nachweis der Reaktionsprodukte von MgUGD und MgUXS. Bitte klicken Sie hier, um eine größere Version dieser Abbildung anzuzeigen.

Subscription Required. Please recommend JoVE to your librarian.

Discussion

Das vorgestellte Protokoll ermöglicht die genetische Identifizierung von nicht referenzierten Austernproben mit ähnlichem Phänotyp aus regionalen Fischmärkten im Vergleich der COX1- und ND-Gene mit einer öffentlich zugänglichen Austern-DNA-Genomdatenbank. Die Bedeutung dieser Methode liegt in ihrer Einfachheit, da für die Auswertung der virtuellen cDNA-Bibliothek nur eine einzige PCR-Reaktion erforderlich ist. Die beiden konservierten mitochondrialen COX1- und ND-Gene wurden aus einer cDNA-Bibliothek verstärkt, die durch reverse Transkription von RNA-Extrakten aus jeder Auster erzeugt wurde. Die Methode der RNA-Isolierung (Schritt 2.1) wurde durch direktes Schleifen des Austerngewebes in flüssigem Stickstoff vereinfacht. Nach der Sequenzierung der COX1- und ND-Gene der einzelnen Proben ergaben Sequenzausrichtungen, dass einige Proben eine hohe Ähnlichkeit mit dem Referenzstamm aufweisen. Der nächste Verwandte zeigte die vollständige Identität sowohl der COX1- als auch der ND-Gensequenzen.

Die wichtigsten Schritte dieses Verfahrens sind der RNA-Extraktionsschritt; Um den RNA-Abbau zu minimieren, ist es wichtig, die Zeit zwischen der Ernte des Austerngewebes und der RNA-Extraktion zu reduzieren.

Erfolgreiches Klonen wurde vor kurzem durch das Klonen des Austern-UGE-Gens12 und hierin durch Klonen der Gene MgUGD und MgUXS13veranschaulicht, die die Praktikabilität der generierten cDNA-Bibliothek validierten und das Klonen einer beliebigen Anzahl von Genen von Interesse ermöglichten. ohne umständliche Klonstrategien mit degenerierten Primern. Diese Methode der molekularen Identifizierung durch Amplifikation der COX1- und ND-Gene zur Erzeugung virtuell sequenzierter cDNA-Bibliotheken kann auch in zukünftigen Anwendungen für andere biologische Materialien verwendet werden, die keine physikalischen Proben referenzierter Genome enthalten. verfügbar.

Subscription Required. Please recommend JoVE to your librarian.

Disclosures

Die Autoren haben nichts zu verraten.

Acknowledgments

Diese Arbeit wurde teilweise von der Natural Science Foundation of China (Grant-Nummern 31471703, A0201300537 und 31671854 an J.V. und L.L., Grant-Nummer 31470435 an G.Y.) und dem 100 Foreign Talents Plan (Grant-Nummer JSB2014012 an J.V.) unterstützt.

Materials

Name Company Catalog Number Comments
Chemicals:
1% Triton X-100 Solarbio 9002-93-1 *Alternative distributors possible
2,5-Dihydroxybenzoic acid Alfa Aesar 490-79-9 *Alternative distributors possible
Acetonitrile Merck 75-05-8 *Alternative distributors possible
Agarose for molecular biology Biowest Chemicals 111860 *Alternative distributors possible
Ampicilin Solarbio 69-52-3 *Alternative distributors possible
Chloroform Lingfeng, Shanghai 67-66-3 *Alternative distributors possible
DEPC water Thermo Scientific R0601
Ethanol Jinhuada, Guangzhou 64-17-5 *Alternative distributors possible
Guanidinium thiocyanate-phenol reagent Invitrogen 15596018 TRIzol reagent
Imidazole Energy Chemical 288-32-4 *Alternative distributors possible
Isopropyl alcohol Nanjing Chemical Reagent 67-63-0 *Alternative distributors possible
Isopropyl β-D-thiogalactopyranoside Solarbio 367-93-1 *Alternative distributors possible
Kanamycin Solarbio 25389-94-0 *Alternative distributors possible
LB Agar Thermo Fisher 22700025 *Alternative distributors possible
LB Broth Thermo Fisher 10855021 *Alternative distributors possible
Methanol Jinhuada, Guangzhou 67-56-1 *Alternative distributors possible
MgCl2 hexahydrate Xilong Huagong 7791-18-6 *Alternative distributors possible
NaCl Xilong Huagong 7647-14-5 *Alternative distributors possible
NAD+ Duly Biotech 53-84-9 *Alternative distributors possible
Phenyl-methylsulfonyl fluoride Macklin 329-98-6 *Alternative distributors possible
Tris Solarbio 77-86-1 *Alternative distributors possible
UDP-glucose Wuhu Nuowei Chemicals 28053-08-9 *Alternative distributors possible
UDP-glucuronic acid SIGMA 63700-19-6 *Alternative distributors possible
Tools/Instruments:
MALDI-TOF mass spectrometer Bruker Autoflex *Alternative distributors possible
Metal block heater Long Yang Scientific Instruments Thermoshaker HB20 *Alternative distributors possible
PCR thermocycler Hema 9600 *Alternative distributors possible
Enzyme and Kits:
10×Ligation buffer Thermo Scientific B69 *Alternative distributors possible
5×PrimeSTAR buffer Takara 9158A
Alkaline phosphatase ThermoFisher FastAP EF0654 *Alternative distributors possible
COX forward primer Genscript ATGTCAACAAATCATTTAGACATTG
COX reverse primer Genscript ACTTGACCAAAAACATAAGACATG
Cutsmart Buffer NEB B7204S *Alternative distributors possible
dNTP mix Invitrogen 18427088
MgUGD forward primer Genscript ACATATGACCCTGTCCAAGATCTGTTGT
MgUGD reverse primer Genscript ACTCGAGACTCTGTGAGGCGGTGGAG
MgUXS forward primer Genscript CCATATGGCAGAATCCTCACAATCAC
MgUXS reverse primer Genscript ACTCGAGCACATTTTTGAATTTGCAGACGT
ND forward primer Genscript ATGAGATGGCAATTATTTTTTAAT
ND reverse primer Genscript ATGTATTTTGGAAAAATCTCCAC
PCR Cleanup Kit AxyGen AP-PCR-250 *Alternative distributors possible
pET-30a(+) vector Merck Millipore 69909

DOWNLOAD MATERIALS LIST

References

  1. Blaxter, M. L. The promise of a DNA taxonomy. Philosophical transactions of the Royal Society of London. Series B, Biological. 359, (1444), 669-679 (2004).
  2. Wen, J., et al. Species identification of dried shellfish (oyster, clam and mussel) products sold on the Chinese market. Food Control. 90, 199-204 (2018).
  3. Zhang, H., et al. Mitochondrial cob and cox1 genes and editing of the corresponding mRNAs in Dinophysis acuminata from Narragansett Bay, with special reference to the phylogenetic position of the genus Dinophysis. Applied and Environmental Microbiology. 74, (5), 1546-1554 (2007).
  4. Sell, J., Spirkovski, Z. Mitochondrial DNA differentiation between two forms of trout Salmo letnica, endemic to the Balkan Lake Ohrid, reflects their reproductive isolation. Molecular Ecology. 13, 3633-3644 (2004).
  5. Karadjian, G., et al. Highly rearranged mitochondrial genome in Nycteria parasites (Haemosporidia) from bats. Proceedings of the National Academy of Sciences of the United States of America. 113, (35), 9834-9839 (2018).
  6. Morga, B., et al. Identification of genes from flat oyster Ostrea edulis as suitable housekeeping genes for quantitative real time PCR. Fish and Shellfish Immunology. 29, (6), 937-945 (2010).
  7. Delsuc, F., et al. Molecular systematics of armadillos (Xenarthra, Dasypodidae): contribution of maximum likelihood and Bayesian analyses of mitochondrial and nuclear genes. Molecular Phylogenetics and Evolution. 28, (2), 261-265 (2005).
  8. Wei, S., et al. Discovery and Biochemical Characterization of UDP-Glucose Dehydrogenase from Akkermansia muciniphila. Protein & Peptide Letters. 24, (8), 735-741 (2017).
  9. Gu, B., et al. Discovery and Biochemical Characterization of the UDP-Xylose Biosynthesis Pathway in Sphaerobacter thermophilus. Protein & Peptide Letters. 23, (12), 1103-1110 (2016).
  10. Duan, X. C., et al. Functional characterization of the UDP-xylose biosynthesis pathway in Rhodothermus marinus. Applied Microbiology and Biotechnology. 99, (22), 9463-9472 (2015).
  11. Vogelstein, B., Gillespie, D. Preparative and analytical purification of DNA from agarose. Proceedings of the National Academy of Sciences of the United States of America. 76, (2), 615-619 (1979).
  12. Song, H. B., et al. UDP-glucose 4-epimerase and β-1,4-galactosyltransferase from the oyster Magallana gigas as valuable biocatalysts for the production of galactosylated products. International Journal of Molecular Sciences. 19, (6), 1600 (2018).
  13. Gainey, P. A., Phelps, C. F. Uridine diphosphate glucuronic acid production and utilization in various tissues actively synthesizing glycosaminoglycans. Biochemical Journal. 128, (2), 215-227 (1972).

Comments

0 Comments


    Post a Question / Comment / Request

    You must be signed in to post a comment. Please or create an account.

    Usage Statistics